ISSN 131A-DSD7 Pages 253-482 ■ Year 2018, Vol. 65, No. 2
ActaChimicaSlc Acta Chimica Slc Slovenica ActaC
65/2018
http://acta.chem-soc.si
9771318020004
EDITOR-IN-CHIEF
KSENIJA KoGEJ
Slovenian Chemical Society, Hajdrihova 19, SI-1000 Ljubljana, Slovenija, E-mail: ACSi@fkkt.uni-lj.si, Telephone: (+386)-1-479-8538
ASSOCIATE EDITORS
Janez Cerkovnik, University of Ljubljana, Slovenia Krištof Kranjc, University of Ljubljana, Slovenia Ksenija Kogej, University of Ljubljana, Slovenia Franc Perdih, University of Ljubljana, Slovenia Aleš Podgornik, University of Ljubljana, Slovenia Helena Prosen, University of Ljubljana, Slovenia Damjana Rozman, University of Ljubljana, Slovenia
Melita Tramšek, Jožef Stefan Institute, Slovenia Irena Vovk, National Institute of Chemistry, Slovenia
ADMINISTRATIVE ASSISTANT
Marjana Gantar Albreht, National Institute of Chemistry, Slovenia
EDITORIAL BOARD
Wolfgang Buchberger, Johannes Kepler University, Austria Alojz Demšar, University of Ljubljana, Slovenia Stanislav Gobec, University of Ljubljana, Slovenia Marko Goličnik, University of Ljubljana, Slovenia Günter Grampp, Graz University of Technology, Austria Wojciech Grochala, University of Warsaw, Poland Danijel Kikelj, Faculty of Pharmacy, Slovenia Janez Košmrlj, University of Ljubljana, Slovenia Blaž Likozar, National Institute of Chemistry, Slovenia Mahesh K. Lakshman, The City College and
The City University of New York, USA
Janez Mavri, National Institute of Chemistry, Slovenia Friedrich Srienc, University of Minnesota, USA Walter Steiner, Graz University of Technology, Austria Jurij Svete, University of Ljubljana, Slovenia Ivan Švancara, University of Pardubice, Czech Republic Jiri Pinkas, Masaryk University Brno, Czech Republic Gašper Tavčar, Jožef Stefan Institute, Slovenia Christine Wandrey, EPFL Lausanne, Switzerland Ennio Zangrando, University of Trieste, Italy
Chairman
Branko Stanovnik, Slovenia Members
Josef Barthel, Germany
Udo A. Th. Brinkman, The Netherlands
Attilio Cesaro, Italy
Dusan Hadzi, Slovenia
Vida Hudnik, Slovenia
Venceslav Kaucic, Slovenia
ADVISORY EDITORIAL BOARD
Željko Knez, Slovenia Radovan Komel, Slovenia Janez Levec, Slovenia Stane Pejovnik, Slovenia Anton Perdih, Slovenia Slavko Pečar, Slovenia Andrej Petrič, Slovenia Boris Pihlar, Slovenia Milan Randic, Des Moines, USA
Jože Škerjanc, Slovenia Miha Tišler, Slovenia Durda Vasic-Rački, Croatia Marjan Veber, Slovenia Gorazd Vesnaver, Slovenia Jure Zupan, Slovenia Boris Žemva, Slovenia Majda Žigon, Slovenia
Acta Chimica Slovenica is indexed in: Chemical Abstracts Plus, Current Contents (Physical, Chemical and Earth Sciences), PubMed, Science Citation Index Expanded and Scopus. Impact factor for 2016 is IF = 0.983.
^creative Articles in this journal are published under Creative Commons Attribution 3.0 License tycommons http://creativecommons.org/iicenses/by/3.0/
Izdaja - Published by:
SLOVENSKO KEMIJSKO DRUŠTVO - SLOVENIAN CHEMICAL SOCIETY Naslov redakcije in uprave - Address of the Editorial Board and Administration Hajdrihova 19, SI-1000 Ljubljana, Slovenija
Tel.: (+386)-1-476-0252; Fax: (+386)-1-476-0300; E-mail: chem.soc@ki.si
Izdajanje sofinancirajo - Financially supported by: Slovenian Research Agency, Ljubljana, Slovenia National Institute of Chemistry, Ljubljana, Slovenia Jožef Stefan Institute, Ljubljana, Slovenia
Faculty of Chemistry and Chemical Technology at University of Ljubljana, Slovenia Faculty of Chemistry and Chemical Engineering at University of Maribor, Slovenia Faculty of Pharmacy at University of Ljubljana, Slovenia University of Nova Gorica, Nova Gorica, Slovenia
Acta Chimica Slovenica izhaja štirikrat letno v elektronski obliki na spletni strani http://acta.chem-soc.si. V primeru posvečenih številk izhaja revija tudi v tiskani obliki v omejenem številu izvodov.
Acta Chimica Slovenica appears quarterly in electronic form on the web site http://acta.chem-soc.si. In case of dedicated issues, a limited number of printed copies are issued as well.
Transakcijski račun: 02053-0013322846 Bank Account No.: SI56020530013322846-Nova Ljubljanska banka d. d., Trg republike 2, SI-1520 Ljubljana, Slovenia, SWIFT Code: LJBA SI 2X
Oblikovanje ovitka - Design cover: KULT, oblikovalski studio, Simon KAJTNA, s. p. Grafična priprava za tisk: Majanafin, d. o. o. Tisk-Printed by: Tiskarna Stušek, Ljubljana © Copyright by Slovenian Chemical Society
ActaChimicaSlovenica
Editorial
Dear authors, readers and reviewers of Acta Chimica Slovenica
Thanks to previous editorial teams, Editors-in-Chief, Advisory Board members and to devoted Slovenian chemists, Acta Chimica Slovenica (ACSi) is today a leading Slovenian journal in the broad field of chemistry. A lot of effort has been invested over the years to increase the quality of the journal and to make it internationally recognized. Previous Editorials summarize all the important achievements, milestones and people in the history of ACSi, who deserve thanks for this. It is not my intention to repeat all that in order not to miss even the smallest merit. In the extremely competitive field of scientific publishing, Acta Chimica Slovenica has an impact factor fluctuating around 1 and attracts contributions of scientists from Slovenia and abroad. From its inception, ACSi was a venue publishing mostly research works of Slovenian chemists, but it later developed into an international journal that nowadays publishes more articles contributed by foreign scientists. The interest of the latter to publish in ACSi has increased tremendously and along with that also the working load of the Associate Editors. In the first half of 2018, we have received almost 400 manuscripts, out of which around 80% are sent back to the authors already at the first stage of the reviewing process because they do not fulfill technical requirements of the journal or, which is more seldom, do not fit in the scope of the journal. This tells clearly that in order to keep the high level and regular appearance of the journal, the team of Associate Editors, together with reviewers and authors, has to work devotedly.
I would like to share some news about activities and changes in ACSi that happened since I took over as the Editor-in-Chief (EiC) in January 2018. Due to high costs of printing and limited financial funds, we had to stop with the production of hard copy issues of the journal. Now the journal is available only as an on-line version, except for issues dedicated to prominent Slovenian and other scientists; these will still be delivered also in a limited number of printed copies. At the same time we have introduced e-mail alerts of new issues that are distributed to members of the Slovenian Chemical Society and to all authors of manuscripts in that issue. Hopefully, such alerts will have a positive effect on the popularity and reading of the journal and will fill the gap that appeared after omitting hard copies.
In an effort to help authors to prepare better manuscripts we have updated Author Guidelines and we invite all to read them carefully before submitting your papers to ACSi. In strive for high quality of our journal, the most important concern of the Associate Editors and also of the authors themselves should be publishing original, innovative and high impact research. This requires competent and diligent reviewers, who freely devote their time to review the manuscripts and thus help authors and editors to produce better papers. We are truly indebted to the reviewers, as we know that reviewing is the critical and most time consuming step in this process. I take this opportunity to invite members of the Editorial and Advisory Boards of ACSi to help the Associate Editors in this task, if they are asked for advice or appraisal of contributions to the journal. With their comprehensive scientific experiences they can only enrich the magazine.
In addition to publishing Reviews, Scientific and Technical Articles and Short Communications, we have introduced a new type of contributions, Feature Articles (FAs), which are written on invitation of the editorial team. They should report on the latest activity of the author and his/her research group bearing the broad scope of ACSi in mind. The present issue of Acta Chimica Slovenica features a cover picture and the first Feature Article in this category written by our colleague Damjana Rozman and co-authors and offers an opportunity to promote this type of articles
to the readers of ACSi. The group of Damjana Rozman has received the award for one of the most excellent research achievements at the University of Ljubljana in 2017 for their work in the field of computational modelling of liver metabolism. We believe that such achievements should be honored and we are pleased that the authors were willing to make this contribution to ACSi. The ambition of the Associate Editors team is to have one (or possibly more) Feature Article in each issue. We therefore motivate all authors, readers, reviewers and other members of the scientific community to send short proposals for Feature Articles to the editorial board of ACSi for their consideration. At this point, I invite our colleagues from industry to participate as well by reporting on technologically important findings and innovations.
Some of the changes in ACSi are yet to happen, hopefully still in 2018. We would like to upgrade the web-page of ACSi and make it more contemporary, attractive and user friendly. This part depends on financial funds that have decreased substantially in the last years. ACSi is issued by the Slovenian Chemical Society (SCS), through which also the costs of journal production are covered with financial contributions from Slovenian Research Agency, National Institute of Chemistry, Jožef Stefan Institute, Slovenian Faculties, and other beneficiaries. The new president of SCS Albin Pintar is very cooperative in this
respect and understands that fast dissemination of scientific papers using new tools is nowadays the key to success. I hope that with our joint efforts Acta Chimica Slovenica will grow in its value and presence in the scientific community.
Finally, I have to say that the activities with which the editorial team of ACSi has started in 2018 would not be possible without inputs and hard work of the previous Editors of ACSi. Their dedicated work has put ACSi on the map of scientific publishing in pure and applied chemistry. Only on such solid foundations can we build on. I would sincerely like to thank the previous EiC Aleksander Pavko, for helping me do the first steps as the EiC and mediating to me his rich experience in editorship. Without his continuous help and encouragement my beginning would definitely be more difficult, so as without the always timely support of our administrative assistant Marjana Albreht Gantar and technical editor Stanislav Orazem. At the same time the group of Associate Editors of ACSi is really excellent and teaches me all what I do not know yet in the field of scientific publishing. Our common goal is to further improve Acta Chimica Slovenica through your help as well.
Ksenija Kogej Editor-in-Chief
June 20, 2018
Graphical Contents
Mm —
, ActaChimicaSlc fe Acta ChimicaS/6
oe Slovenica/lctaC _
Year 2018, Vol. 65, No. 2
feature ARTicLE
253—265	Biochemistry and molecular biology
Computational Modelling of Liver Metabolism and its Applications in Research and the Clinics
Tanja Cvitanovic Tomaš, Miha Moškon, Miha Mraz and Damjana Rozman
SciENTiFic papER
266—270	General chemistry
The Antioxidant Response System in Wheat Exposed to Pesticides and its Combined-induced oxidative Damage
Nilgun Candan Yucel, Elif Hakli Heybet and Ozay Ozgur Gokmen
Aiulwudwt Critic AdvHa
t/rwujn	SOOM/vgi	CATdVmsl	il
VftroJ	61.4Ï	15Z.2Î	
Imjktr'CP	M.sr	2II.3S"	st.»
kS"' CP	SMS		
îrrçkJ'DM	Ti.11	14T.I9	7S.SI"
Mraki'OM	I1W1"		7121
1 n^^'CP+Smft^J'	lli.CW"	lWHO	M a
271-277 Analyt ical chemistry
Simultaneous Sensitive Detection of Lead(II), Mercury(II) and Silver Ions Using a New Nucleic Acid-Based Fluorescence Sensor
Yuan Deng, Yinran Chen and Xiaodong Zhou
278-288 Analyt ical chemistry
A Highly Selective DNA Sensor Based on Graphene
Üxide-Silk Fibroin Composite and AuNPs
as a Probe Oligonucleotide Immobilization Platform
Ali Benvidi, Zohreh Abbasi, Marzieh Dehghan Tezerjani, Maryam Banaei, Hamid Reza Zare, Hossein Molahosseini and Shahriar Jahanbani
289-295 Phy sical chemistry
Interaction of HF, HBr, HCl and HI Molecules with Carbon Nanotubes
Wiem Felah Gtari and Bahoueddine Tangour
296-302 Physical chemistry
Theoretical Study of Ability of Boron Nitride Nanocone to Oxidation of Sulfur Monoxide
Xuewu Zuo, Kourosh Behradfar, Jia-Bao Liu, Milad Janghorban Lariche and Meysam Najafi
303-311 Phy sical chemistry
Possibility of C38 and Si19Ge19 Nanocages in Anode of Metal Ion Batteries: Computational Examination
Rong-Jun Bie, Muhammad Kamran Siddiqui, Razieh Razavi, Milad Taherkhani and Meysam Najafi
312-318 Applied chemistry
Effect of Copper Alloying on Electro-Catalytic Activity of Nickel for Ethanol Oxidation in Alkaline Media
Niloufar Bahrami Panah, Iman Danaee, Mahmood Payehghadr and Afrooz Madahi
319—327 Materials science
Solvothermal Synthesis of Znü-Nitrogen Doped Graphene Composite and its Application as Catalyst for Photodegradation of Organic Dye Methylene Blue
Rajinder Singh, Manesh Kumar, Heena Khajuria, Jigmet Ladol, and Haq Nawaz Sheikh
O,
N doped Gripheat ZoO
328-332 Phy sical chemistry
DFT Study of the Reaction Mechanism of N-(Carbomylcarbamothioyl) Benzamide
Felix Odame
333-343
inorganic chemistry
Biological Significance of Hetero-Scaffolds Based Gold(III) Complexes
Darshana N. Kanthecha, Dilip B. Raval, Vasudev R. Thakkar and Mohan N. Patel
S 4>	D«* ":itlu>s I
i Z'
ami
Molccular modeling
344-353
Materials
Polypropylene Blends with m-EPR Copolymers: Mechanical and Rheological Properties
Iztok Švab, Andela Pustak, Matjaž Denac, Andrijana Sever Škapin, Mirela Leskovac, Vojko Musil and Ivan Šmit
354—364 General chemistry
Capsicum annuum Fruit Extract: A Novel Reducing Agent for the Green Synthesis of ZnO Nanoparticles and Their Multifunctional Applications
Haraluru Shankraiah Lalithamba, Mahadevaiah Raghavendra, Kogali Uma, Kalanakoppal Venkatesh Yatish, Das Mousumi, and Govindappa Nagendra
365-371	i norganic chemistry
Phase Equilibria in the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 Section of the Tl-Pb-Bi-Sm-Te System
Samira Zakir Imamaliyeva, Alakbarzade Ganira Ilgar, Mahmudova Matanat Aydin, Amiraslanov Imameddin Rajabali and Mahammad Baba Babanly
372-379 inorganic chemistry
Synthesis, X-ray Structural Characterization, and DFT Calculations of Mononuclear Nickel(II) Complexes Containing Diamine and Methacrylate Ligands
Rasoul Vafazadeh, Mansoor Namazian, Behnoosh Shahpoori-Arani, Anthony C. Willis and Paul D. Carr
380-387 Analytical chemistry
Determination of Titanium Dioxide Content in Bauxites Using X-ray Fluorescence Spectrometry by Fusion and by Pressing
Dragana Blagojevic, Dragica Lazic, Dragana Keselj, Gordana Ostojic and Mugdin Imamovic
388-393 Analytical chemistry
Thin-Layer Chromatography: an Efficient Technique for the Optimization of Dispersive Liquid-Liquid Microextraction
Elena Kupcova, Katarina Reiffova and Yaroslav Bazel'
E2	
after DLLME	
belore DLLMÈ^y\_	
	
0 10	ÎC 30 40
Migration distance (mm)
394-400 General chemistry
The Accuracy of Macro-Submicro-Symbolic Language of Future Chemistry Teachers
Dusica D. Rodic, Tamara N. Roncevic and Mirjana D. Segedinac
401-406 General chemistry
Synthesis of Cyclic and Acyclic Pyrimidine Nucleosides Analogues with Anticipated Antiviral Activity
Mohamed F. El-Shehry, Emad M. El Telbani and Mohamed I. Hegab
407-415 i norganic chemistry
Investigation of High-Activity Activated Carbon-Supported Co-Cr-B Catalyst in the Generation of Hydrogen from Hydrolysis of Sodium Borohydride
Orhan Baytar
416-428 i norganic chemistry
Copper(II) Schiff Base Complexes with Catalyst Property: Experimental, Theoretical, Thermodynamic and Biological Studies
Sheida Esmaielzadeh and Elham Zarenezhad
429-437 Materials science
Solvothermal Synthesis and Photocatalytic Activity of BiOBr Microspheres with Hierarchical Morphologies
Adriana C. Mera, Carlos A. Rodríguez, Héctor Valdés, Andres F. Jaramillo, David Rojas and Manuel F. Meléndrez
438—447	Chemical, biochemical and environmental engineering
Recovery of Antioxidant Compounds from Aronia Filter Tea Factory by -Product: Novel Versus Conventional Extraction Approaches
Aleksandra Gavaric, Milica Ramic, Jelena Vladic, Branimir Pavlic, Robert Radosavljevic and Senka Vidovic
448-461 Materials science
Hydrothermal Synthesis of Novel Magnetic Plate-Like Bi2O2CO3/CoFe2O4 Hybrid Nanostructures and Their Catalytic Performance for the Reduction of Some Aromatic Nitrocompounds
Parisa Zarringhadam and Saeed Farhadi
NHj
462-469 i norganic chemistry
Complex Formation in a Liquid-Liquid Extraction System Containing Vanadium(IV/V), 2,3-Dihydroxynaphtahlene and Thiazolyl Blue
Galya K. Toncheva, Zlatimir T. Zhelev, Vassil B. Delchev and Kiril B. Gavazov
	— — rvmwwT
i	-1 VfYVDH-UTT
ft	......... KÖfWTT
	
	V v
	.-- ----
300 JOO 50Q 600 700 300 900 Wavelength, nm
470-474	chem ical, biochemical and environmental engineering
Factors Influencing Imazapyr Herbicide Removal from Wastewater Using Photocatalytic Ozonation
Salma Bougarrani, Laila El Azzouzi, Soukaina Akel, Lahbib Latrach, Asmae Bouziani and Mohammed El Azzouzi
Time / min
SHORT cOMMUNICATION
475-480 physical chemistry
Interaction Between the Rubidium Cation and [2.2.2]Paracyclophane: Experimental and Theoretical Study
Emanuel Makrlik, Stanislav Böhm, David Sykora, Magdalena Kvlcalova and Petr Vanura
Feature Article
Computational Modelling of Liver Metabolism and its Applications in Research and the Clinics
Tanja Cvitanovic Tomas,1,t Miha Moskon,2,t Miha Mraz2 and Damjana Rozman1'*
1 Centre for Functional Genomics and Bio-chips, Institute of Biochemistry, Faculty of Medicine, University of Ljubljana, Slovenia
2 Faculty of Computer and Information Science, University of Ljubljana, Slovenia
t These authors contributed equally to this work. * Corresponding author: E-mail: damjana.rozman@mf.uni-lj.si Received: 15-05-2018
Abstract
Computational models of liver metabolism are gaining an increasing importance within the research community. Moreover, their first clinical applications have been reported in recent years in the context of personalised and systems medicine. Herein, we survey selected experimental models together with the computational modelling approaches that are used to describe the metabolic processes of the liver in silico. We also review the recent developments in the large-scale hepatic computational models where we focus on object-oriented models as a part of our research. The object-oriented modelling approach is beneficial in efforts to describe the interactions between the tissues, such as how metabolism of the liver interacts with metabolism of other tissues via blood. Importantly, this modelling approach can account as well for transcriptional and post-translational regulation of metabolic reactions which is a difficult task to achieve. The current and potential clinical applications of large-scale hepatic models are also discussed. We conclude with the future perspectives within the systems and translational medicine research community.
Keywords: Hepatic metabolism; systems medicine; modelling and simulation; large-scale metabolic models; NAFLD; liver
1. Introduction
Novel high throughput technologies and advanced computation impact the medicine quickly and influential-ly. Despite this, we still face a number of multifactorial diseases where the diagnosis and treatment remain a hurdle. This is the case as well for the multifactorial liver pathologies where the combinations of poorly defined genetic factors, together with environmental factors, interplay with each other and result in distinct disease phenotypes.
Non-alcoholic fatty liver disease (NAFLD) is the most prevalent form of chronic liver disease in the world. It affects 25% of the global adult population and as many as 1/3 of people in the developed world.1 The disease is manifested by a spectrum of liver pathologies ranging from simple steatosis (fatty liver) to liver cell injury with fibrosis and can end in cirrhosis or liver cancer (hepatocellular
carcinoma, HCC). The rising incidence of NAFLD has led to dramatic rise of liver cancer, a disease with poor outcomes and limited therapeutic options. Without treatment, HCC is fatal, with a 5-year survival of only five percent.
Due to individuality of humans and the combinatorial effects, it is virtually impossible to predict all combinations that can lead to a liver disease phenotype. It appears that in each individual a different combination of genetic and environmental factors might be responsible for the multifactorial disease appearance and progression. In addition, such multifactorial conditions combine during the aging. This limits the ability to predict the individuals' disease progression and to discover and/or apply efficient individualized treatments.
We are thus faced with a challenging situation where on one hand there is a large progress in understanding the
molecular players of the liver disease stages and the overlap with other diseases while the inconsistencies from different studies and different populations leave the impression that we are close to the starting point. A major challenge of today's medicine is thus to incorporate the technological revolution accompanied with expansion of various data into the everyday clinical practice. One example is the knowledge regarding the genetic bases of liver diseases. Despite multiple studies and numerous potentially involved genes, the polymorphisms of a single gene PNPLA3 named also adiponutrin, correlate with the non-alcoholic fatty liver disease progression to later disease stages, including the hepatocellular carcinoma (reviewed in2,3).
At present we do not understand the mechanisms and pathways that define a particular liver disease stage, we cannot predict the fate of disease progression nor can we treat NAFLD. To solve such complex questions we must apply innovative systems solutions that in addition to experimentation include also modelling and validation in clinical samples. These will be described in more details in the following chapters of the paper.
2. Selected Liver Disease Models that Produce Data for Computation
Cholesterol presents one of the most important metabolites synthesized within liver. Starting point of cholesterol biosynthesis is an acetyl-CoA molecule. The pathway consists of more than 20 enzyme catalysed reactions.4 Unlike the pre-squalene part of the cholesterol biosynthesis the exact order of reactions in the post-squalene part has not yet been clarified. Enzyme lanosterol 14a-demethylase i.e. CYP51, the evolutionary most conserved member of the cytochrome P450 family, catalyses the conversion of lanosterol to FF-MAS in the post-squalene part of cholesterol biosynthesis.5 Cyp51 is regulated by transcription factor SREBP, via cyclic adenosine monophosphate (cAMP)6 and by the circadian regulation.7 Liver disease mouse model in which CYP51 was blocked as the rate limiting enzyme of the post-lanosterol part of cholesterol biosynthesis, exposed the progression of NAFLD in mice, and resulted in a phenotype similar to the metabolic progression of NAFLD towards HCC in humans.8 It is impossible to monitor the long-term metabolic progression of NAFLD in human individuals since repetitive liver biopsies are strictly avoided in practice. The complete removal of both Cyp51 gene alleles in mice causes death of the embryo in the 15th day of development, which indicates the importance of cholesterol in embryogenesis.9 Cholesterol synthesis mutations may cause severe defects such as Ant-ley-Bixler syndrome, Smith-Lemli-Opitz syndrome and several other genetic diseases.10
There are still no approved therapies for NAFLD, which is becoming a major health concern due to increas-
ing incidence of obesity in Europe. The problem of NAFLD is its multifactorial nature, with a largely uncharacterized genetic basis and only a few known associated genes.11 For several patients, NAFLD presents an initial step of a serious condition called non-alcoholic steatohepatitis (NASH), which includes fibrosis and is the fastest growing cause of HCC.3 While HCC prevails in males and is increased in postmenopausal females, the sex-based metabolic cues have not been investigated.12 Clinical research and more individualized disease progression monitoring is thus hampered by a lack of reliable non-invasive bio-markers. It currently seems impossible to predict all genetic and environmental factors and their combinations that leads to NAFLD phenotypes. To bridge this gap it is timely to apply a multidisciplinary systems medicine approach to combine experimentation and clinical work with the state-of-the-art multiscale and spatio-temporal liver models.13 Only in this way we will be able to fully understand NAFLD as a multifactorial condition and deduce metabolic causes and risk factors in females and males. This article will survey the combination of experimental, clinical, bio-informatics and modelling approaches that present the state-of-the art in identifying potential targets of complex multifactorial NAFLD and other complex liver diseases.
3. From Dynamical Models of Biochemical Reactions to Virtual Organisms
Computational modelling approaches that are currently used in the systems biology and systems medicine research communities can be differentiated into two main groups. First are the bioinformatic approaches, which allow us to analyse the experimental data, perform statistical analyses and conduct statistical modelling. The second are computational biology also known as mechanistic or dynamical modelling approaches, which allow us to perform dynamical modelling and execute computational simulations of the systems under the study.14 Even though bioin-formatic approaches serve to be complementary to the dynamical modelling approaches, the focus of this paper will be made solely on the later.
Dynamical modelling approaches differ in dependence on the data that are available either from experimentalists or already in published literature. They differ as well based on the type and scale of the system we are investigating and also on the level of details we are aiming to describe in silico15 (see Table 1 and Figure 1).
Isolated segments of gene regulatory, signalling or metabolic networks are usually described with ordinary differential equations (ODEs). ODEs are composed of the classical Michaelis-Menten equations for modelling the enzymatic reactions. They contain as well Hill equations for modelling the gene regulation and expression, and also
Table 1: Dynamical modelling approaches depend on the focus, the data and the size of the observed (sub)system. Abbreviations: NF-kB - nuclear factor kappa beta, ODEs - ordinary differential equations, PDEs - partial differential equations, SSA - stochastic simulation algorithm, GEMs -genome scale metabolic models, WCM - whole-cell model, M. genitalium - Mycoplasma genitalium, 3D - three dimensional, ABM - agent-based model, OOM - object-oriented modelling.
Focus	Parameters Multi-scale Size	Examples	Examples
(applications)	(approaches)
molecular modelling, isolated segments, only vital reactions	needed	No	small	oscillatory network of transcription factor NF-kB 16	ODEs, PDEs, SSA
subcellular processes / reaction networks	not needed	no	large	Comprehensive model of human metabolism17	Boolean networks, GEMs
integration of subcellular processes, whole-cells	needed	yes	large	WCM of M. genitalium18	integrated models, WCMs
tissues, organs, cell populations	needed	yes	from small to large	3D liver tissue models 19	ABM, coupled ODEs and/or PDEs
all of the above	partially needed yes	large	LiverSex model 20	OOM
Figure 1: The focus of computational models scales from simple models describing selected chemical reactions to complex models describing reaction networks and finally organs and tissues. Abbreviations: ODEs - ordinary differential equations, PDEs - partial differential equations, SSA -stochastic simulation algorithm, GEMs - genome scale metabolic models, WCMs - whole-cell models, ABMs - agent-based models, OOM - object-oriented model
first order differential equations for modelling the protein degradation and similar processes.21 Models based on ODEs usually present the basis for the so called deterministic modelling, which describes the average of the system's response. Deterministic modelling also presumes a homogeneous distribution of the observed entities through the constant volume of the observed molecular space.22 An entity can be anything, from small molecules to proteins and genes. When concentrations of the observed chemical species become small, the noise influences become too large to be simply omitted from the models.23,24 In such cases a single-molecule level which is named also the stochastic modelling approach, need to be applied.23,25,26 The stochastic modelling bases on the Stochastic Simulation Algorithm (SSA)27 and on its variations (e.g., see28). It can account for the stochasticity of the observed biochemical reactions on the account of a larger computational complexity.
Stochastic as well as deterministic modelling approaches described above require the estimation of biologically relevant parameter values. Parameters are values (numbers) that are mostly based on the rate constants k for the observed biochemical reactions. It is the fact that these models (stochastic and deterministic) are useful only with realistic parameter values.29 This means that the simulations that would produce biologically relevant results cannot be performed without the evaluation of kinetic parameter values. Specific parameter values, such as protein binding affinities or their degradation rates, can be experimentally measured. However, several pitfalls exist here. For example, (1) mathematical models usually describe complex processes in a simplified manner, which do not necessarily correspond to the measured biochemical constants (for example, multiple reactions can be lumped into a single virtual reaction) (2) reaction rates may strongly depend on environmental conditions (for example, reaction rates increase at higher temperatures) (3) variations of evaluated parameters may be extremely large (for example, reaction rates may differ significantly within the colony of genetically identical cells) and finally (4) not all parameters can be evaluated neither in vivo nor in vitro.29 It can thus happen that the majority of the parameter values that are needed in the model, have to be deduced or inferred. Deduction of the missing parameter values is possible with the so called parameter estimation techniques. These techniques compare the available experimental results with the simulation results from the model, and upon that globally minimize the error function 30,31. Different parameter estimation techniques that aim to integrate the experimental results within the computational models have already been described (see e.g. 32-34). Even though specific techniques that might be able to cope with the large-scale models have also been proposed recently (see e.g.35), they are in general still far from being scalable.29 Moreover, comprehensive in vivo measurements in animals are still not available even for the most studied organisms.29 We must underline at
this point that there are few in vivo studies in humans that are ethically feasible. It is, for example, impossible to count on kinetic data from human organs in vivo. Even ex vivo studies relying on data from human liver, are frequently small and difficult to compare with one another.36 Consequently, majority of experiments that require e.g. a time-series of data, or data from the inner body organs, rely on experiments on laboratory animals, in line with ethical considerations for work on laboratory animals, including the 3R (reduce, replace, refine) principles.
Computational approaches that are able to deal with large-scale models have thus evolved into different forms that allow us to fully or partially omit the parameter estimation problem. These approaches are mainly focused to specific segments of observed biological system. For example, gene regulatory or signalling networks can be described with Boolean networks (see e.g.37), while metabolic networks use the stoichiometric description in the form of genome-scale metabolic models.38
Boolean networks (known also as logic models) depict the biological systems as a network of Boolean functions, i.e. functions describing binary relations between inputs and outputs.39,40 These networks presume that the observed chemical species can take only two possible values, i.e. absent (0) or present (1). Boolean networks are thus only a rough and approximate description of the system under study, but circumvent several problems of the approaches mentioned before. Boolean models can be established without any knowledge of kinetic parameter values and, when experimental data describing the system's response in different conditions are available, also without the knowledge of exact mechanistic description of the system under study. Their structure can be in many cases inferred solely from the characterization of the system's dynamical response (see e.g.41,42).
Genome-scale metabolic models (GEMs) describe the in silico relations between the organism's genome and its metabolic phenotype.38 In these models, the organism's genome and its annotations are applied to the reconstruction of stoichiometric description of the metabolism.43 GEMs have already been established for simple prokaryot-ic organisms (see e.g.44) as well as for humans17 and other eukaryotes (see e.g.45 and46). These models represent the general metabolism encoded within the genome of the organism under study and can be further refined to reflect experimental data observed in different environmental conditions, in different cell strains (see e.g.46), in different tissues (see e.g.47), organs (see e.g.48), diseases (see e.g.49), as well as within specific individuals (see e.g.50), using dedicated computational algorithms, such as GIMME51, mCADRE47 and CORDA52. GEMs can be used to assess the metabolic fluxes that bring the observed metabolic network into an optimal steady-state under given criteria and optimisation function, such as maximal biomass production. Flux-balance analysis (FBA)53 and other constraint-based approaches under the hood of COBRA
methodologies54 can be applied for this purpose. These methodologies require the definition of optimisation criteria as well as upper and lower limits of metabolic fluxes, i.e. constraints, through observed reactions, and do not rely on the evaluation of exact values of kinetic parameters. They are, however, limited solely to the observation of the metabolic phenotype within the steady state of the system and without direct interactions with other cellular processes, such as gene regulation and protein-protein interactions.
The integration of GEMs with other cellular networks into integrated models have also been reported in recent years (see e.g.55 and56). The most comprehensive version of these model are so called whole-cell models (WCMs), which integrate the GEMs with the large-scale models of gene regulatory networks, signalling networks, protein-protein networks and other cellular processes.57 WCM has already been established for Mycoplasma genita-lium.18 This model integrates 28 different submodels into a unified WCM that is able to describe the cellular dynamics in the time-span of one cellular division.18 Even though this model seems extremely promising, the methodology used in its establishment is hardly scalable.29 There are several challenges and problems that currently obstruct the application of WCMs to more complex organisms.58 One of the main problems these models are facing is again the evaluation of realistic parameter values, their distributions and uncertainties in order to describe the dynamics of observed systems accurately.29 Moreover, the integration of models of different cellular processes as well WCMs with their environment into comprehensive models that bridge the gaps between multiple scales still needs to be addressed sufficiently.58
While WCMs try to give an accurate description of all cellular processes, models that are currently being applied to the analysis of intra- or inter-cellular dynamics mostly base on the descriptions of the selected processes that seem to be vital for the analysed aspects of cellular dynamics. These models are usually based on the simplifications that combine and reduce the number of observed biochemical reactions thus reducing also the number of parameters that need to be evaluated.59 Since the number of observed biochemical entities is drastically reduced, the ODE- or SSA-based approaches can be applied again.
These models can be integrated into multicellular models describing bacterial populations, tissues or organs with the coupling of differential equations and accounting for spatial as well as temporal dynamics of the system's response (see e.g. 60, 61 and 62). An alternative approach that accounts for the spatial aspects of the systems under study is so called agent-based modelling (ABM). ABM describes the dynamics of different individual agents, i.e. in our case cells, that follow predefined rules (describing e.g. cellular motility, growth and basic cellular processes) and communicate using cellular communication mechanisms.15 Different easy-to-use computational tools that allow straightforward ABM modelling have been proposed recently
(see63 for a recent review of these tools and frameworks). These allow computational modelling of bacterial populations (see e.g.64) as well as computational modelling of tissues and organs (see e.g.65, 66 and67). The main problem of these approaches is again in their inability to scale up, in the context of increasing the modelling accuracy as well as observed population size63. Moreover, large computational complexity of these models usually needs to be addressed with an expensive computer hardware.63,68
An alternative to the approaches described above is object-oriented modelling that is based on the systems biology (SysBio) library that was built at the University of Ljubljana.69 SysBio library was initially used to construct the first integrated human metabolic model SteatoNet with multi-layered regulation.70 This model describes the interaction between multiple tissues and accounts for metabolic reactions as well as for transcriptional and post-tran-scriptional regulation.70 Most of the parameters that describe the dynamics of the observed system can be omitted from the model representation due to the observation of the normalised steady-state of the system's response. Object-oriented modelling approach that is applied here allows us to construct complex models by connecting the objects corresponding to basic biological entities in a meaningful and straightforward way.70 Since the number of parameters that need to be incorporated into the model is small, this prevents several problems, such as parameter estimation problems as well as the problem of model over-fitting. On the other hand parameters that are used at the end allow us to easily adapt the models to specific data, such as personalised or gender specific data as described
4. Large-scale Computational Models of Liver Metabolism
Changes in health, which may lead to the development and progression of different diseases, are caused by abnormal modifications of metabolism. Identification and characterization of these modifications have potentials for various applications, which include drug discovery and identification of new biomarkers.71 The majority of metabolic disorders occurs in the liver.72,73 The study of liver disorders improves the understanding of their physiological and pathological consequences. Computational models present an indispensable tool for the prediction of the effects of metabolic, genetic or chemical perturbations in liver metabolism and consequently in liver-related disease development and progression.13 Traditional methods fail to conduct the analyses in the same scope as in silico methods or can be conducted only under unfeasible costs. They need to be, however, complemented with the computational approaches.15 Finally, combination of experimental work, clinical work and computational modelling can be used for understanding the disease mechanisms, for eval-
uating the clinical efficacy and cost-effectiveness of existing diagnostic methods, for the development of new diagnostic methods and for the proposal of new drugs73 (see Figure 2).
The liver is a key organ maintaining the metabolic homeostasis in the human body via synthesis, storage, and degradation of metabolites.76 The use of computational models in liver research has been increasingly growing in
Figure 2: Computational models are complemented with experimental, literature and clinical data, which allows their transition towards clinical applications.
recent years (see Table 2 ). Most computational liver models are focused to the isolated liver (hepatic) metabolic mechanisms. For example, a detailed kinetic model of gly-colysis, gluconeogenesis, and glycogen metabolism in human hepatocytes under the hormonal control of insulin, glucagon, and epinephrine, presents a tool for understanding the role of the liver in glucose homeostasis under normal conditions, in patients with diabetes or with glycogen storage diseases.77 Different models are used to analyse different specific aspects of liver metabolism, such as energy metabolism78, fat accumulation79, iron metabolism80 and xenobiotic metabolism81. Even though liver exhibits a large dynamical complexity, their microscopic architecture is remarkably uniform. The uniformity of the liver structure makes the modelling of the hepatic architecture relatively easy, which is indicated by several in silico models of hepatic structural architecture.82,83 These models help us to explain how cells form functional tissues, as for example in the 3-dimensional computational model of liver regeneration.84
To date, only selected computational approaches of hepatic metabolism have been shifted to clinical application.43 Individualized options for medical care of patients with HCC are not available yet, but there are large efforts to develop personalized systems care for them.85 HCC presents a global health problem because it is the seventh most common cancer in the world and the third leading cause of cancer-related deaths.86 Research in personalized approaches in hepatology has delivered different examples of successful application of systems biology such as HCC GEMs, which improved the HCC stratification and sug-
Table 2: State-of-the-art computational models used in the liver research. Only major large-scale computational models are included within the table. Abbreviations: GEM - genome scale metabolic models, HCC - hepatocellular carcinoma, NAFLD - non-alcoholic fatty liver disease, NASH -non-alcoholic steatohepatitis, SteatoNet - steatosis network.
Type	Description and applications	Reference
HepatoNet1	GEM	first hepatic GEM; explained the relations between the available oxygen levels and the nutrients availability in the hepatic detoxification of ammonia	74
iHepatocyte2322	GEM	composed of the hepatocyte, the uptake and secretion of VLDL, LDL and HDL lipoproteins, and the formation and/or degradation of lipid droplets; used to simulate the progression of NAFLD to NASH; identified the potential therapeutic targets for treatment of NASH	48
HCC GEM	GEM	personalised iHepatocyte2322 model to HCC patients; identified 101 antimetabolites with tumour suppression effect in the HCC; identified i-carnitine as suppressor of HCC progression by inhibiting p-oxidation	50
iHCC2578	GEM	reconstructed from the proteome and transcriptome of 361 HCC tumors and 49 noncancerous liver samples; used to study acetate utilization and HCC; identified deregulation of fatty acid oxidation as a vital process for cell proliferation in HCC	75
SteatoNet	OOM	integrated human metabolic model with multi-layered regulation; used to explain the relations between the liver and other organs in the development of NAFLD; identified ketone body metabolism, cholesterol transport and regulatory functions of FXR, LXR and SREBP2 as crucial steps in NAFLD development and progressions	70
LiverSex	OOM	adaptation of SteatoNet to gender-specific models; used to investigate gender-dependent complex liver pathologies; identified the partition of fatty acids into different pathways as a possible NAFLD protective mechanisms in females; identified PGC1A, PPARa, FXR and LXR as regulatory factors for gender dependent personalized treatment of NAFLD	20
gested new targets for personalized treatments.50,75,87 Different GEMs have been focused on the human liver metabolism. HepatoNet174 is a product of the liver adaptation of the human metabolic network Recon188 using the extensive knowledge and databases for hepatocyte representation. HepatoNet1 has been used to explain the relations between the available oxygen levels and the nutrients availability in the hepatic detoxification of ammonia. HepatoNet1 presents a starting point for the reconstruction of other hepatocyte-specific GEMSs, for example iLJ104689, iAB67690, iHepatocyte115491 and iHepato-cyte232248. iHepatocyte2322 currently presents the most powerful liver-related GEM. It was established with the combination of various clinical, biochemical and genetic studies. Its main aim was to provide the identification of novel biomarkers and therapeutic targets for NAFLD. Simulation of NAFLD progression to NASH has exposed serine deficiency as the main cause in NASH patients. iHepat-ocyte2322 was used to show that increasing serine level in hepatocytes as a consequence of the serine uptake as a dietary supplement could prevent NASH progression. Phos-phoserine phosphatase and hydroxymethyltransferases 1
as well as branched chain amino-acid transaminase 1 were identified as potential therapeutic targets for the treatment of NASH.48
SteatoNet70 presents an OOM model, which was established to increase the understanding of the relations between the liver and other organs in the development of NAFLD. SteatoNet was used to identify the interactions between liver and adipose tissue as critical for the patho-genesis of NAFLD. Ketone body metabolism, cholesterol transport, and regulatory functions of farnesoid X receptor, liver X receptor and sterol regulatory element-binding protein 2 were recognized as novel crucial steps of NAFLD development and progressions. However, the liver is well known as one of the most sexually dimorphic non-reproductive organs92, which is also indicated by sex differences in liver-related disease prevalence and progression.93 Hepatic large-scale metabolic models are, on the other hand, uniform models and do not differentiate between genders. They are constructed and validated mostly on male data, also because of the lack of liver transcriptome-based studies that would take into account both genders.94 With the goal to investigate differences in NAFLD progression be-
Figure 3: LiverSex presents the gender-based adaptation of the SteatoNet model, and is able to provide detailed insights into gender-dependent complex liver pathologies. The adaptation was performed with the addition of androgen and estrogen receptor responses, the addition of connections between sex steroids and growth hormone, and the addition of gender-based growth hormone release (see20).
tween genders, we developed the LiverSex model20, the first gender-based, multi-tissue and multi-level liver metabolic computational model (see Figure 3). SteatoNet was reused and adapted to gender-based hormonal regulation of liver. The key step in the adaptation of liver metabolism to gender was the addition of androgen and estrogen receptor responses to relevant hormones, the additions of connections between sex steroids and growth hormone, and the addition of specific gender-based growth hormone release to the model. Hormonal regulation in LiverSex was simplified to a level that still ensures normal function. Hormones were organized into 3 groups: androgen, estrogens and growth hormone. Androgen and estrogen groups represent steroid hormones that regulate the development and maintenance of sex characteristics in mammals by binding to their corresponding receptors.92 The growth hormone has a daily oscillatory behaviour in males and has a constant concentration in females, which was also included in the model.95 The dynamics of estrogen in the female model was described with the monthly estrous cycle that cannot be found in males.96 With these alterations, LiverSex was able to provide detailed insights into gender dependent complex liver pathologies in the liver-related disease development and progression. The model identified the cardinal gender dependent metabolic pathways such as partition of fatty acids to ketone body production, VLDL synthesis, and fatty acids oxidation, together with deposition of triglycerides as lipid droplets, which are involved in accumulation of triglyceride as one of the initial steps of NAFLD. Later was recognized as substantially more sensitive in females in response to a high-fat diet challenge. The ability to partition fatty acids into different pathways might be one of the possible protective mechanisms in females leading to delayed NAFLD progression compared to males. In the same way, PGC1A, PPARa, FXR and LXR were identified as regulatory factors, which could become influential in gender dependent personalized treatment of NAFLD.
5. Future Perspectives
In systems medicine, computational models can be applied for diagnostics, for prediction of disease progression, and for optimal selection of suitable therapeutic strategies. They give us the opportunity to personalise the clinical care to the patients' anatomy, physiology, genomic background, etc. In addition, systems medicine approaches highlight patient specific aspects on the development and progression of the diseases.
The liver has a major physiological role in the fine-tuning of metabolic pathways, including functions associated with health and disease. A comprehensive characterization of liver maintenance and disruptions might be crucial in preventive medicine and in the design of safer and more efficient therapeutic approaches. Systems medi-
cine may help with finding preventive approaches for diseases of hepatic metabolism.
Computational models complement experimental data and can be used for diagnostic purposes, for identification of drug targets and for personalized care of patients with liver diseases. There is an urgent need for new therapies in hepatology, as the mortality and morbidity in many liver diseases is still high. End-stage liver diseases and cancers share a similar dismal prognosis.
The aim of personalised medicine is to adapt the diagnosis and clinical care to each individual patient. With the reduction of the probability of wrong diagnoses as well as the application of wrong therapies, personalized medicine has all the potentials to drastically reduce the costs of health care as well as global health risks. Personalized medicine, however, still needs an approval from the general audience of physicians as well as from the wider population. Making big data work for patients is still a challenge from the decision making to the data management as well as ethical and legal perspective.97 The consent policies need to be clear. The data and its interpretations need to be integrated into a comprehensive health care system that would have practical benefits for all participants, i.e. patients, clinicians and researchers. Other challenges that limit the bridging of personalized medicine to market include is current costs of multiomics experimental approaches and lack as well as inconsistencies of internationally accepted best practice standards.98
The majority of current personalized medicine approaches is directed towards the diagnosis and treatment of cancer. In comparison to the recent progress of personalized medicine in oncology, personalized medicine in hepatology still remains in its infancy. Several liver diseases, such as progression of NAFLD to HCC via NASH, are still hard to characterize in the context of their predictive outcome. We still do not fully understand the sex-dependent mechanisms that lead the development and progression of liver related diseases and which might be crucial for their diagnosis and treatment. We speculate these mechanisms are driven by growth hormone as well as sex hormones and their influences on gene expression patterns. In the future, broad molecular profiling of liver diseases, their integration in computational models and their validation in clinical trials, in females and males could improve the current treatment options with individualized care. These computational models will not only progress in their accuracy and prediction power of describing the dynamics of the metabolism of isolated organs or reactions networks. Current trends of systems biology in hepatology go towards the integration of different network types with multilayered omics data to obtain integrative models, which will accurately simulate whole-body metabolic functions.99
Scientific society has entered a new era in which computational methods and technologies have a key role in investigation of the human body. EuroPhysiome100-102
is an European project, which created a framework for modelling the human body using computational methods which incorporate the biochemistry, biophysics, and anatomy of cells, tissues and organs known as Homo sapiens in silico. These methods aim to design a computational version of the human body within the next 20 years.103 This will provide the comprehensive insights into the dynamics of the human body and development and progression of complex diseases, and increase their treatment potentials in the context of preventive and personalized medicine.
In conclusion, despite spectacular advances in the post-genome era, there is a gap between experimental data and medical knowledge, and an even greater gap between new knowledge in terms of clinical utility and benefits to the patients. We still suffer from multifactorial disorders that affect large-scale populations and we are unable to guide the epidemics due to the knowledge gaps. Progressive liver diseases arising from metabolic causes are a typical example where the classical approaches have not lead to sufficient progress. It is thus timely to introduce multi-disciplinary approaches and tackle NAFLD by combining biochemical experimentation with the state-of-the-art modelling. There are no approved therapies for NAFLD and the compounds currently in Phase III clinical trials may very likely face safety and efficacy issues. Further research and more individualized disease progression monitoring is also affected by a current lack of reliable non-invasive biomarkers. It is thus evident that in addition to experimental and clinical work we also need models to help us decrease the burden of liver pathologies.
Acknowledgments
Supported by the resources of FP7 CASyM (Coordinating Action Systems Medicine Europe, grant no. 305033), by Slovenian Research Agency grants P1-0390, P2-0359, and by the infrastructure grant ELIXIR.
Author biographies
Tanja Cvitanovic Tomas is a PhD student at the Faculty of Medicine, University of Ljubljana, Slovenia. She received her MSc from the Biotechnical Faculty, University of Ljubljana, Slovenia in 2012. Her research work is focused on interdisciplinary bridging between medicine, biochemistry and computational modelling. Her recent work is directed towards the applications of computational approaches to gain the insights into hot topics in hepatol-ogy.
Miha Moskon received his BSc and PhD degree in computer science from the Faculty of Computer and Information Science, University of Ljubljana, Slovenia in 2007 and 2012, where he holds the position of an assistant professor. His research work is focused on computational approaches in systems medicine, systems biology and synthetic biology. His main research interests have been re-
cently directed towards accurate quantitative modelling and analysis of metabolic and gene regulatory networks and towards the computational design of synthetic biological systems.
Miha Mraz received his BSc, MSc and PhD degree in computer science from the Faculty of Computer and Information Science, University of Ljubljana, Slovenia in 1992, 1995 and 2000, where he leads the Computational biology group, and holds the position of a full professor. His research interests include unconventional processing methods and applications of computational approaches to systems biology, systems medicine and synthetic biology.
Damjana Rozman received her BSc at Faculty of Chemistry and Chemical Technology, University of Ljubljana, MSc and PhD degree at Faculty of Medicine, University of Ljubljana and post-doctoral training at Vander-bilt University in USA. She holds the position of full professor at Institute of Biochemistry and is the head of the Centre for Functional Genomics and Bio-chips at Faculty of Medicine. In her research she applies functional genom-ics and systems medicine approaches to decipher how the cholesterol homeostasis cross-talks with other liver metabolic pathways and how this influences liver health and transformation to disease.
6. References
1.	Younossi, Z.; Henry, L. Contribution of Alcoholic and Nonalcoholic Fatty Liver Disease to the Burden of Liver-Related Morbidity and Mortality. Gastroenterology 2016, 150, 17781785. D01:10.1053/j.gastro.2016.03.005
2.	Naik, A.; Košir, R.; Rozman, D. Genomic Aspects of NAFLD Pathogenesis. Genomics 2013, 102, 84-95. D0I:10.1016/j.ygeno.2013.03.007
3.	Blagotinšek, K.; Rozman, D. Targeting Signalling Pathways in Hepatocellular Carcinoma. Curr. Pharm. Des. 2017, 23, 170175.
4.	Ačimovič, J.; Rozman, D. Steroidal Triterpenes of Cholesterol Synthesis. Molecules 2013, 18, 4002-4017. D0I:10.3390/molecules18044002
5.	Seliskar, M.; Rozman, D. Mammalian Cytochromes P450 -Importance of Tissue Specificity. Biochim Biophys Acta 2007, 1770, 458-466.
6.	Fink, M.; Acimovic, J.; Rezen, T.; Tansek, N.; Rozman, D. Cholesterogenic Lanosterol 14alpha-Demethylase (CYP51) Is an Immediate Early Response Gene. Endocrinology 2005, 146, 5321-5331. D0I:10.1210/en.2005-0781
7.	Kosir, R.; Prosenc Zmrzljak, U.; Korencic, A.; Juvan, P.; Acimovic, J.; Rozman, D. Mouse Genotypes Drive the Liver and Adrenal Gland Clocks. Sci. Rep. 2016, 6, 31955. D0I:10.1038/srep31955
8.	Lorbek, G.; Perše, M.; Jeruc, J.; Juvan, P.; Gutierrez-Mariscal, F. M.; Lewinska, M.; Gebhardt, R.; Horvat, S.; Bjorkhem, I.;
Rozman, D. Lessons from Hepatocyte-Specific Cyp51 Knockout Mice: Impaired Cholesterol Synthesis Leads to Oval Cell-Driven Liver Injury. Sci. Rep. 2015, 5, 8777. DOI: 10.1038/srep08777 9. Keber, R.; Motaln, H.; Wagner, K. D.; Debeljak, N.; Ras-soulzadegan, M.; Acimovic, J.; Rozman, D.; Horvat, S. Mouse Knockout of the Cholesterogenic Cytochrome P450 Lanos-terol 14a-Demethylase (Cyp51) Resembles Antley-Bixler Syndrome. J. Biol. Chem. 2011, 286, 29086-29097. DOI: 10.1074/jbc.M111.253245
10.	Urlep, 2.; Lorbek, G.; Perse, M.; Jeruc, J.; Juvan, P.; Matz-Soja, M.; Gebhardt, R.; Bjorkhem, I.; Hall, J. A.; Bonneau, R. Disrupting Hepatocyte Cyp51 from Cholesterol Synthesis Leads to Progressive Liver Injury in the Developing Mouse and Decreases RORC Signalling. Sci. Rep. 2017, 7, 40775.
DOI: 10.1038/srep40775
11.	Kovac, U.; Rozman, D. Genetics of Non-alcoholic Fatty Liver Disease. In eLS; John Wiley & Sons, Ltd, 2015.
12.	Skubic, C.; Drakulic, 2.; Rozman, D. Pharmacogenetic Considerations for Personalized Therapy When Tackling Nonalcoholic Fatty Liver Disease: The Perspective of Genes, Drugs, and the Sex. Submitted 2018.
13.	Cvitanovic, T.; Reichert, M. C.; Moskon, M.; Mraz, M.; Lam-mert, F.; Rozman, D. Large-Scale Computational Models of Liver Metabolism: How Far from the Clinics? Hepatology 2017, 66, 1323-1334. D0I:10.1002/hep.29268
14.	Duffy, D. J. Problems, Challenges and Promises: Perspectives on Precision Medicine. Brief. Bioinform. 2016, 17, 494-504. D0I:10.1093/bib/bbv060
15.	Wolkenhauer, O. Why Model? Front. Physiol. 2014, 5, 21. D0I:10.3389/fphys.2014.00021
16.	Mengel, B.; Hunziker, A.; Pedersen, L.; Trusina, A.; Jensen, M. H.; Krishna, S. Modeling Oscillatory Control in NF-KB, P53 and Wnt Signaling. Curr. Opin. Genet. Dev. 2010, 20, 656-664. D0I:10.1016/j.gde.2010.08.008
17.	Brunk, E.; Sahoo, S.; Zielinski, D. C.; Altunkaya, A.; Drager, A.; Mih, N.; Gatto, F.; Nilsson, A.; Preciat Gonzalez, G. A.; Aurich, M. K.; et al. Recon3D Enables a Three-Dimensional View of Gene Variation in Human Metabolism. Nat. Biotech-nol. 2018, 36, 272-281. D0I:10.1038/nbt.4072
18.	Karr, J. R.; Sanghvi, J. C.; MacKlin, D. N.; Gutschow, M. V.; Jacobs, J. M.; Bolival, B.; Assad-Garcia, N.; Glass, J. I.; Covert, M. W. A Whole-Cell Computational Model Predicts Pheno-type from Genotype. Cell 2012, 150, 389-401. D0I:10.1016/j.cell.2012.05.044
19.	Hoehme, S.; Friebel, A.; Hammad, S.; Drasdo, D.; Hengstler, J. G. Creation of Three-Dimensional Liver Tissue Models from Experimental Images for Systems Medicine. Methods Mol. Biol. 2017, 1506, 319-362. D0I:10.1007/978-1-4939-6506-9_22
20.	Cvitanovic Tomas, T.; Urlep, 2.; Moskon, M.; Mraz, M.; Rozman, D. LiverSex Computational Model: Sexual Aspects in Hepatic Metabolism and Abnormalities. Front. Physiol. 2018, 9, 360. D0I:10.3389/fphys.2018.00360
21.	Ingalls, B. P. Mathematical Modelling in Systems Biology: An Introduction; MIT Press, 2014.
22.	Ksrn, M.; Blake, W. J.; Collins, J. J. The Engineering of Gene Regulatory Networks. Annu. Rev. Biomed. Eng. 2003, 5, 179206. DOI: 10.1146/annurev.bioeng.5.040202.121553
23.	Turner, T. E.; Schnell, S.; Burrage, K. Stochastic Approaches for Modelling in Vivo Reactions. Comput. Biol. Chem. 2004, 28, 165-178. DOI: 10.1016/j.compbiolchem.2004.05.001
24.	Gillespie, D. T. Deterministic Limit of Stochastical Chemical Kinetics. J. Phys. Chem. B 2009, 113, 1640-1644. D0I:10.1021/jp806431b
25.	Karlebach, G.; Shamir, R. Modelling and Analysis of Gene Regulatory Networks. Nat. Rev. Mol. Cell Biol. 2008, 9, 770780. D0I:10.1038/nrm2503
26.	De Jong, H. Modeling and Simulation of Genetic Regulatory Systems: A Literature Review. J. Comput. Biol. 2002, 9, 67103. DOI: 10.1089/10665270252833208
27.	Gillespie, D. T. Exact Stochastic Simulation of Coupled Chemical Reactions. J. Phys. Chem. 1977, 81, 2340-2361. D0I:10.1021/j100540a008
28.	Petroni, M.; Zimic, N.; Mraz, M.; Moskon, M. Stochastic Simulation Algorithm for Gene Regulatory Networks with Multiple Binding Sites. J. Comput. Biol. 2015, 22, 218-226. D0I:10.1089/cmb.2014.0064
29.	Babtie, A. C.; Stumpf, M. P. H. How to Deal with Parameters for Whole-Cell Modelling. J. R. Soc. Interface 2017, 14, 20170237. D0I:10.1098/rsif.2017.0237
30.	Ashyraliyev, M.; Fomekong-Nanfack, Y.; Kaandorp, J. A.; Blom, J. G. Systems Biology: Parameter Estimation for Biochemical Models. FEBS J. 2009, 276, 886-902.
D01:10.1111/j.1742-4658.2008.06844.x
31.	Gábor, A.; Banga, J. R. Robust and Efficient Parameter Estimation in Dynamic Models of Biological Systems. BMC Syst. Biol. 2015, 9, 74. D0I:10.1186/s12918-015-0219-2
32.	Zhan, C.; Yeung, L. F. Parameter Estimation in Systems Biology Models Using Spline Approximation. BMC Syst. Biol. 2011, 5, 14. D01:10.1186/1752-0509-5-14
33.	Sun, J.; Garibaldi, J. M.; Hodgman, C. Parameter Estimation Using Metaheuristics in Systems Biology: A Comprehensive Review. IEEE/ACM Trans. Comput. Biol. Bioinforma. 2012, 9, 185-202.
34.	Lillacci, G.; Khammash, M. Parameter Estimation and Model Selection in Computational Biology. PLoS Comput. Biol. 2010, 6, e1000696. D0I:10.1371/journal.pcbi.1000696
35.	Penas, D. R.; González, P.; Egea, J. A.; Doallo, R.; Banga, J. R. Parameter Estimation in Large-Scale Systems Biology Models: A Parallel and Self-Adaptive Cooperative Strategy. BMC Bioinformatics 2017, 18, 1-24. D0I:10.1186/s12859-016-1452-4
36.	Rozman, D. From Nonalcoholic Fatty Liver Disease to Hepa-tocellular Carcinoma: A Systems Understanding. Dig. Dis. Sci. 2014, 59, 238-241. D0I:10.1007/s10620-013-2998-x
37.	Saadatpour, A.; Réka, A. Boolean Modeling of Biological Regulatory Networks: A Methodology Tutorial. Methods 2013, 62, 3-12. D0I:10.1016/j.ymeth.2012.10.012
38.	O'Brien, E. J.; Monk, J. M.; Palsson, B. O. Using Genome-Scale Models to Predict Biological Capabilities. Cell 2015, 161, 971-987. D0I:10.1016/j.cell.2015.05.019
39.	Wynn, M. L.; Consul, N.; Merajver, S. D.; Schnell, S. Logic-Based Models in Systems Biology: A Predictive and Parameter-Free Network Analysis Method. Integr. Biol. 2012, 4, 1323. DOI:10.1039/c2ib20193c
40.	Le Novere, N. Quantitative and Logic Modelling of Molecular and Gene Networks. Nat. Rev. Genet. 2015, 16, 146-158. DOI:10.1038/nrg3885
41.	Ivanov, I. Boolean Models of Genomic Regulatory Networks: Reduction Mappings, Inference, and External Control. Curr. Genomics 2009, 10, 375-387.
DOI: 10.2174/138920209789177584
42.	Martin, S.; Zhang, Z.; Martino, A.; Faulon, J. L. Boolean Dynamics of Genetic Regulatory Networks Inferred from Mi-croarray Time Series Data. Bioinformatics 2007, 23, 866-874. DOI: 10.1093/bioinformatics/btm021
43.	Rejc, Z.; Magdevska, L.; Trselic, T.; Osolin, T.; Vodopivec, R.; Mraz, J.; Pavliha, E.; Zimic, N.; Cvitanovic, T.; Rozman, D.; et al. Computational Modelling of Genome-Scale Metabolic Networks and Its Application to CHO Cell Cultures. Comput. Biol. Med. 2017, 88, 150-160. DOI:10.1016/j.compbiomed.2017.07.005
44.	Orth, J. D.; Conrad, T. M.; Na, J.; Lerman, J. A.; Nam, H.; Feist, A. M.; Palsson, B. A Comprehensive Genome-Scale Reconstruction of Escherichia Coli Metabolism. Mol. Syst. Biol. 2011, 11, 535.
45.	Sánchez, B. J.; Nielsen, J. Genome Scale Models of Yeast: Towards Standardized Evaluation and Consistent Omic Integration. Integr. Biol. 2015, 7, 846-858.
DOI: 10.1039/C5IB00083A
46.	Hefzi, H.; Ang, K. S.; Hanscho, M.; Bordbar, A.; Ruckerbauer, D.; Lakshmanan, M.; Orellana, C. A.; Baycin-Hizal, D.; Huang, Y.; Ley, D.; et al. A Consensus Genome-Scale Reconstruction of Chinese Hamster Ovary Cell Metabolism. Cell Syst. 2016, 3, 434-443. DOI:10.1016/j.cels.2016.10.020
47.	Wang, Y.; Eddy, J. A.; Price, N. D. Reconstruction of Genome-Scale Metabolic Models for 126 Human Tissues Using MCADRE. BMC Syst. Biol. 2012, 6, 153.
DOI: 10.1186/1752-0509-6-153
48.	Mardinoglu, A.; Agren, R.; Kampf, C.; Asplund, A.; Uhlen, M.; Nielsen, J. Genome-Scale Metabolic Modelling of Hepat-ocytes Reveals Serine Deficiency in Patients with Non-Alcoholic Fatty Liver Disease. Nat. Commun. 2014, 5, 1-11. DOI:10.1038/ncomms4083
49.	Ghaffari, P.; Mardinoglu, A.; Nielsen, J. Cancer Metabolism: A Modeling Perspective. Front. Physiol. 2015, 6, 382. DOI:10.3389/fphys.2015.00382
50.	Agren, R.; Mardinoglu, A.; Asplund, A.; Kampf, C.; Uhlen, M.; Nielsen, J. Identification of Anticancer Drugs for Hepato-cellular Carcinoma through Personalized Genome-Scale Metabolic Modeling. Mol. Syst. Biol. 2014, 10, 721. DOI:10.1002/msb.145122
51.	Becker, S. A.; Palsson, B. O. Context-Specific Metabolic Networks Are Consistent with Experiments. PLoS Comput. Biol. 2008, 4, e1000082.
DOI: 10.1371/journal.pcbi.1000082
52.	Schultz, A.; Qutub, A. A. Reconstruction of Tissue-Specific Metabolic Networks Using CORDA. PLoS Comput. Biol. 2016, 12, 1-33. DOI:10.1371/journal.pcbi.l004808
53.	Orth, J. D.; Thiele, I.; Palsson, B. 0. What Is Flux Balance Analysis? Nat. Biotechnol. 2010, 28, 245-248. DOI:10.1038/nbt.1614
54.	Heirendt, L.; Arreckx, S.; Pfau, T.; Mendoza, S. N.; Richelle, A.; Heinken, A.; Haraldsdottir, H. S.; Wachowiak, J.; Keating, S. M.; Vlasov, V.; et al. Creation and Analysis of Biochemical Constraint-Based Models: The COBRA Toolbox v3.0. Dev. Biol. 2017, 276, 391-402.
55.	Lee, S.; Zhang, C.; Kilicarslan, M.; Piening, B. D.; Bjornson, E.; Hallström, B. M.; Groen, A. K.; Ferrannini, E.; Laakso, M.; Snyder, M.; et al. Integrated Network Analysis Reveals an Association between Plasma Mannose Levels and Insulin Resistance. Cell Metab. 2016, 24, 172-184. DOI:10.1016/j.cmet.2016.05.026
56.	Lee, S.; Mardinoglu, A.; Zhang, C.; Lee, D.; Nielsen, J. Dysreg-ulated Signaling Hubs of Liver Lipid Metabolism Reveal Hepatocellular Carcinoma Pathogenesis. Nucleic Acids Res.
2016,	44, 5529-5539. DOI:10.1093/nar/gkw462
57.	Karr, J. R.; Takahashi, K.; Funahashi, A. The Principles of Whole-Cell Modeling. Curr. Opin. Microbiol. 2015, 27, 1824. DOI:10.1016/j.mib.2015.06.004
58.	Widmer, L. A.; Stelling, J. Bridging Intracellular Scales by Mechanistic Computational Models. Curr. Opin. Biotechnol. 2018, 52, 17-24. DOI:10.1016/j.copbio.2018.02.005
59.	Apri, M.; De Gee, M.; Van Mourik, S.; Molenaar, J. Identifying Optimal Models to Represent Biochemical Systems. PLoS One 2014, 9, e83664. DOI:10.1371/journal.pone.0083664
60.	Nikolaev, E. V.; Sontag, E. D. Quorum-Sensing Synchronization of Synthetic Toggle Switches: A Design Based on Monotone Dynamical Systems Theory. PLoS Comput. Biol. 2016, 12, e1004881. DOI:10.1371/journal.pcbi.1004881
61.	Chen, Y.; Kim, J. K.; Hirning, A. J.; Josic, K.; Bennett, M. R. Emergent Genetic Oscillations in a Synthetic Microbial Consortium. Science 2015, 349, 986-989.
DOI: 10.1126/science.aaa3794
62.	Ricken, T.; Werner, D.; Holzhütter, H. G.; König, M.; Dah-men, U.; Dirsch, O. Modeling Function-perfusion Behavior in Liver Lobules Including Tissue, Blood, Glucose, Lactate and Glycogen by Use of a Coupled Two-Scale PDE-ODE Approach. Biomech. Model. Mechanobiol. 2015, 14, 515-536. DOI:10.1007/s10237-014-0619-z
63.	Gorochowski, T. E. Agent-Based Modelling in Synthetic Biology. Essays Biochem. 2016, 60, 325-336. DOI:10.1042/EBC20160037
64.	Matyjaszkiewicz, A.; Fiore, G.; Annunziata, F.; Grierson, C. S.; Savery, N. J.; Marucci, L.; Di Bernardo, M. BSim 2.0: An Advanced Agent-Based Cell Simulator. ACS Synth. Biol.
2017,	6, 1969-1972. DOI:10.1021/acssynbio.7b00121
65.	Swat M H, Thomas G L, Belmonte J M, Shirinifard A, Hmel-jak D, G. J. A. Multi-Scale Modeling of Tissues Using Com-puCell3D. Methods Cell Biol. 2012, 110, 325-366. DOI:10.1016/B978-0-12-388403-9.00013-8
66.	Friebel, A.; Neitsch, J.; Johann, T.; Hammad, S.; Hengstler, J. G.; Drasdo, D.; Hoehme, S. TiQuant: Software for Tissue Analysis, Quantification and Surface Reconstruction. Bioin-formatics 2015, 31, 3234-3236. D01:10.1093/bioinformatics/btv346
67.	Dutta-Moscato, J.; Solovyev, A.; Mi, Q.; Nishikawa, T.; Soto-Gutierrez, A.; Fox, I. J.; Vodovotz, Y. A Multiscale Agent-Based in Silico Model of Liver Fibrosis Progression. Front. Bioeng. Biotechnol. 2014, 2, 18. D0I:10.3389/fbioe.2014.00018
68.	Wolkenhauer, O.; Auffray, C.; Brass, O.; Clairambault, J.; Deutsch, A.; Drasdo, D.; Gervasio, F.; Preziosi, L.; Maini, P.; Marciniak-Czochra, A.; et al. Enabling Multiscale Modeling in Systems Medicine. Genome Med. 2014, 6, 4-6. D0I:10.1186/gm538
69.	Belič, A.; Ačimovič, J.; Naik, A.; Goličnik, M. Analysis of the Steady-State Relations and Control-Algorithm Characterisation in a Mathematical Model of Cholesterol Biosynthesis. Simul. Model. Pract. Theory 2013, 33, 18-27. D0I:10.1016/j.simpat.2011.12.010
70.	Naik, A.; Rozman, D.; Belič, A. SteatoNet: The First Integrated Human Metabolic Model with Multi-Layered Regulation to Investigate Liver-Associated Pathologies. PLoS Comput Biol 2014, 10, e1003993. D0I:10.1371/journal.pcbi.1003993
71.	Ayers, D.; Day, P. J. Systems Medicine: The Application of Systems Biology Approaches for Modern Medical Research and Drug Development. Mol. Biol. Int. 2015, 2015, 1-8.
72.	Guilder, L.; Pula, S.; Pierre, G. Metabolic Disorders Presenting as Liver Disease. Paediatr. Child Heal. (United Kingdom) 2017, 27, 533-539. D0I:10.1016/j.paed.2017.07.007
73.	Hafezi-Bakhtiari, S.; Adeyi, O. A. Metabolic Disorders of the Liver. Diagnostic Histopathol. 2014, 20, 125-133. D0I:10.1016/j.mpdhp.2014.01.012
74.	Gille, C.; Bölling, C.; Hoppe, A.; Bulik, S.; Hoffmann, S.; Hübner, K.; Karlstädt, A.; Ganeshan, R.; König, M.; Rother, K.; et al. HepatoNet1: A Comprehensive Metabolic Reconstruction of the Human Hepatocyte for the Analysis of Liver Physiology. Mol. Syst. Biol. 2010, 6, 411. D0I:10.1038/msb.2010.62
75.	Björnson, E.; Mukhopadhyay, B.; Asplund, A.; Pristovsek, N.; Cinar, R.; Romeo, S.; Uhlen, M.; Kunos, G.; Nielsen, J.; Mardinoglu, A. Stratification of Hepatocellular Carcinoma Patients Based on Acetate Utilization. Cell Rep. 2015, 13, 2014-2026. D0I:10.1016/j.celrep.2015.10.045
76.	Klover, P. J.; Mooney, R. A. Hepatocytes: Critical for Glucose Homeostasis. Int. J. Biochem. Cell Biol. 2004, 36, 753-758. D0I:10.1016/j.biocel.2003.10.002
77.	König, M.; Bulik, S.; Holzhütter, H.-G. Quantifying the Contribution of the Liver to Glucose Homeostasis: A Detailed Kinetic Model of Human Hepatic Glucose Metabolism. PLoS Comput. Biol. 2012, 8, e1002577. D0I:10.1371/journal.pcbi.1002577
78.	Ashworth, W. B.; Davies, N. A.; Bogle, I. D. L. A Computational Model of Hepatic Energy Metabolism: Understanding Zonated Damage and Steatosis in NAFLD. PLoS Comput. Biol. 2016, 12, e1005105. D0I:10.1371/journal.pcbi.1005105
79.	Schleicher, J.; Dahmen, U.; Guthke, R.; Schuster, S. Zonation of Hepatic Fat Accumulation: Insights from Mathematical Modelling of Nutrient Gradients and Fatty Acid Uptake. J. R. Soc. Interface 2017, 14, 20170443.
DOI: 10.1098/rsif.2017.0443
80.	Mitchell, S.; Mendes, P. A Computational Model of Liver Iron Metabolism. PLoS Comput. Biol. 2013, 9, e1003299. D0I:10.1371/journal.pcbi.1003299
81.	Sluka, J. P.; Fu, X.; Swat, M.; Belmonte, J. M.; Cosmanescu, A.; Clendenon, S. G.; Wambaugh, J. F.; Glazier, J. A. A Liver-Centric Multiscale Modeling Framework for Xenobiotics. PLoS One 2016, 11, e0162428. D0I:10.1371/journal.pone.0162428
82.	Drasdo, D.; Hoehme, S.; Hengstler, J. G. How Predictive Quantitative Modelling of Tissue Organization Can Inform Liver Disease Pathogenesis. J. Hepatol. 2014, 61, 951-956. D0I:10.1016/j.jhep.2014.06.013
83.	Naito, Y. A Computational Model of the Hepatic Lobule. In E-Cell System; Springer: New York, 2013; pp 143-155. D0I:10.1007/978-1-4614-6157-9_9
84.	Hoehme, S.; Brulport, M.; Bauer, A.; Bedawy, E.; Schormann, W.; Hermes, M.; Puppe, V.; Gebhardt, R.; Zellmer, S.; Schwarz, M.; et al. Prediction and Validation of Cell Alignment along Microvessels as Order Principle to Restore Tissue Architecture in Liver Regeneration. Proc. Natl. Acad. Sci. 2010, 107, 10371-10376. D0I:10.1073/pnas.0909374107
85.	Chan, S. L.; Wong, A. M.; Lee, K.; Wong, N.; Chan, A. K. C. Personalized Therapy for Hepatocellular Carcinoma: Where Are We Now? Cancer Treat. Rev. 2016, 45, 77-86. D0I:10.1016/j.ctrv.2016.02.008
86.	Yang, J. D.; Roberts, L. R. Hepatocellular Carcinoma: A Global View. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 448-458. D0I:10.1038/nrgastro.2010.100
87.	Folger, O.; Jerby, L.; Frezza, C.; Gottlieb, E.; Ruppin, E.; Shlo-mi, T. Predicting Selective Drug Targets in Cancer through Metabolic Networks. Mol. Syst. Biol. 2011, 7, 501. D0I:10.1038/msb.2011.35
88.	Duarte, N. C.; Becker, S. A.; Jamshidi, N.; Thiele, I.; Mo, M. L.; Vo, T. D.; Srivas, R.; Palsson, B. O. Global Reconstruction of the Human Metabolic Network Based on Genomic and Bib-liomic Data. Proc. Natl. Acad. Sci. 2007, 104, 1777-1782. D0I:10.1073/pnas.0610772104
89.	Jerby, L.; Shlomi, T.; Ruppin, E. Computational Reconstruction of Tissue-Specific Metabolic Models: Application to Human Liver Metabolism. Mol. Syst. Biol. 2010, 6, 401. D0I:10.1038/msb.2010.56
90.	Bordbar, A.; Feist, A. M.; Usaite-Black, R.; Woodcock, J.; Palsson, B. O.; Famili, I. A Multi-Tissue Type Genome-Scale Metabolic Network for Analysis of Whole-Body Systems Physiology. BMC Syst. Biol. 2011, 5, 180.
D01:10.1186/1752-0509-5-180
91.	Agren, R.; Bordel, S.; Mardinoglu, A.; Pornputtapong, N.; Nookaew, I.; Nielsen, J. Reconstruction of Genome-Scale Active Metabolic Networks for 69 Human Cell Types and 16 Cancer Types Using INIT. PLoS Comput. Biol. 2012, 8, e1002518.
D0I:10.1371/journal.pcbi.1002518
92.	Roy, A. K.; Chatterjee, B. Sexual Dimorphism in the Liver. Annu. Rev. Physiol. 1983, 45, 37-50.
DOI: 10.1146/annurev.ph.45.030183.000345
93.	Durazzo, M.; Belci, P.; Collo, A.; Prandi, V.; Pistone, E.; Mar-torana, M.; Gambino, R.; Bo, S. Gender Specific Medicine in Liver Diseases: A Point of View. World J. Gastroenterol. 2014, 20, 2127-2135. D01:10.3748/wjg.v20.i9.2127
94.	Zhang, Y.; Laz, E. V; Waxman, D. J. Dynamic, Sex-Differential STAT5 and BCL6 Binding to Sex-Biased, Growth Hormone-Regulated Genes in Adult Mouse Liver. Mol Cell Biol 2012, 32, 880-896. D0I:10.1128/MCB.06312-11
95.	Waxman, D. J.; O'connor, C. Growth Hormone Regulation of Sex-Dependent Liver Gene Expression. Mol. Endocrinol. 2006, 20, 2613-2629. D0I:10.1210/me.2006-0007
96.	Gui, Y.; Silha, J. V.; Murphy, L. J. Sexual Dimorphism and Regulation of Resistin, Adiponectin, and Leptin Expression in the Mouse. Obes. Res. 2004, 12, 1481-1491. D0I:10.1038/oby.2004.185
97.	Cordeiro, J. V. Ethical and Legal Challenges of Personalized Medicine: Paradigmatic Examples of Research, Prevention, Diagnosis and Treatment. Rev. Port. Saúde Pública 2014, 32, 164-180. D0I:10.1016/j.rpsp.2014.10.002
98.	Knowles, L.; Luth, W.; Bubela, T. Paving the Road to Personalized Medicine: Recommendations on Regulatory, Intellectual Property and Reimbursement Challenges. J. Law Biosci. 2017, 4, 453-506. D0I:10.1093/jlb/lsx030
99.	Mardinoglu, A.; Boren, J.; Smith, U.; Uhlen, M.; Nielsen, J. Systems Biology in Hepatology: Approaches and Applications. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 365-377. DOI:10.1038/s41575-018-0007-8
100.	Fenner, J. W.; Brook, B.; Clapworthy, G.; Coveney, P. V.; Feipel, V.; Gregersen, H.; Hose, D. R.; Kohl, P.; Lawford, P.; McCormack, K. M.; et al. The EuroPhysiome, STEP and a Roadmap for the Virtual Physiological Human. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 2008, 366, 2979-2999. D01:10.1098/rsta.2008.0089
101.	Hunter, P.; Coveney, P. V.; de Bono, B.; Diaz, V.; Fenner, J.; Frangi, A. F.; Harris, P.; Hose, R.; Kohl, P.; Lawford, P.; et al. A Vision and Strategy for the Virtual Physiological Human in 2010 and Beyond. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 2010, 368, 2595-2614. D0I:10.1098/rsta.2010.0048
102.	Hunter, P.; Chapman, T.; Coveney, P. V; De Bono, B.; Diaz, V.; Fenner, J.; Frangi, A. F.; Harris, P.; Hose, R.; Kohl, P.; et al. A Vision and Strategy for the Virtual Physiological Human: 2012 Update. Interface Focus 2013, 3, 20130004. D0I:10.1098/rsfs.2013.0004
103.	Kolodkin, A.; Boogerd, F. C.; Plant, N.; Bruggeman, F. J.; Goncharuk, V.; Lunshof, J.; Moreno-Sanchez, R.; Yilmaz, N.; Bakker, B. M.; Snoep, J. L.; et al. Emergence of the Silicon Human and Network Targeting Drugs. Eur. J. Pharm. Sci. 2012, 46, 190-197. D0I:10.1016/j.ejps.2011.06.006
Povzetek
Računski modeli presnove jeter postajajo vse bolj pomembni in prepoznavni v raziskavah na področju sistemske medicine. V zadnjih letih so se pojavile tudi njihove prve klinične aplikacije v kontekstu personalizirane medicine. V pričujočem prispevku predstavimo pregled eksperimentalnih in računskih modelov, ki jih lahko uporabimo pri opisovanju in razumevanju presnovnih procesov in silico. Pregledamo zadnje trende pri razvoju obsežnih računskih modelov presnove jeter, kjer se osredotočimo na objektno-orientirane pristope modeliranja, ki predstavljajo eno od glavnih usmeritev naših raziskav. Prednosti objektno-orientiranih pristopov so v relativno enostavnem opisovanju interakcij med tkivi, kot je npr. interakcija presnove jeter z okoliškimi tkivi preko krvi. V nasprotju z alternativnimi pristopi modeliranja objektno-oritentirani pristopi omogočajo neposredno vključitev tako transkripcijske kot tudi post-translacijske regulacije presnovnih reakcij. Na koncu prispevka opredelimo obstoječe in potencialne klinične aplikacije obsežnih računskih modelov presnove jeter ter opredelimo potenciale tako modelov presnovne kot tudi modelov ostalih celičnih procesov na področju sistemske in translacijske medicine.
DOI: I0.i7344/acsi.20i7.3586	Acta Chim. Slov. 2018, 65, 266-270	^commons
Scientific paper
The Antioxidant Response System in Wheat Exposed to Pesticides and its Combined-induced Oxidative Damage
Nilgün Candan Yücel,1* Elif Hakli Heybet2 and Ozay Ozgür Gokmen3
1 Chemistry Department, Dokuz Eylul University, Faculty of Science, Buca, 35160, Izmir, Turkey
2 Biology Department, Cukurova University, Faculty of Science and Art, 01150, Sarigam, Balcali, Adana, Turkey
3 Maize Research Institute, Arifiye, Sakarya
* Corresponding author: E-mail: nilgun.candan@deu.edu.tr Tel: +90 232 301 95 40
Received: 26-05-2017
Abstract
The aim of the present study was to analyze the alterations in the, antioxidant enzyme activities (such as superoxide dis-mutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px) and level of glutathione (GSH) and lipid peroxidation (LPO) of wheat acutely treated with CP and DM treatments at low, high doses and their combination. CP and DM were administered to wheat in different doses of 1, 1.5, 5 and 35 mg kg-1 given alone and combination. After 3 weeks, antioxidant enzyme activities, and the level of GSH and LPO were recorded and analyzed. Antioxidative defense mechanisms and LPO in wheat display different responses depending on different pesticide treatments and doses. Biochemical analysis showed that exposure of the CP and DM cause plant tissue damage. It is suggested that appropriate ecotoxicological risk assessment should be made in the areas where DM is proposed to be used in pest control when compared to CP. In the present study, we also concluded that the effect of the combined of CP and DM on the oxidative stress may be syner-gistic.
Keywords: Antioxidant enzymes; lipid peroxidation; pesticide mixture; wheat
1. Introduction
With the rapid development of global agriculture, the pesticide risk is receiving increasing consideration. Throughout world, there is a considerable plant exposure to pesticides due to several factors: bioaccumulation and excessive use of pesticides in the agriculture wastes.1
From the pesticides, chlorpyrifos (CP, an organo-phosphate) belongs to the phosphorothioate class of or-ganophosphorus insecticides.2 CP, used worldwide (for use in nearly 100 countries and is applied to approximately 8.5 million crop acres each year) unfortunately is a known developmental neurotoxicant. There is increasing evidence that oganophosphorus compounds also induce oxidative stress through generation of free oxygen radicals and cause an imbalance between formation and removal of free radicals, leading to LPO and DNA damage.3
Oxidative damage has been recognized as one of the primary causes of subcellular toxicity of pesticides.4 Studies on CP and DM exposure have also suggested a putative
role for free radicals in LPO and other oxidative stress-mediated injuries.5,6 Also, synthetic pyrethroids (DM, a pyre-throid pesticide) have emerged as a new class of agricultural pesticides and have found wide use over organochlo-rine and organophosphate pesticides. The use of pyrethroids as insecticidal and anti-parasitic formulations has markedly increased in last 2 decades.7 The main advantages of their use are their photostability, high efficacy.8 Pyre-throid class of pesticide, such as DM, is globally used in crop protection and control of malaria and other vector-borne diseases.
Insecticides may cause oxidative stress in plant cells, affecting the various metabolic activities and growth components in plants.8 It has been well documented that oxidative stress can occur in the cells of plants suffering from severe external environment stress like pesticides. For protection, plants have multiple complex enzymatic and non-enzymatic antioxidant systems including SOD, CAT, and POD.
However, no information is available on the combined effect of CP and DM on the response defense systems
in plants. The present study was designed to explore the effects of CP, DM and their combination on wheat plant and their relation to free-radical mediated membrane LPO and the influence of the antioxidant defense systems.
2. Experimental
2. 1. Plants
Wheat sterilized seed cultivar (Triticum durum Desf. cv. Yelken) were kept in 1% sodium hipochloride about 15 min for sterilizing. Wheat plants were germinated in per-lite moistened with saturated CaSO solution. Germinated
4
seedlings were bundled in five, fixed with a sponge stripe and transferred to plastic pots containing 2.7 L of the following continuously aerated nutrient solution: 0.7 mM K2SO4, 2.0 mM Ca(NO3)2, 0.2 mM KH2PO4, 0.75 mM MgSO4, 0.1 mM KCl, 100 (M FeEDTA, 1 (M H3BO3, 0.5 (M MnSO4, 0.2 (M CuSO4, and 0.02 (M (NH4)6Mo7O24. Each treatment was replicated three times. Plants were grown in a climate chamber set to light-dark cycles of 16-8 h with a photosynthetic photon flux density of 450 (mol m-2s-1 at plant height during the light cycle and a temperature regime of 24-20oC during the light-dark cycles. Nutrient solutions were renewed every three days.
Seven-day-old seedlings were subjected to foilar application of five concentrations of CP, DM and their combination.
After 3 weeks of treatment, plant MDA level and SOD, GSH-Px, and CAT activities were determined.
Tissue extracts of wheat plants were prepared for enzyme activity determinations. One g material was homogenized in 4 ml 20 mM phosphate buffer (pH 7.4). The ho-mogenate was then centrifuged at 15000 x g for 15 min. The supernatant was used for enzyme analysis. All operations (until the enzyme determination) were done at 4 °C.
2. 2. Enzymatic Assays
The SOD assay was based on the inhibitory effects of SOD on the spontaneous autoxidation of 6-hydroxydopa-mine.9 One IU is the amount of SOD required to inhibit the initial rate of 6-hydroxydopamine autoxidation by 50%. CAT activity was assayed in a reaction mixture containing 25 mM phosphate buffer (pH 7.0) 10.5 mM H2O2, and enzyme. The decomposition of H2O2 was followed at 240 nm (E = 39.4 mM-1 cm-1).10 One IU of enzyme activity is the amount of the enzyme, which decomposes 1 ^mol H2O2 per min at 25 °C. The determination of GSH-Px activity was based on the method of Paglia and Valentine.11 GSH-Px catalyses the oxidation of GSH by cumene hydroperoxide. In the presence of GSH reductase and NA-DPH, the oxidized glutathione is immediately converted to the reduced form with a concomitant oxidation of NA-DPH to NADP+. The decrease in absorbance of NADPH was measured at 340 nm.
2. 3. Non-enzymatic Assays
GSH was estimated based on Ellman 5,5'-Dithio-bis(2-nitrobenzoic acid) (DTNB) reactivity. Samples were evaluated for colored component production using a spec-trophotometric assay for DTNB at 412 nm.12
LPO was estimated based on thiobarbituric acid (TBA) reactivity. Samples were evaluated for MDA production using a spectrophotometric assay for TBA.13 The extinction coefficient of 153 mM-1 cm-1 at 532 nm for the chromophore was used to calculate the MDA-like TBA.
The total protein content was determined by the method of Bradford using bovine serum albumin (BSA) as standard (data not shown).14
Data are given as mean ± standard deviation. Statistical analysis of data was performed on computer by using SPSS Version 11.0. Kruskal Wallis was used for comparis-ion of six groups. If a difference was detected by using Kruskal Wallis test, the Bonferonni-corrected Mann-Whitney U test was used to determine which two groups were significantly different.
2. 4. Fresh Weight and Shoots Length
The fresh weight of whole seedlings (roots included) and shoot length was measured at 7th, 14th and 21th days.
3. Results and Discussion
Antioxidative defense mechanism and LPO in wheat tissues display different responses depending on different pesticide treatments (CP as an organophosphate, DM as a pyre-throid pesticide) and doses. All the results from various treatment groups have been compared to each other and to control.
Biochemical analysis showed that there was a significant increase in MDA level of plant after low- and high-doses pesticide (CP, DM) treatments compared to control (Fig. 1). At high doses of DM and CP, the wheat showed remarkable increase LPO levels compared to those of low dose of DM and CP treatments (p < 0,001). The highest LPO levels in plant were observed as 295.17% in high dose CP treatment and as 226.03% in high dose DM treatment when compared with control plant. DM and CP combination group of plants showed significant maximum LPO level (308.97%) respect to control.
The results of the present study clearly demonstrate that CP, DM and their combination produced adverse effects on wheat plants, the major symptoms were reduced growth, disruption of the antioxidant system and significantly increased of LPO level.
However, the relative responses of LPO affected by CP were more pronounced than in case of DM. According to the present experiments, we concluded that LPO may be one of the molecular mechanisms involved in CP and DM-induced toxicity. Also the same mechanism may be operated for DM treatment caused the LPO induction.
Figure 1. Effect of chlorpyrifos and deltamethrin on the wheat plant lipid peroxidation as measured by MDA value. CP and DM were administered in different doses. Group I (control group), group II (1 mg kg1 CP group), group III (15 mg kg1 CP group), group IV (5 mg kg1 DM group), group V (35 mg kg1 DM group), group VI (combination group of 1 mg kg-1 CP and 5 mg kg-1 DM). Values are represented as means ** significantly different from control at P < 0.001.
The observed activities of antioxidative enzymes such as SOD (a scavenger of superoxides), CAT (a scavenger of H2O2) and GSH-Px are shown in Table. 1.
Table 1. Effect of CP and DM on the SOD, CAT and GSH-Px activities of wheat plant. Values are represented as means S.D. of eight plants in each group. ** Significantly different from control at P < 0.001.
	Antioxidant Enzyme Activities		
Groups	SOD	CAT	GSH-Px 103
	(IU/mg)	(IU/mg)	(IU/mg)
I	61.43	132.23	51.31
II	96.87 **	211.36**	59.30
III	82.18	150.62	29.03**
IV	76.14	147.79	78.68**
V	116.51**	306.41**	71.27
VI	118.09**	160.00	64.53
SOD activities were significantly increased in both pesticide treatment groups (Table 1). While SOD activities in the CP treatment group showed a negative correlation with CP concentration, DM treatment group displayed a positive correlation with the concentration. The maximum SOD activity was observed in DM and CP combination group of plants as 88.74% (p < 0.001).
GSH-Px activities were significantly increased in wheat tissues except for high dose CP treatment group (Table 1). GSH-Px activities in plants showed a negative correlation with CP and DM concentrations. The maximum GSH-Px activity was observed in low dose DM group of plants as 53.34% (p < 0.001).
CAT activities were significantly increased in all groups (Table 1). While CAT activities in wheat showed a
negative correlation with CP concentration, a positive correlation was observed due to the DM concentration. The maximum increase was observed in high dose DM group as 131.62% (p < 0.001).
GSH levels in wheat plants were decreased in all groups except for low dose CP treatment group showed a negative correlation with CP and DM concentrations (Fig. 2).
3,5 -
I	II	Itl	IV	V	VI
Groups
Figure 2. Effect of chlorpyrifos and deltamethrin on the wheat GSH level. CP and DM were administered in different doses. Group I (control group), group II (1 mg kg-1 CP group), group III (15 mg kg-1 CP group), group IV (5 mg kg-1 DM group), group V (35 mg kg-1 DM group), group VI (combination group of 1 mg kg-1 CP and 5 mg kg-1 DM). Values are represented as means ± S.D. of eight plants in each group. ** Significantly different from control at P < 0.001.
Fresh weight and shoot length in wheat plants were decreased in all groups and the maximum decreases were observed in DM and CP combination group of plants as 86.64% and 83.64%, respectively (p < 0.001) (Table 2.).
It appears that the cells under stress increase the production of antioxidant enzymes that scavenge the free rad-icals.15 Once free radicals are formed, the cells start some physiological defense mechanisms to prevent the damage. SOD, CAT and GSH-Px activities at 1 mg kg-1 increased activities, while 15 mg kg-1 decreased those. It is highly likely that 3 weeks of treatment with 15 mg kg-1 of CP caused more wheat tissue injury than did 1 mg kg-1. The negative correlation could be a reflection of tissue loss due to the toxic action of these pesticides. Some studies indicated that superoxide radicals can inhibit GSH-Px16 and CAT activities17, and singlet oxygen and peroxyl radicals can inhibit SOD and CAT activities.18 As pointed out by Oncu et al., if CP inhibits GSH-Px and CAT significantly via ROS induced by CP, H2O2 will accumulate.19 The increased H2O2 could cause SOD inhibition, so that superoxide radicals would increase. The increased superoxide radicals would inhibit both CAT and GSH-Px so that H2O2 would accumulate in the medium, causing SOD inhibition and increased superoxide radicals. The observed inhibitions of SOD, CAT and GSH-Px may be due to the direct effect of CP or due to the effect of ROS induced by CP or both.
Table 2. Growth parameters: Fresh weight and % Germination of wheat for different treatments
Growth	Treatments		Plant growth (in days)	
parameters	(% + mM)	7	14	21
Fresh weight (mg)	I	60 ± 2	150 ± 2	189 ± 3
	II	52 ± 2	110 ± 2s	183 ± 8e
	III	45 ± 2	102 ± 2s	173 ± 9e
	IV	50 ± 2	130 ± 2s	162 ± 5e
	V	40 ± 2	120 ± 09e	140 ± 4 e
	VI	30 ± 2	95 ± 11s	119 ± 11e
Shoot length (cm)	I	5.2 ± 2	11.3 ± 2	20.2 ± 2
	II	4.9 ± 2	10.5 ± 2	19.2 ± 2
	III	4.6 ± 2	9.9 ± 2	18.1 ± 2
	IV	3.9 ± 2	9.5 ± 2	16.5 ± 2
	V	3.5 ± 2	9.4 ± 2	16.4
	VI	2.9 ± 2	8.7 ± 2	14.4
Data are 'mean ± S.D' the mean ± SD of three independent experiments. s p < 0.05 (probably significant) E p < 0.01 (definitely significant)
In the present study, significant elevations in the SOD and CAT activities were indicated in DM-toxicated plants with increasing dose. These results show that SOD and CAT display co-operative functions for preventing a partial protection of membrane lipid against oxidative stress under DM treatment compared to CP treatment.
GSH is an important antioxidant system of most aerobic cells.20 It plays a key role as a cofactor with a variety of enzymes including GSH-Px. GSH depletion has been shown to intensify LPO and predispose cells to oxidant damage.21 This study demonstrates that enhanced CP and DM concentrations effect on GSH loss and LPO elevation in wheat plants. When the relative responses of LPO and GSH were compared, effects of these pesticides were more pronounced in case of decrease in GSH than the LPO induction in wheat plants. Thus, it is concluded that endogenous GSH plays an important protective role against CP than DM and induced oxidative damage in vivo.
Groten et al., suggest that a simple mixture should be evaluated by testing each individual compound separately, and thereafter different combinations of the compounds.22 Testing mixture in this way, it would be possible to identify the compound(s) responsible for possible interactions. As mixture models improve, more precise data throughout the toxicity range could be required. More research on pesticide mode of toxic action and secondary physiological effects caused by pesticides would provide a platform for understanding the physiology of mixture effects, lead to better predictive models, and allow for rational experimental design. We believe that these types of studies are critical for realistic estimations of toxicity, because rarely are organisms exposed to only a single chemical in the field. In the present study, the two pesticides (CP and DM) were tested individually, and one combination group. It was shown that inhibition of GSH level in the combination group induced LPO level. These observations suggest that
the effect of combination of CP and DM on the oxidative stress may be synergistic.
Pesticides before authorized and registered to be used in European Union (EU), member states undergo extensive chemical, biological (effectiveness), toxicological and environmental behaviour scrutiny investigations in the field of water policy.23 According to this prioritization approach 71 pesticides were identified as being pollutants in the Pinios River Basin of Central Greece reflecting the current situation of land use and agricultural practices.24 CP ranked first potential hazardous candidate for the Pin-ios River basin and DM did not rank as a potential hazardous. In the present study, we also concluded that the effect of the combined of CP and DM biochemical behavior scrutiny may be much better than DM alone.
4. Conclusions
These data present evidence that, CP and DM treatments lead to enhanced toxicity in wheat plant in relation to dose. The enhancements of LPO suggest the involvement of free radicals intermediates in these pesticide tox-icities. The existence of an inducible antioxidant system may reflect an adaptation by the organism. Increased anti-oxidant defense system of wheat resulted in partial protection of membrane lipid against oxidative stress under DM treatment compared to CP.
5. References
1.	C. G. Castillo, M. Montante, L. Dufour, M. Martinez, M. E. Jimenez-Capdeville, Neurotoxic. Teratol 2002, 24, 797-804. DOI:10.1016/S0892-0362(02)00268-4
2.	R. J. Richardson, T. B. Moore, U. S. Kayyali, J. H. Fowke, J. C.
Randall, Fundam. Appl. Toxicol. 1993, 20, 273-279. DOI:10.1006/faat.1993.1036
3.	D. Bagchi, M. Bagchi, E. A. Hassoun, S. J. Stohs, Toxicol 1995, 104, 129-40. DOI:10.1016/0300-483X(95)03156-A
4.	L. Liang, Y. L. Lu, H. Yang, 2012, Environ. Sci. Pollut. R. 19, 2044-2054. DOI: 10.1007/s11356-011-0698-7
5.	M. I. Yousef, T. I. Awad, E. H. Mohamed, Toxicol. 2006, 227, 240-247. DOI:10.1016/j.tox.2006.08.008
6.	S. P. Bradburry, J. R. Coast, Rev. Environ. Contam. Toxicol. 1989, 108, 134-77. DOI:10.1007/978-1-4613-8850-0_4
7.	Y. Shukla, A. Arora, A. Singh, Toxicol. 2001, 163, 1-9. D0I:10.1016/S0300-483X(00)00416-9
8.	F. Bashir, T. O. Siddiqi, Mahmooduzzafar, M. Iqbal, Environ. Pollut. 2007, 147, 94-100. D0I:10.1016/j.envpol.2006.08.013
9.	N. Crosti, T. Servedi, J. Bajer, A. Sera, J. Clin. Chem. Clin. Bio-chem. 1987, 25, 265-267.
10.	H. E. Aebi, 1983, Catalase, In: Methods of Enzymatic Analysis, 3rd Ed., Deerfield Beach, Florida: Verlag Chemic, pp. 273286.
11.	D. E. Paglia, W. N. Valentine, J. Lab. Clin. Med. 1967, 70, 158169.
12.	F. Tietze, Anal. Biochem. 1969, 27, 502-522. DOI: 10.1016/0003-2697(69)90064-5
13.	H. H. Draper, M. Hadley, Methods. Enzymol. 1990, 186, 421431. D0I:10.1016/0076-6879(90)86135-I
14.	M. M. Bradford, Anals. Biochem. 1976, 72, 248-252. DOI: 10.1016/0003-2697(76)90527-3
15.	B. D. Banerjee, V. Seth, R. S. Ahmed, Rev. Environ. Health. 2001, 16, 1-40. D0I:10.1515/REVEH.2001.16.1.1
16.	D. Debnath, T. K. Mandal, J. Applied. Toxicol. 2000, 20, 197204. D0I:10.1002/(SICI)1099-1263(200005/06)20:3<197::
AID-JAT634>3.0.C0;2-7
17.	J. L. Freeman, M. W. Persans, K. Nieman, Plant Cell 2004, 16, 2176-2191. D0I:10.1105/tpc.104.023036
18.	F. Gultekin, M. Ozturk, M. Akdogan, Arch. Toxicol. 2000, 74, 533-538, 2000. D0I:10.1007/s002040000167
19.	J. A. Escobar, M. A. Rubio, E. A. Lissi, Free Radic Biol Med. 1996, 20, 285-290. D0I:10.1016/0891-5849(95)02037-3
20.	D. Dolphin, R. Poulson, R. Avramovic, 1998, Glutathione: chemical, biochemical and medical aspects, Willey, New York, NY Parts A and B.
21.	R. G. Nath, J. E. Ocanda, J. P. Richie, F. L. Chung, Chem Res Toxicol. 1997, 10, 1250-1253. D0I:10.1021/tx9701079
22.	J. P. Groten, V. J. Feron, J. Suhnel, Trends. Pharmacol. 2001, 31, 316-321. D0I:10.1016/S0165-6147(00)01720-X
23.	European Commission (EU) 2013. Decision 2013/39/EC on environmental quality standards in the field of water policy. Off. J. Eur. Communities (2013), L 226/1 (12.08.2013).
24.	A. Tsaboula, E. N. Papadakis, Z. Vryzas, A. Kotopoulou, K. Kintzikoglou, Environ. Inter. 2016, 91, 78-93. D0I:10.1016/j.envint.2016.02.008
Povzetek
Cilj te študije je bil analizirati spremembe v aktivnostih antioksidantnih encimov (kot so superoksid dismutaze (SOD), katalaze (CAT), glutation peroksidaze (GSH-Px) in stopnje peroksidacije glutationa in lipidov (LPO) pšenice akutno zdravljenie s klorpirifosom in deltametrinskim zdravljenjem pri nizkih in visokih odmerkih in njihovi kombinaciji. Klorpirifos (CP) in deltametrin (DM) so dajali pšenici v različnih odmerkih po 1, 1,5, 5 in 35 mg kg-1, samostojno in v kombinaciji. Po 3 tednih so bile zabeležene in analizirane stopnje antioksidantnih encimov ter ravni glutationa GSH, askorbata in lipidov. Antioxidativni obrambni mehanizmi in peroksidacija lipidov pri pšenici kažejo različne odzive, odvisno od različnih pesticidov in odmerkov. Biokemijske analize so pokazale, da klorpirifos in deltametrin povzročata poškodbe rastlinskega tkiva. Predlagamo, da se ustrezno oceni ekotoksikološko tveganje na območjih, kjer se deltametrin uporablja za zatiranje škodljivcev v primerjavi s klorpirifosom. V tej študiji smo ugotovili tudi, da je lahko učinek kombinacije klorpirifosa in deltametrina sinergističen.
DOI: 10.17344/acsi.2017.3620
Acta Chim. Slov. 2018, 65, 271-277
Scientific paper
Simultaneous Sensitive Detection of Lead(II), Mercury(II) and Silver Ions Using a New Nucleic Acid-Based Fluorescence Sensor
Yuan Deng,1 Yinran Chen2 and Xiaodong Zhou2'*
1	Institute of Scientific Research & Development, Wuhan University, Wuhan 430072, PR China.
2	College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072, PR China.
* Corresponding author: E-mail: Email: zhouxd@whu.edu.cn Phone: +86 027 68752439 fax: +86 027 68752136
Received: 07-06-2017
Abstract
A new nucleic acid-based fluorescence sensor is reported for simultaneous detection of Pb2+, Ag+, and Hg2+ based on the specific catalytic activity of Pb2+ for a particular DNAzyme, specific regulation of Ag+ on "C-Ag+-C" complex, and stable complex formed by Hg2+ and rhodamine B isothiocyanate (RBITC). Three fluorescence dyes, aminomethylcoumarin acetic acid (AMCA), 5-carboxyfluorescein (FAM), and RBITC, were modified on the probes and served as fluorescent donors. Upon DNA interaction with these metal ions and AuNP fluorescence quenching effect on the fluorescence dyes, the fluorescence recovery of RBITC and the fluorescence quenching of AMCA and FAM were monitored to detect Hg2+, Pb2+, and Ag+, separately, without the need of using any masking reagents. This sensor exhibited high sensitivity and selectivity. The limit of detection (LOD) is 0.48 nM for Pb2+, 0.23 nM for Ag+, and 0.17 nM for Hg2+. Finally, this sensor was successfully applied for simultaneous detection of Pb2+, Ag+, and Hg2+ in real sample.
Keywords: Fluorescent sensor; Au nanoparticles (AuNPs); DNAzyme; simultaneous detection; metal ions
1. Introduction
With the ever increasing pollution from modern industry, heavy metal contaminants have posed severe adverse effects on human health and ecosystems due to their high and persistent toxicities.1,2 Therefore, it is quite necessary and urgent to rapidly and accurately detect these metal ions. Traditional methods, such as atomic absorption spectrometry (AAS),3 inductively coupled plasma mass spectrometry (ICP-MS),4 and anodic stripping voltamme-try (ASV),5 have high sensitivity and selectivity but require specialized instrumentation and extensive sample pre-treatment processes which limit their applications for in situ analysis.6,7
In recent years, much effort has been devoted toward design of DNA-based sensors to detect heavy metal ions, especially Ag+, Hg2+, and Pb2+, which are three of the most toxic heavy metals.8 The detection of Pb2+ relies on the specific catalytic activity of Pb2+ for the particular DNA-zyme. For Pb2+ detection, most detectors were based on the Pb2+-dependent DNAzyme9,10 and Pb2+-stabilized
G-quaduplex.11,12 As for Hg2+ and Ag+, the detections relies on the selective capture of Hg2+ by T-T mismatches to form T-Hg(II)-T base pairs,13,14 and the exclusive recognition of Ag+ by C-C mismatches to form C-Ag(I)-C complex.15,16 Accordingly, various detection techniques, such as colorimetry, 17-19 electrochemistry,10,20,21 and fluorescence,15,22,23 were applied to selectively detect Pb2+, Ag+, or Hg2+. Given that metal ions usually coexist in several samples, some researches have been focused on the simultaneous detection of two or more metal ions at trace level, such as Pb2+ and Hg2+, 24,25 as well as Hg2+ and Ag+.26-28
However, with regard to the sensors designed for the simultaneous detection of three metal ions, there are only a few relevant reports. Zhang et al.29 developed a colorimet-ric assay for parallel detection of Cd2+, Ni2+, and Co2+ utilizing peptide modified gold nanoparticles as a sensing element based on its unique surface plasmon resonance properties. Hien et al.30 designed a fluorescent chemosensor based on dimethylaminocinnamaldehyde-aminothiourea and applied it for simultaneous detection of Ag+, Hg2+, and Pb2+. Lin et al.31 reported an unlabeled immobilized DNA-
based sensor for simultaneous detection of Pb2+, Ag+, and Hg2+ by electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]4-/3- as redox probe. However, they have some limitations including poor selectivity, insufficient sensitivity, or the need of using the masking reagent.
In this paper, we designed a DNA-based sensor to achieve a rapid, simple and simultaneous detection of Pb2+, Ag+, and Hg2+ based on the DNA interaction with these metal ions and AuNP fluorescence quenching effect on the fluorescence dyes. Three fluorescence dyes, amino-methylcoumarin acetic acid (AMCA), 5-carboxyfluores-cein (FAM), and rhodamine B isothiocyanate (RBITC), were introduced in this assay to detect Pb2+, Ag+, and Hg2+, respectively. Consequently, no masking reagent was needed in this method so that the detection process was simplified and speeded up. Fluorescence spectra were used at trace level due to its high sensitivity.
2. Experimental
2. 1. Materials and Instrumentation
Reagents including AgNO3, Hg(NO3)2, Pb(NO3)2, Ca(NO3)2, Mg(NO3)2, Al(NO3)3, Co(NO3)2, Cu(NO3)2, Cr(NO3)3, Zn(NO3)2, Ni(NO3)2, KNO3, NaNO3, Cd(NO3)2, trisodium citrate, 1% HAuCl4, K2CO3, RBITC, High Performance Liquid Chromatography (HPLC) purified oligonucleotides (aDNA:5'-FAM-ACCCCTC-3, bDNA:5'-ATGT-CACTT-3'-SH-, cDNA: 5'-AMCA-AAGTGACA TrAG-GACGATCACCCCT-3'-SH-, dDNA:5'- ATCGTCTC-CGAGCCGGTCGAAATGTC-3') were purchased from Shanghai Sangon Biotechnology Co., Ltd. Deionized water (18.2 MO cm resistivity) from a Millipore Milli-Q system was used throughout this work.
Fluorescence spectra were recorded by F-4600 fluorescence spectrophotometer (Hitachi, Japan) with the excitation and emission slit widths 5.0 nm and 10.0 nm, voltage 700 V, and excitation and emission wavelengths of 495 nm and 517 nm for FAM-ssDNA, 530 nm and 580 nm for RBITC, and 353 nm and 450 nm for AMCA, respectively.
2. 2. Preparation of Functionalized AuNPs Probe and Analytical Procedure
cDNA (5 ^M) and dDNA (5 ^M) were mixed uniformly, reacting for 5 min in 90 °C water bath. Then the mixture was gradually cooled to room temperature to form double-stranded "cDNA+dDNA".
RBITC solution (1 mM, 10 ^L) was added into AuNPs suspension (13 nm, 1 mL); the mixture was incubated at room temperature for 2 h, and then centrifuged. The filter cake was added to double-stranded "cDNA+dDNA" solution (5 ^M) and bDNA solution (5 ^M), respectively, to synthesize cDNA+dDNA-AuNP and bDNA-AuNP probes. Next, the solution containing cDNA+dDNA-AuNP and bDNA-AuNP probes was mixed uniformly with the
same volume of aDNA solution. All the prepared mixtures were stored at 4 °C for later use.
For Pb2+ sensing, Pb2+ solutions of different concentrations (10, 50, 100, 300, 500, 700 and 1000 nM) were prepared and added into the sensor solution prepared as described above, reacting at room temperature for 20 min. The concentration of both Ag+ and Hg2+ were 10 ^M in these solutions. Afterwards, the fluorescence emission spectra were measured at excitation wavelength of 353 nm. For Ag+ and Hg2+ detection, similar procedures were followed to those described for Pb2+.
For the selectivity measurement, other metal ions solution (10 ^M) were added into the sensor solution, and the fluorescence spectra were monitored at excitation wavelengths of 353 nm, 495 nm, and 530 nm, respectively.
The real sample was collected from East Lake in Wuhan City and used after being filtered, and the sample was spiked with different concentrations of Pb2+, Ag+, and Hg2+ to implement the recovery test.
3. Results and Discussion 3. 1. Sensing Strategy
Fig. 1 depicts the process of simultaneous detection. Three fluorescent dyes, AMCA, FAM, and RBITC, served as fluorescent donors for detection of Pb2+, Ag+, and Hg2+, respectively. The newly synthesized AuNPs were selected as fluorescent receptor owing to their advantages, such as: small particle size, large specific surface area, strong adsorption capacity and excellent water-solubility. RBITC was initially combined with AuNP (recorded as AuNP-RBITC), resulting in fluorescence quenching at 580 nm. AMCA was specially designed to label at one end of the substrate strand of 8-17 DNAzyme, and the other end was combined with AuNP, emitting fluorescence signal at 450 nm. FAM was combined with ACCCCTC-3' (aDNA), and this FAM-aDNA fluoresced at 520 nm. In addition, the surfaces of some AuNPs were modified with 5'-ATGT-CACTT-3'-SH-(bDNA). Then when adding Pb2+, Ag+, and Hg2+ into the bulk solution, the fluorescence intensity would change due to the interaction between these metal ions and the DNA sequences labeled by fluorescent dye. Pb2+ cleaved the substrate strand of DNAzyme at the ribonucleic adenosine (rA) base, releasing two kinds of DNA fragments: AuNP-cDNA and AMCA-dDNA. dDNA com-plementarily paired with bDNA-AuNP, to shorten the distance between AMCA and the surface of AuNPs, resulting in fluorescence quenching of AMCA. Simultaneously, Ag+ prompted AuNP-cDNA and aDNA to form a strong double-stranded DNA via the stable "C-Ag+-C" complex, resulting in fluorescence quenching of FAM. There is also a limitation in our sensor that Ag+ cannot be detected in the absence of Pb2+. If there is no Pb2+ in the system, a slight amount of Pb2+ should be introduced to trigger the subsequent reactions.
Fig. 1. Schematic of simultaneous detection of Ag+, Hg2+, and Pb2+ using AuNP-based fluorescent sensors.
As for Hg2+, owing to the larger stability constant of the complex formed by Hg2+ and RBITC than that of the complex formed by AuNPs and RBITC, RBITC would displace from the surface of AuNPs and combine with Hg2+, leading to fluorescence recovery of RBITC.
3. 2. Simultaneous Detection of Pb2+, Ag+, and Hg2+
Fig. 2 shows the fluorescence emission spectra of the AuNP probe solution before and after adding Pb2+, Ag+, and Hg2+. As illustrated in Fig. 2(A), the presence of Pb2+ in the AuNP-bDNA and AuNP-cDNA+dDNA-AMCA solution leads to ~95% fluorescence quenching of AMCA (compare Curves 3 with 1 or 2), due to the complementary pairing of AuNP-bDNA with the released AMCA-dDNA caused by Pb2+-induced cleavage. In Fig. 2(B), fluorescence of FAM quenched ~70% with the addition of Ag+ into FAM-aDNA and AuNP-cDNA-dDNA-AMCA (compare Curves 6 with 4 or 5) owing to the Ag+-introduced combination of FAM-aDNA and AuNP-cDNA released after Pb2+-induced cleavage. In Fig. 2(C), the significant
fluorescence recovery of RBITC (compare Curves 7 and 8) proves the strong binding of Hg2+ and RBITC, which impelled the RBITC's departing from surface of AuNPs and caused fluorescence recovery.
In Fig.2(A), the coincidence of Curve 1 and 2 shows that fluorescence signal was almost unchanged when AuNPs-bDNA was added into AuNP-cDNA+dDNA-AM-CA, indicating dDNA and bDNA would not pair in the absence of Pb2+, which can guarantee the precision for Pb2+. Similarly, fluorescence signal of FAM remained almost unchanged when aDNA was added into AuNP-cD-NA+dDNA-AMCA (compare Curve 4 with 5). It is because cDNA part of the DNAzyme substrate strand was specially designed to be rich in an odd number of C bases arranged asymmetrically, so as to avoid the combination of "C-Ag+-C" complex by aDNA itself in the presence of Ag+ and improve the precision of detection of Ag+. In order to further ensure the precision of this detection method, we analyzed the mutual impacts among the three metal ions during the detection process. As shown in Fig. 3, the detection results remained unchanged in the presence of all three metal ions or only one of these metal ions, proving
X (rim)	-i(nm)	¿(nmj
Fig. 2. Fluorescence emission spectra of the detection of (A) Pb2+ (Aex = 353 nm, Aem = 450 nm), (B) Ag+ (Aex = 495 nm, Aem = 517 nm), (C) Hg2+ (Aex = 530 nm, Aem = 580 nm) in the solution containing (1) AuNP-cDNA-dDNA-AMCA, (2) AuNP-cDNA-dDNA-AMCA + AuNP-bDNA, (3) AuNP-cDNA-dDNA-AMCA + AuNP-bDNA + Pb2+, (4) FAM-aDNA, (5) FAM-aDNA + AuNP-cDNA, (6) FAM-aDNA + AuNP-cDNA + Ag+, (7) AuNP-RBITC, (8) AuNP-RBITC + Hg2+.
3000
I ¡Synthesized material without metal ion i i Synthesized material with Pb2*, Ag* and Hg3* ^■Synthesized material with only metal ion to be detected
530	435	353
¿ex (nm)
Fig. 3. Mutual impacts among the three metal ions during the detection process.
that the detection of these three metal ions was independent from each other.
Furthermore, fluorescence intensity changes rapidly in response to the addition of the metal ions. As shown in Fig. 4, the reactions reached equilibrium after about 600 s for Pb2+, 200 s for Ag+, and 200 s for Hg2+. The results indicated that this sensor allows a rapid detection of three heavy metal ions with high stability.
3. 3. Sensitivity and Selectivity of Simultaneous Detection for Pb2+, Ag+, and Hg2+
In order to evaluate the sensitivity of the sensor for Pb2+, Ag+, and Hg2+, different concentrations of these metal ions were added into the sensor solution under the optimized conditions such as pH = 8.0, RBITC concentration is 1 mM and DNA concentration is 5 ^M.
f(s)	f(s)	f(s)
Fig. 4. Fluorescence intensity changes vs. time after adding (A) Pb2+, (B) Ag+, and (C) Hg2+.
Figure 5. Fluorescence emission spectra of (A) Pb2+ (Aex = 353 nm, Aem = 450 nm), (B) Ag+ (Aex = 495 nm, Aem = 517 nm), and (C) Hg2+ ( Aex = 530 nm, Aem = 580 nm), and standard curves of (D) Pb2+, (E) Ag+, and (F) Hg2+ in the concentration of (a~b) 10, 50, 100, 300, 500, 700, 1000 nM. F is measured fluorescence intensity, F0 is background fluorescence intensity.
As shown in Fig. 5, the fluorescence spectra changed regularly. The intensity of AMCA (Aex = 353 nm, Aem = 450 nm) and FAM (Aex = 495 nm, Aem = 517 nm) gradually decreased with increased concentration of Pb2+ and Ag+, respectively; while the intensity of RBITC ( Aex = 530 nm, Aem = 580 nm) increased with the increased concentration of Hg2+, which proved the fluorescence quenching caused by Pb2+ and Ag+, and the fluorescence recovery caused by Hg2+. The LOD (limit of detection) of this assay was 0.48 nM, 0.23 nM and 0.17 nM for Pb2+, Ag+, and Hg2+, respectively. The linear range was 10 nM~1000 nM for the three ions.
The selectivity of the sensing system was also explored: the fluorescence spectra were monitored upon adding other metal ions (such as 10 pM Mg2+, Ca2+, Fe3+, Co2+, Ni2+, Zn2+, Cd2+, Al3+, Cr3+, Cu2+) to the sensing system in the presence of 1 pM Ag+, Hg2+, and Pb2+. As shown in Fig. 5, Only Pb2+ , Ag+, and Hg2+ caused considerable changes in the intensity of fluorescent signals while other ions have little effect on this system. These results illustrated that the sensor was specifically responding to the three metal ions.
The comparison of the proposed sensor with other methods for simultaneous determination of three metal
ions is listed in Table 1. As it can be seen, the proposed sensor has a comparable and even higher sensitivity to the previous reports, and no masking reagent was used in this method, indicating that this sensor was an appropriate platform for the determination of these metal ions.
3. 4. Detection of Pb2+, Hg2+, and Ag+ in Real Samples
This sensor's application in real samples (water of the East Lake) were investigated by Standard Recovery Test. the sample of the East Lake water was filtered through a 0.45 ^m cellulose acetate filter membrane, and then the water sample (10 ^L) was added to the prepared sensor. Afterwards, the standard solution of three metal ions was added to reach the final concentration of 10 nM. The fluorescence intensities were detected at 450 nm, 580 nm and 517 nm. The fluorescent quenching responding to Pb2+ and Ag+, and recovery responding to Hg2+ were also observed in East Lake water (as indicated in Fig. 7), and Table 2 shows that the satisfactory recoveries were obtained for the real samples. The average recoveries are
6 7 8 Ions
450 nm; (B) AeJ
= 495 nm, Aem = 517 nm; (C) Aex = 530 nm, Aem = 580 nm.
Figure 6. Selective detection of three metal ions at (A) Aex = 353 nm, Aem 1-13: Pb2+, Ag+, Hg2+, Mg2+, Ca2+, Fe3+, Co2+, Ni2+, Zn2+, Cd2+, Al3+, Cr3+, Cu2+. The concentrations of Pb2+, Ag+, Hg2+ to be measured were 1 pM, and the concentrations of other metal ions were 10 pM. F is measured fluorescence intensity, F0 is background fluorescence intensity.
Table 1. The comparison of our sensor with other methods for simultaneous determination of three metal ions.
Method	Ions detected and its LOD	Using masking reagent	Ref.
peptide modified gold nanoparticles probe	Cd2+ (0.05 mM) Ni2+ (0.3 mM) Co2+ (2 mM)	Y	[29]
fluorescent chemosensor based on dimethylaminocinnamaldehyde- aminothiourea	Ag+ (1.0 ppb) Hg2+ (2.8 ppb) Cu2+ (0.8 ppb)	Y	[30]
DNA-based sensor	Ag+ (10 nM) Hg2+ (0.1 nM) Pb2+ (10 pM)	Y	[31]
Ag+ (0.23 nM )
DNA-based sensor	Hg2+ (0.17 nM )	N	Our method
Pb2+ (0.48 nM)
/.(nm)	?. (rim)	(run)
Figure 7. Fluorescence curves of (A) Pb2+ (with added standard concentration of (a) 0, (b) 50 nM, (c) 300 nM, and (d) 700 nM), (B) Ag+ (with added standard concentration of (a) 0, (b) 10 nM (c) 100 nM, and (d) 700 nM), and (C) Hg2+ (with added standard concentration of (a) 0, (b) 10 nM (c) 100 nM, and (d) 700 nM) in East Lake water.
Table 2. Standard Recovery Test for detection of the metal ions in East Lake water.
Metal ions	Sample	Measured concentration in test sample /nM	Added standard concentrations /nM	Measured concentration after adding standard concentrations / nM	Recover /%
	1	9.79	50	67.71	115.8
Pb2+	2	9.79	300	331.04	107.1
	3	9.79	700	726.46	102.4
	1	1.12	10	12.36	112.4
Ag+	2	1.12	100	105.62	104.5
	3	1.12	700	719.72	102.7
	1	1.45	10	11.32	98.7
Hg2+	2	1.45	100	105.39	103.9
	3	1.45	700	707.76	100.9
108.43% for Pb2+, 106.53% for Ag+ and 101.17% for Hg2+. These results confirmed that the proposed sensor can be successfully used to detect Pb2+, Ag+, and Hg2+ in real samples.
provides a well suitable method to simultaneous detection of a variety of heavy metal ions in environmental monitoring.
4. Conclusions
In this paper, we have described a successful design of a new and simple fluorescent sensor for simultaneous detection of Pb2+, Ag+, and Hg2+ based on the specific catalytic activity of Pb2+ for a particular DNAzyme, specific regulation of Ag+ on "C-Ag+-C" complex, stable complex formed by Hg2+ and RBITC, and AuNP fluorescence quenching effect on fluorescence dyes. Fluorescence quenching of AMCA and FAM, and the fluorescence recovery of RBITC indicated the presence of Pb2+, Ag+, and Hg2+, and the intensity changed corresponding to concentration of these ions. The detection limits of three metal ions were 0.48 nM for Pb2+, 0.23 nM for Ag+ and 0.17 nM for Hg2+.It has been proven that this sensor is characterized by good stability, high sensitivity and selectivity, fast detection speed, and easy operation, and has successfully produced satisfactory detection results in real samples. These attributions suggest that our approach
5. Acknowledgements
This work is supported by the National Natural Science Foundation of China (NSFC) (Grant No. 41273093, 81471696) and the Project of Experimental technology of Wuhan University (Grant No. WHU-2014-SYJS-09). Financial support from the Fundamental Research Funds for the Central Universities is acknowledged.
6. References
1.	G. C. Zhu and C. Y. Zhang, Analyst 2014, 139, 6326-6342. DOI:10.1039/C4AN01069H
2.	T. Li, E. K. Wang, S. J. Dong, Chem. Commun. 2009, 5, 580582. DOI:10.1039/B815814B
3.	Y. Miyake, H. Togashi, M. Tashiro, H. Yamaguchi, S. Oda, M. Kudo, Y. Tanaka, Y. Kondo, R. Sawa, T. Fujimoto, T. Machinami, A. Ono, J. Am. Chem. Soc. 2006, 128, 2172-2173. DOI:10.1021/ja056354d
4.	A. Ataro, R. I. McCrindle, B. M. Botha, C. M. E. McCrindle, P. P. Ndibewu, Food Chem. 2008, 111, 243-248. DOI:10.1016/j.foodchem.2008.03.056
5.	D. W. Pan, Y. E. Wang, Z. P. Chen, T. T. Lou, W. Qin, Anal. Chem. 2009, 81, 5088. DOI:10.1021/ac900417e
6.	S. J. Lee, M. Moskovits, Nano Lett. 2011, 11, 145-150. DOI:10.1021/nl1031309
7.	Y. X. Du, R. Y. Liu, B. H. Liu, S. H. Wang, M. Y. Han, Z. P. Zhang, Anal. Chem. 2013, 85, 3160-3165. DOI:10.1021/ac303358w
8.	A. Sett, S. Das, U. Bora, Biochem. Biotechnol. 2014, 174, 10731091. DOI:10.1007/s12010-014-0990-3
9.	J. Li, Y. Lu, J. Am. Chem. Soc. 2000, 122, 10466-10467. DOI:10.1021/ja0021316
10.	Y. Xiao, A. A. Rowe, K. W. Plaxco, J. Am. Chem. Soc. 2007, 129, 262-263. DOI:10.1021/ja067278x
11.	T. Li, S. J. Dong, E. K. Wang, J. Am. Chem. Soc. 2010, 132, 13156-13157. DOI:10.1021/ja105849m
12.	T. Li, E.K. Wang, S.J. Dong, Anal. Chem. 2010, 82, 1515-1520. DOI:10.1021/ac902638v
13.	Y. Tanaka, S. Oda, H. Yamaguchi, Y. Kondo, C. Kojima, A. Ono, J. Am. Chem. Soc. 2007, 129, 244-245. DOI:10.1021/ja065552h
14.	Y. Miyake, H. Togashi, M. Tashiro, H. Yamaguchi, S. Oda, M. Kudo, Y. Tanaka, Y. Kondo, R. Sawa, T. Fujimoto, T. Machinami, A. Ono, J. Am. Chem. Soc. 2006, 128, 2172-2173. DOI:10.1021/ja056354d
15.	A. Ono, S. Cao, H. Togashi, M. Tashiro, T. Fujimoto, T. Machinami, S. Oda, Y. Miyake, I. Okamoto, Y. Tanaka, Chem. Commun. 2008, 39, 4825-4827. DOI:10.1039/b808686a
16.	H. Torigoe, Y. Miyakawa, N. Nagasawa, T. Kozasa, A. Ono, Nucleic. Acids. Symp. Ser. 2006, 50, 225-226. DOI:10.1093/nass/nrl112
17.	B. Rajam, P. Ramasamy, U. Mahalingam, Acta Chim. Slov. 2017, 64, 186-192. DOI:10.17344/acsi.2016.3054
18.	T. Li, S.J. Dong, E. K. Wang, Anal. Chem. 2009, 81, 2144-2149. DOI:10.1021/ac900188y
19.	J. J. Du, L. Jiang, Q. Shao, X. G. Liu, R. S. Marks, J. Ma, X. D. Chen, Small 2013, 9, 1467-1481. DOI:10.1002/smll.201200811
20.	M. B. Gumpu, S. Sethuraman, U. M. Krishnan, J. B. B. Rayap-pan, Sensor Actuat B-Chem. 2015, 213, 515-533. DOI:10.1016/j.snb.2015.02.122
21.	G. Mor-Piperberg, R. Tel-Vered, J. Elbaz, I. Willner, J. Am. Chem. Soc. 2010, 132, 6878-6879. DOI:10.1021/ja1006355
22.	J. W. Liu, Anal. Chem. 2014, 58, 99-111.
23.	A. Ceylan, S. Z. Bas, M. Bayrakcl, S. Ertul, A. Uysal, Acta Chim. Slov. 2012, 59, 656-663
24.	X. L. Shi, X. Y. Gao, L. L. Zhang, Y. C. Li, Analyst 2015, 140, 2608-2612. DOI:10.1039/C5AN00120J
25.	S. J. Wu, N. Duan, Z. Shi, C. C. Fang, Z. P. Wang, Talanta 2014, 128, 327-336. DOI:10.1016/j.talanta.2014.04.056
26.	C. Y. Lin, C. J. Yu, Y. H. Lin, W. L. Tseng, Anal. Chem. 2010, 82, 6830-6837. DOI:10.1021/ac1007909
27.	G. C. Zhu, Y. Li and C. Y. Zhang, Chem. Commun. 2014, 50, 572-574. DOI:10.1039/C3CC46884D
28.	Y. R. Chen, K. Mao, X. D. Zhou, A. G. Shen, J. M. Hu, Wuhan University Journal of Natural Sciences 2016, 21, 499-504. DOI:10.1007/s11859-016-1202-5
29.	M. Zhang, Y. Q. Liu, B. C. Ye, Analyst 2012, 137, 601-607. DOI:10.1039/C1AN15909G
30.	N. K. Hien, N. C. Bao, N. T. A. Nhung, N. T. Trung, P. C. Nam, T. Duong, J. S. Kim, D. T. Quang, Dyes and Pigments 2015, 116, 89-96. DOI:10.1016/j.dyepig.2015.01.014
31.	Z. Z. Lin, X. H. Li, H. B. Kraatz, Anal. Chem. 2011, 83, 68966901. DOI:10.1021/ac2014096
Povzetek
Poročamo o novem fluorescenčnem senzorju na osnovi nukleinskih kislin za simultano detekcijo Pb2+, Ag+ in Hg2+ ionov. Osnovan je na specifični katalitski aktivnosti Pb2+ ionov za določen DNA encim; na specifični regulaciji Ag+ na »C-Ag+-C« kompleksu; na stabilnem kompleksu, ki ga tvorita Hg2+ in rodamin B izotiocianat (RBITC). Tri fluorescenčna barvila: aminometilkumarin ocetna kislina (AMCA), 5-karboksifluorescein (FAM) in RBITC, smo dodali raztopinam in so služila kot donorji fluorescence. Zaradi interakcije DNA s temi kovinskimi ioni in efekta dušenja fluorescence, ki so ga imeli AuNP delci na fluorescenčna barvila, smo lahko spremljali povečanje fluorescence RBITC za detekcijo Hg2+ ter dušenje fluorescence pri AMCA in FAM za ločeno detekcijo Pb2+ in Ag+, ne da bi bilo treba uporabljati maskirne reagente. Senzor je pokazal visoko občutljivost in selektivnost. Meja zaznave (LOD) je 0,48 nM za Pb2+, 0,23 nM za Ag+ in 0,17 nM za Hg2+. Na koncu smo senzor uspešno uporabili za hkratno detekcijo Pb2+, Ag+ in Hg2+ ionov v realnem vzorcu.
DOI: I0.i7344/acsi.20i7.3667	Acta Chim. Slov. 2018, 65, 278-288	©commohs
Scientific paper
A Highly Selective DNA Sensor Based on Graphene
Oxide-Silk Fibroin Composite and AuNPs as a Probe Oligonucleotide Immobilization Platform
Ali Benvidi,1^ Zohreh Abbasi,1 Marzieh Dehghan Tezerjani,1 Maryam Banaei,1 Hamid Reza Zare,1 Hossein Molahosseini2 and Shahriar Jahanbani1
1 Department of Chemistry, Faculty of Science, Yazd, Yazd, I. R. Iran
2 Department of Textile Engineering, Isfahan University of Technology, Isfahan, Iran
* Corresponding author: E-mail: abenvidi@yazd.ac.ir, benvidi89@gmail.com Tel.: +98 353 812 2645; Fax: +98-353-8210644
Received: 25-06-2017
Abstract
In this study, a simple and novel electrochemical biosensor based on a glassy carbon electrode (GCE) modified with a composite of graphene oxide (GO) - silk fibroin nanofibers (SF) and gold nanoparticles (MCH/ssDNA/AuNPs/SF/GO/ GCE) was developed for detection of DNA sequences. The fabrication processes of electrochemical biosensor were characterized by scanning electron microscopy (SEM), FT-IR and electrochemical methods. Some experimental conditions such as immobilization time of probe DNA and MCH incubation time, time and temperature of hybridization were optimized. The designed biosensor revealed a wide linear range of 1.0 x 10-16 - 1.0 x 10-8 mol L-1 and a low detection limit (3.3 x 10-17 mol L-1) for detection of BRCA1 5382 mutation by EIS technique. The designed biosensor revealed high selectivity for discrimination of the complementary (P1C) sequences from various non-complementary sequences of (P1nC1, P1nC2 and P1nC3). Also, the biosensor revealed a high reproducibility (RSD of 7.5% (n = 4)) and high stability (92% of its initial response after 8 days). So, the fabricated biosensor has a suitable potential to be applied for detection of breast cancer sequences in the initial stages of the cancer.
Keywords: DNA biosensor; immobilization; composite; silk nanofibers; graphene oxide nanosheets
1.Introduction
Breast cancer like other cancers initiates continuous process of aberrant chromosomal changes and consequently leads to damage to DNA.1-3 As known, there are various clinical methods for detection of breast cancer such as mammography, magnetic resonance imaging (MRI) and breast biopsy tests.4 Besides that up to now, lots of techniques such as surface plasmon resonance,5,6 optical fiber,7 quartz crystal microbalance,8 micro cantilever and electrochemical methods have been developed for detection of cancers because the cancer detection in the initial stages is so important.9-13 Most of the optical methods are indirect and need a labeling of target DNA. So, the electrochemical biosensors based on electrochemical techniques such as cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) have been developed for detection of low
concentrations of DNA sequences.14,15 Some great advantages of electrochemical biosensors compared to other types of biosensors are miniaturization, high sensitivity, low cost and fast detection. 16
The immobilization step of the DNA probe on the electrode surface is important in determining the overall performance of an electrochemical DNA biosensor.17 To have a good immobilization process, some materials such as polymer, ionic liquid and nanoparticles have been used as the biosensing interface.18-21 Up to now, lots of nano-particles have been applied for fabrication of biosensors due to some unique properties such as high surface-to-volume ratio, high conductivity and suitable biological com-patibility.22 Graphene is a one-atom-thick 2D carbon na-nomaterial. Graphene oxide is a water dispersible version of graphene with oxygen-containing functional groups such as hydroxyl, carboxyl and epoxy groups.23 Its nano-sheets can adsorb single-stranded DNA (ssDNA) via
non-covalent p-stacking interactions between the hexagonal cells of graphene and the ring structure of nucleobas-es.24 Graphene oxide (GO) has a key role in the construction of biosensors due to its unique characteristics such as good dispensability and simple surface functionality, high electronic, thermal and mechanical properties.25-26 So, in the present work graphene oxide nanosheets were used for immobilization and hybridization processes of DNA strands at the electrode surface.
Another used nanomaterial in this study is silk na-nofiber. Silk fibroin (SF) is a macromolecular protein with molecular weight about 350 kDa which can be extracted from silkworm cocoon. It is highly biocompatible and due to its porous structure allows the growing of cells, growth factors and the production of extracellular matrix (ECM) to enable communication between the cells. Fibroin is extremely versatile and can be processed in very different forms.27-30 One of the most interesting polymers that could be combined with graphene is silk fibroin (SF). In addition to having an excellent and well known biocompatible properties,31 fibroin is a protein with a secondary molecular structure in the form of a beta-sheet that combines well with graphene.32,33 However, there are other configurations of fibroin scaffolds that could be improved after combination with graphene.
Recently, lots of electrochemical sensors based on various nanomaterials have been developed for detection of different targets.34-39 For instance, S. M. Ghoreishi et al. designed an electrochemical method for determination of acetaminophen in different pharmaceutical forms using gold nanoparticles carbon paste electrode.40 B. Bozzini group investigated the electro deposition of Co/CoO nanoparticles onto graphene for electrocatalysis of oxygen reduction reaction by a multi-technique approach.41 Also, B. Mahltig and coworkers fabricated an antimicrobial agent by using the silver nanoparticles in SiO2 microspheres.42
As known, voltammetric methods are simple, sensitive, selective and time-saving.43 A DNA biosensor based on using electrochemical impedance spectroscopy (EIS) technique is a device that transduces changes in interfacial properties between the electrode and the electrolyte surface to an electrical signal. DNA biosensors based on EIS detection are label-free and it means that it is not necessary to use some labels such as fluorophore,44-46 magnetic beads,47 or an enzyme for detection of target.48 Thus, some advantages of this kind of DNA biosensor are: low cost, simplicity, and ease of miniaturization. Also, when the differences in current are not significant in a low target concentration range, the EIS technique is more suitable than other electrochemical detection techniques.
Following our previous works,4,49,50 in the present research an electrochemical biosensor for detection of BRCA1 sequences was designed. This biosensor is based on nano composite of graphene oxide - silk nanofibers and gold nanoparticles as a platform at the glassy carbon electrode (GCE). The fabrication processes of the designed
sensor were followed by electrochemical impedance spec-troscopy (EIS) and cyclic voltammetry (CV) methods. Under optimum conditions, the fabricated biosensor (MCH/ ssDNA/AuNPs/SF/GO/GCE) revealed a wide linear range (1.0 x 10-16 to 1.0 x 10-8 mol L-1) and a low detection limit of 3.3 x 10-17 mol L-1 using EIS method. The designed biosensor revealed a high selectivity for discrimination of complementary from different non-complementary sequences. Briefly, some advantages of MCH/ssDNA/ AuNPs/SF/GO/GCE biosensor are: detecting DNA without using additional labels, easy preparation, possessing high selectivity, sensitivity, reproducibility and stability.
2. Experimental 2. 1. Reagents and Instruments
The used primers and probes were designed based on the breast cancer cells obtained from the Gen Bank database. 6-Mercapto-1-hexanol (MCH) was purchased from Aldrich. HAuCl4 and all other chemicals were of analytical grade and obtained from Merck Company. All of the chemicals were used as received without further purification. The sequences of the used probe and complementary were as follows:
Probe sequence (P1): 5'-AAGCGAGCAAGAGAATTCCAG-3' Complementary sequence (P1C): 5'- GTGAAAGTATCTAGCACTGCTGGAATTCT CTTGCTCGCTT-3'
Non-complementary sequence (P1nC1): 5'-TGTGAAAGTATCTAGCACTGTGGGAAT-TCTCTTGCTCGCT-3'
Non-complementary sequence (P1nC2): 5'-GAGAAACATCTGGGATA-3' Non-complementary sequence (P1nC3): 5'-CACTTTATTTGGGATG-3 For electrochemical measurements an Autolab po-tentiostat/galvanostat model PGSTAT 302 N (Eco Chem-ic, Utrecht, Netherlands) and NOVA 1.7 software at laboratory temperature (25 ± 1 °C) were used. The used three-electrode system was composed of a modified glassy carbon electrode as working electrode, an Ag/AgCl (1.0 mol L-1 KCl) and a platinum wire as reference and auxiliary electrodes, respectively. A Metrohm model 691 pH/mV meter was applied for pH measurements. The graphene nanosheets were synthesized according to the procedure given in the literature.25
2. 2. Preparation of Nano Silk Fibroin
The natural silk fibers were purchased in a silk worm cocoon from Iran-Mazandaran area and then were cut into small pieces. To separate Srysyn gum, the small pieces of silk worm cocoon were boiled in the sodium carbonate solution (0/5% w/w) for 30 min two times. The resulting
fibers were rinsed with distilled water. The obtained silk fibroin was dried at room temperature and then dissolved in a solution containing calcium chloride/ethanol/water (molar ratio of 8/2/1) for 4 h at 60 °C. The resulting solution was purified using filtration process and dialyzed using a cellulose dialysis bag (12000) for 3 days at room temperature in the deionized water solution. The obtained solution as the diluted pure fibroin solution was dried at room temperature in a petri dish and the resulting film was converted to a powder. For preparation of fibroin nan-oparticles, the physical method of ball mill grinding was applied for 12 h. The obtained FT-IR spectra of the resulting fibroin nanoparticles indicated a good agreement with other reported FT-IR of fibroin nanoparticles.51
2. 3. Preparation of MCH/ssDNA/SF/GO/ GCE Biosensor
The fabrication processes of ssDNA/SF/GO/GCE biosensor include the steps as follows: at first, non-modified glassy carbon electrode (GCE) was polished by 0.05 ^m alumina slurry to a mirror-like appearance, and then the mirror GCE was washed with anhydrous alcohol and water by ultrasonication for 30 min, respectively. At the second step, 20 ^L of homogeneously dispersed solution of SF/GO (0.015/0.035 g/mL) nano composite was placed on the working electrode surface and dryed under ambient conditions and this electrode was named SF/GO/GCE electrode. At the third step, gold nanoparticles (1.5 mmol L-1) were deposited electrochemically on the surface of SF/ GO/GCE electrode to prepare AuNPs/SF/GO/GCE (the applied experimental conditions: the potential range and the number of scans were -0.2 V to +0.9 V and 40, respectively). Fourth step contained dropping 20 ^L of the DNA probe solution (1 ^mol L-1) at the surface of AuNPs/SF/ GO/GCE for 12 h in a wet chamber to prepare ssDNA/ AuNPs/SF/GO/GCE electrode. At the last step, the prepared electrode was immersed in a MCH (1 mol L-1) solu-
tion as a blocker of surface to fill the bare areas of the ssD-NA/AuNPs/SF/GO/GCE surface which have not been covered by DNA strands and remove nonspecific adsorption of DNA (MCH/ssDNA/AuNPs/SF/GO/GCE). After each step the electrode was rinsed with a buffer and the modification steps were followed by using EIS and CV techniques.
2. 4. The Solutions Preparation Procedure
The probe and complementary solutions provided from the Gen Bank database were dissolved in water and were kept frozen at -20 °C to form stock solution of primers (18.5 ^mol L-1). For preparation of solutions, deionized water (DI: 18 MO cm resistivity) was used. The solutions of DNA probe (1 ^mol L-1) and various concentration of complementary (1.0 x 10-16 mol L-1 to 1.0 x 10-8 mol L-1) were prepared by sequential dilution of the stock solution of primers. Also, for preparation of SF/GO suspension, GO and SF (0.035 g, 0.015 g, respectively) was weighed and diluted with 1 mL of distilled water. Then, this suspension was sonicated for 1 h to prepare the solution of SF/ GOI which was placed on the electrode surface. The probe DNA immobilization and hybridization were monitored in a solution containing [Fe(CN)6]3-/4- (1:1) (1.0 mmol L-1) and KCl (0.1 mol L-1 ) mixture as the redox active probe (Scheme 1).
3. Results and Discussion 3. 1. Characterization of the Fabricated Biosensor
As shown in Fig. 1, the surface morphology of bare glassy carbon electrode (A), the modified glassy carbon with graphene oxide nanosheets (B), the silk nanofibers (C), nano composite of graphene oxide - silk fibroin (D),
Scheme 1. The schematic diagram of the fabrication of MCH/ssDNA/AuNPs/SF/GO/GCE biosensor
the nano composite of graphene oxide - silk fibroin and nanoparticle AuNPs (E) was examined by scanning electron microscopy (SEM) technique. According to Fig. 1A, the bare glassy carbon electrode has a smooth surface area. Fig. 1B indicates the petal-like structure of graphene oxide nanosheets with a large surface area.52 Fig. 1C shows the SEM of silk nanofibers compared with smooth surface of bare glassy carbon electrode.53 Fig. 1D, shows the SEM of the modified glassy carbon electrode with nanosheets of
graphene oxide - silk nanofibers which can provide a suitable platform for DNA sensing by increasing the electrode surface area. As shown in Fig 1E, the SEM of the modified glassy carbon electrode with nanosheets of graphene oxide - silk nanofibers and gold nanoparticles (AuNPs) can provide a suitable platform for sensing of thiolated DNA strands via the formation of Au-S bond.
For characterization of the used compounds for modification of the electrode surface the FT-IR spectros-
26 KV 20.0 KX Ivn KYKYOT SNffiSi I M 4MKX 1 um KWÛI800 SS &S95
1 rlpiif TEu l+M		
ÎÎKV 40.QIÛ! 1 um KÏXYOT SWÏÏ4	SKV 4SLSKX turn KÏKÏ-EWM SIMM |	SUV M In KWJOT tt«H
Figure 1. The SEM images of A) bare GCE, B) GO/GCE, C) SF/GCE, D) SF/GO/GCE and E) AuNPs/SF/GO/GCE electrodes
Figure 2. FT-IR spectrum of A) GO, B) SF, C) SF/GO composite and D) AuNPs/SF/GO.
copy technique was used. The FT-IR spectrum of graphene oxide reveals a C-O stretch at 1222 cm-1, an O-H stretch at 3500-3300 cm-1, and a C=O stretch at 1720-1690 cm-1 54 (Fig. 2A). Also, the FT-IR spectrum of silk nanofibers shows a hydrogen bond at 3300 cm-1, a C-N stretch at 1444 cm-1, C=O stretch at 1640-1620 cm-1, a C-N stretch at 1230 cm-1 (Fig. 2B). The FT-IR spectrum of SF/GO composite indicates the related peaks of both graphene oxide and silk fibroin in the SF/GO composite (Fig. 2C). After electro-deposition of gold nanoparticles on the SF/GO surface, a NH peak which is shifted to low energy is ob-
served in the SF/GO/AuNPs spectrum and this can be related to the interaction between the AuNPs and composite of SF/GO (see Fig. 2D). These observations denote that the modification of electrode surface was performed well.
Also, the modification processes of electrode were monitored with electrochemical techniques (cyclic voltammetry (CV) and impedance (EIS)). Fig. 3 indicates the obtained cyclic voltammograms of different electrodes in a solution containing [Fe(CN)6]3-/4- (1.0 mol L-1) at a scan rate of 100 mV/s. According to this figure, after introduction of SF/GO composite at the surface of bare glassy
Figure 3. Cyclic voltammograms obtained for a 1.0 mmol L 1 [Fe(CN)6]3 /4 and 0.1 mol L 1 KCl solution at the surfaces of (a) bare GCE, (b) SF/ GO/GCE, (c) AuNPs/SF/GO/GCE, (d) ssDNA/ AuNPs/SF/GO/GCE, (e) MCH/ssDNA/AuNPs/SF/GO/GCE (CV condition: scan rate 50 mV s-1).
Figure 4. Electrochemical impedance spectroscopy (EIS) signals obtained for a 1.0 mmol L 1 [Fe(CN)6]3 /4 and 0.1 mol L 1 KCl solution at the surfaces of (a) bare GCE, (b) GO/SF/GCE, (c) AuNPs/GO/SF/GCE, (d) ssDNA/ AuNPs/GO/SF/GCE, (e) MCH/ssDNA/AuNPs/GO/SF/GCE (EIS conditions: initial ac potential 0.20 V with an AC amplitude of 5 mV and frequency range 10 kHz to 0.1 Hz).
carbon electrode, the peak current (ip) of SF/GO/GCE electrode is decreased compared with the CV response of the bare GCE (curves a and b). This observation can be related to the insulation of the SF layer.55 By electrodeposi-tion of gold nanoparticles on SF/GO/GCE surface, the peak current value is increased due to high conductivity of gold nanoparticles (curves b and c). It is noticeable that the existence of the gold nanoparticles at the modified electrode surface leads to more attachment of ss-DNA strands at the electrode surface (curve c). By immobilization of probe at the surface of the AuNPs/SF/GO/GCE, the peak current is decreased due to the repellence of [Fe(CN)6]3-/4-by the negatively charged phosphate backbone of probe DNA and also the saturation of the electrode surface by probe DNA to prevent [Fe(CN)6]3-/4- ions from reaching the electrode surface (curve c and d). After blocking the electrode surface by MCH (1.0 mmol L-1) as a blocker surface at the ss-DNA/AuNPs/SF/GO/GCE, the peak current is decreased (curve e).
In addition, the fabrication process of MCH/ssDNA/ AuNPs/SF/GO/GCE was followed with EIS method (Fig. 4). The modification of the bare glassy carbon electrode surface with SF/GO composite causes an increase of the semicircle diameter (Rct) compared to bare GCE (curves a, b). After electrodeposition of gold nanoparticles on the modified electrode surface with SF/GO composite, the val-
ue of Rct is decreased due to the high conductivity of gold nanoparticles (curves b and c). By immobilization of the ss-DNA probe at the AuNPs/SF/GO/GCE surface, Rct value is increased (curve d). Finally, using MCH solution as a blocker agent of electrode surface (ssDNA/AuNPs/SF/ GO/GCE) leads to an increase in the value of Rct (curve e). These results reveal that the fabrication process of MCH/ ssDNA/AuNPs/SF/GO/GCE biosensor is performed well.
3. 2. Optimization of Experimental Conditions
3. 2. 1. Optimization of the Percentages of GO
in the SF/GO Composite, Immobilization Time of Probe DNA and MCH Incubation Time
For increasing the sensitivity of the designed electrochemical sensor (ssDNA/SF/GO/GCE), some experimental parameters such as the percentages of GO in the SF/GO composite was optimized. The influence of the GO percentage in SF/GO composite was examined in the range of 30 to 90% w/w. The results revealed that the ARct values are increased by increasing the percentages of GO in the composite up to 70% w/w and after that, by increasing the percentages of GO the ARct values are nearly constant. So, the
Optimization of (JO in SF/GO
Time of immobilized ssDNA
CÎ
50	80
SF-GO (%w/w)
3500
2500
1500
Time of Mi M
Ci
9000
7000
5000
t / min
Figure 5. Optimization of operating conditions in a solution containing 0.5 mmol L-1 [Fe(CN)6]3-/4- and 0.1 mol L-1 KCl (the number of independent experiments n = 3): (A) the percentages of GO in the composite of SF/GO, (B) the effect of immobilization time of ssDNA (1.0 x 10-6 mol L-1), (C) the effect of MCH incubation time.
GO percentage of 70% w/w was chosen as the optimum percentage value of GO in the SF/GO composite (see Fig. 5A).
For investigation of immobilization time of probe DNA, 20 ^L of the probe DNA solution (1 x 10-6 mol L-1) was introduced at the electrode surface from 5 min to 2 h. According to Fig. 5B, it is observed that by increasing time, ARct values are increased until 1 h and then, ARct values remain constant. So, an immobilization time of 1 h was selected as an optimum immobilization time of probe DNA for further experiments (Fig. 5B). Also, for enhancement of selectivity and sensitivity of the proposed DNA biosensor, the MCH incubation time was investigated. As mentioned before, MCH incubation has an important role to remove the nonspecifically adsorbed probe molecules from the electrode surface. So, ssDNA/AuNPs/SF/GO/ GCE electrode was immersed in a solution of MCH (1 mol L-1) for a specific time. MCH can bind to the electrode surface and consequently prevents the absorption of complementary DNA sequences to the electrode surface. After incubation of the fabricated sensor in a solution containing MCH (1 mol L-1), the ARct values are increased until 20 min and then the AR^ values are constant (Fig. 5C). Based on these observations, the optimum time of 20 min was selected for the incubation of MCH.
3. 2. 2. Optimization of Time and Temperature of Hybridization
Other parameters which were optimized in this research are the effects of time and temperature of hybridization. The effect of hybridization time was investigated over the range of 5 min to 60 min while temperature and ssD-NA concentration were kept constant at 25 °C and 1.0 x 10-16 mol L-1, respectively. According to obtained results in Fig. 6A, 40 min was selected as the optimum hybridization time for further experiments.
Also, due to the importance of the temperature of hybridization for hybridization reaction, the temperature of hybridization was optimized. Hybridization temperature was changed from 25 to 65 °C while keeping hybridization time and complementary concentration constant at 50 min and 1.0 x 10-16 mol L-1, respectively. As shown in Fig. 6B, the AR ct values are constant up to 35 °C and then rapidly decrease by increasing the temperature due to replacement of some molecules from the electrode surface. Thus, the temperature of 25 °C was selected as the optimum hybridization temperature.
3. 3. Investigation of Sensitivity of MCH/ ssDNA/AuNPs/SF/GO/GCE Biosensor
The sensitivity of MCH/ssDNA/AuNPs/SF/GO/ GCE biosensor was investigated by electrochemical impedance spectroscopy (EIS) technique. Fig. 7 reveals the impedance signals of the fabricated biosensor versus various concentrations of complementary target DNA sequences. Inset (A) of Fig. 7 reveals that the ARct values versus various target concentrations have a linear relationship in the range from 1.0 x 10-16 mol L-1 to 1.0 x 10-8 mol L-1 with a regression equation of ARct = 698.6 logC (mol L-1) + 18480 (R = 0.9914). The detection limit based on 3sbl (where the sbl was the standard deviation of 10 replicate measurements of MCH/ssDNA/AuNPs/SF/GO/GCE in [Fe(CN)63-/4-] solution) was calculated to be 3.3 x 10-17 mol L-1. Inset (B) of this figure indicates the used Randles equivalent circuit in this study while Rs is the electrolyte (1.0 mmol L-1 [Fe(CN)6]3-/4- and 0.1 mol L-1 KCl) resistance, CPE is constant phase element, W01 is Warburg impedance resulting from the diffusion of ions and Rct is the electron transfer resistance. Due to the significant influence of electron transfer process between [Fe(CN)6]3-/4-and electrode surface during the modification and hybridization processes, the Rct values are used. The obtained
Time of hvbridization
10000
sooo

6000
30
60
Tem [»l'attire of hybridization
<
9000
SOOO
7000
20
■1?
70
I / min
T/°C
Figure 6. Optimization of operating conditions in a solution containing [Fe(CN)6]3-/4- (0.5 mmol L-1) and KCl (0.1 mol L-1) and the number of independent experiments is 3 (n=3): (A) the influence of target DNA (1x10 -12 mol L-1) interaction time and (B) the effect of hybridization temperature.
results reveal that using the nano composite of GO and SF in the structure of MCH/ssDNA/AuNPs/SF/GO/GCE biosensor leads to increasing the sensitivity of the designed biosensor due to the unique properties of GO such as possessing lots of carboxylic acid groups, increasing the surface area, good biocompatibility and electron mobility at room temperature56 and also some specific properties of SF like tensile strength and elasticity, good thermal stability, hygroscopicity, microbial resistance and biocompatibil-ity.57 Also, Table 1 reveals the comparison of some charac-
teristics of ssDNA/SF/GO/GCE biosensor with some other reported electrodes.58-62 According to Table 1, the obtained detection limit and linear range in this work are better than in other works. It is noticeable that the ssDNA/ SF/GO/GCE biosensor has a good sensitivity for detection of BRCA 1 sequences but it has some disadvantages like: (i) EIS is used for DNA detection which is so sensitive towards the electrode surface changes but its selectivity is lower than in some other electrochemical techniques such as differential pulse voltammetry; (ii) the proposed meth-
Figure 7. The obtained EIS signals for various concentrations of complementary DNA. Inset A: the applied Randles equivalent circuit, Inset B: the dependence of ARC( versus the logC of target (DNA).
Table 1. Comparison of analytical performances of the MCH/ssDNA/AuNPs/SF/GO/GCE biosensor with several reported electrochemical DNA sensors for detection of breast cancer.
Electrode	Detection	Linear range	Detection limit	Ref.
	technique	(mol L-1)	(mol L-1)	
MWCNTs/GCE	DPV	0.1 x 10-9 - 1000 x 10-9	5.0 x 10-11	[58]
GCE	DPV	2 x 10-10 - 5 x 10-8	1.0 x 10-10	[59]
DNA/PICA/GCE	EIS	1 x 10-9 - 2 x 10-8	5 x 10-10	[60]
Polypyrrole/DNA/MWCNT	CV	3.3 x10-9 - 1.06 x 10-8	1.0 x 10-9	[61]
PPy/DNA/CNT/GCE	DPV	1.0 x 10-10 - 1.0 x 10-8	8.5 x 10-11	[62]
MCH/ssDNA/AuNPs/SF/GO/GCE	EIS	1.0 x10-16 - 1.0 x 10-8	3.3 x 10-17	This work
od is quite time consuming; and (iii) it was not applied to a real sample although we believe that the fabricated biosensor has a good potential for detection of breast cancer in the near future.
3. 4. The Selectivity Investigation of the Fabricated Biosensor
As known, the selectivity is explained as the recognition of differences between the target DNA sequences from others. For investigation of the selectivity of the ssDNA/SF/ GO/GCE biosensor, the fabricated biosensor was hybridized with complementary P1C and different non-complementary sequences of P1nC1, P1nC2 and P1nC3. The obtained results are shown in Fig. 8. According to this figure, ssDNA/SF/GO/GCE biosensor reveals different EIS signals after hybridization with 1.0 x 10-13 mol L-1 of complementary P1C (6400 kO) and 1.0 x 10-13 mol L-1 of various non-complementary DNA sequences P1nC1, P1nC2 and P1nC3 (690, 600 and 580 kO, respectively). These observations indicate that the fabricated biosensor has a high selectivity and also it can be suggested that the designed biosensor will be applied in the future for real samples.
sooo -
PlnCl	PlnC2	J>lnC3
Scqucnces
Figure 8. The specificity test using the MCH/ssDNA/AuNPs/SF/ GO/GCE biosensor responses to different targets of complementary (P1C) and non-complementary (P1nC1, P1nC2 and P1nC3) sequences.
3. 5. Reproducibility and Stability of the MCH/ssDNA/AuNPs/SF/GO/GCE Biosensor
The reproducibility and stability of MCH/ssDNA/ AuNPs/SF/GO/GCE biosensor were examined. For reproducibility investigation of the designed biosensor, three ssDNA/SF/GO/GCE electrodes were fabricated and then hybridized with target DNA (1.0 x 10-13 mol L-1). It is noticeable that independent DNA sensors were prepared in the similar conditions like suspension concentration of SF/ GO composite, ssDNA immobilization and hybridization
of complementary sequences. The obtained results revealed a relative standard deviation (RSD) of 7.5% (n = 4) for AR where AR = Rfinal - Rinitial, and Rfinal is EIS response after hybridization and Rinitial is EIS signal before hybridization. Thus, the obtained results reveal a satisfactory re-producibility of this electrochemical biosensor. The stability of the MCH/ssDNA/AuNPs/SF/GO/GCE biosensor was also investigated during 8 days. The proposed biosensor was stored in a 0.1 mol L-1 phosphate buffer solution (pH 7.4) in the refrigerator at 4 °C and after 8 days the response of the ssDNA/SF/GO/GCE biosensor retained about 92% of its initial response. These observations prove the high stability of the fabricated DNA sensor.
4. Conclusions
In this paper, a DNA electrochemical biosensor based on graphene oxide nanosheets - silk fibroin composite as probe oligonucleotide immobilization platform was designed for breast cancer sequences detection. The modification processes of electrode were followed by scanning electron microscopy (SEM), FT-IR and electrochemical techniques of cyclic voltammetry (CV) and impedance (EIS). Some experimental parameters of the designed biosensor like the percentages of GO in the SF/GO composite, immobilization time of probe DNA and MCH incubation time, time and temperature of hybridization processes were optimized. Under optimum conditions, this electrochemical biosensor revealed a suitable dynamic range (1.0 x 10-16 mol L-1 to 1.0 x 10-8 mol L-1) and a low detection limit (3.3 x 10-17 mol L-1) for target DNA by EIS technique. The obtained results revealed high sensitivity of the fabricated biosensor. This method was successful in detection of BRCA 1 sequences containing complementary P1C sequences and various non-complementary sequences of P1nC1, P1nC2 and P1nC3. Briefly, this designed biosensor possesses some advantages such as suitable selectivity and sensitivity, high reproducibility and being not expensive. This biosensor like other designed sensors has some disadvantages such as being quite time consuming and was not applied to real samples. We hope that our explorations may present a basis for further advancement in modified electrochemical DNA biosensors applyed to various science fields.
5. Acknowledgements
We gratefully acknowledge the support of this work by Yazd University research council.
6. References
1.	R. Sager, Cancer Res. 1986, 46, 1573-1580.
2.	J. H. Ray and J. German, Chromosome mutation and neoplasia, 1983, 135-167.
3.	J. D. Rowley, Chromosomes and cancer: from molecules to man, Academic Pr, 1983.
4.	A. Benvidi, N. Rajabzadeh, M. Mazloum-Ardakani, M. M. Heidari and A. Mulchandani, Biosens. Bioelectron. 2014, 58, 145-152. D01:10.1016/j.bios.2014.01.053
5.	S. Maheswaran, L. V. Sequist, S. Nagrath, L. Ulkus, B. Branni-gan, C. V. Collura, E. Inserra, S. Diederichs, A. J. Iafrate and D. W. Bell, N Engl. J. Med. 2008, 359, 366-377. D0I:10.1056/NEJMoa0800668
6.	Y.-T. Long, C.-Z. Li, T. C. Sutherland, H.-B. Kraatz and J. S. Lee, Anal. chem. 2004, 76, 4059-4065. D0I:10.1021/ac049482d
7.	F. J. Steemers, J. A. Ferguson and D. R. Walt, Nat. Biotechnol. 2000, 18, 91-94. DOI: 10.1038/72006
8.	M. Duman, R. Saber and E. Pipkin, Biosens. Bioelectron. 2003, 18, 1355-1363. D0I:10.1016/S0956-5663(03)00087-3
9.	J. Wang and A. J. Bard, Anal. chem. 2001, 73, 2207-2212. D0I:10.1021/ac001344a
10.	L. A. Thompson, J. Kowalik, M. Josowicz and J. Janata, J. Am. Chem. Soc. 2003, 125, 324-325. D0I:10.1021/ja027929z
11.	H. Korri-Youssoufi and A. Yassar, Biomacromolecules, 2001, 2, 58-64. D0I:10.1021/bm0000440
12.	J. Wang, Chem. Eur. J. 1999, 5, 1681-1685. D0I:10.1002/(SICI)1521-3765(19990604)5:6<1681::AID-CHEM1681>3.0.C0;2-U
13.	K. Kerman, M. Kobayashi and E. Tamiya, Meas. Sci. Technol. 2003, 15, R1. D0I:10.1088/0957-0233/15/2/R01
14.	A. Benvidi, M. D. Tezerjani, A. D. Firouzabadi, M. Ma-zloum-Ardakani and S. M. Moshtaghioun, JICS. 2016, 13, 2135-2142. D0I:10.1007/s13738-016-0931-x
15.	H. Karimi-Maleh, F. Tahernejad-Javazmi, N. Atar, M. L. t. Yola, V. K. Gupta and A. A. Ensafi, Ind. Eng. Chem. Res. 2015, 54, 3634-3639. D0I:10.1021/ie504438z
16.	C. Tlili, H. Korri-Youssoufi, L. Ponsonnet, C. Martelet and N. J. Jaffrezic-Renault, Talanta 2005, 68, 131-137. D0I:10.1016/j.talanta.2005.04.069
17.	S. Cheraghi, M. A. Taher, H. Karimi-Maleh, E. Faghih-Mirzaei, New J. Chem. 2017, 41, 4985-4989.
D01:10.1039/C7NJ00609H
18.	A. Benvidi, M. D. Tezerjani, S. M. Moshtaghiun and M. Ma-zloum-Ardakani, Microchim. Acta 2016, 183, 1797-1804. D0I:10.1007/s00604-016-1810-y
19.	N. Zhu, Z. Chang, P. He and Y. Fang, Electrochim. Acta 2006, 51, 3758-3762. D0I:10.1016/j.electacta.2005.10.038
20.	Z. Liu, B. Zhao, Y. Shi, C. Guo, H. Yang and Z. Li, Talanta 2010, 81, 1650-1654. D0I:10.1016/j.talanta.2010.03.019
21.	M. O'hare and E. Nice, J. Chromatogr. A 1979, 171, 209-226. D0I:10.1016/S0021-9673(01)95300-2
22.	R. Vaidyanathan, S. Dey, L. G. Carrascosa, M. J. Shiddiky, M. Trau, Biomicrofluidics, 2015, 9, 061501.
D01:10.1063/1.4936300
23.	Y.-T. Cheng, C.-C. Pun, C.-Y. Tsai and P.-H. Chen, Sens. Actuators, B 2005, 109, 249-255. D0I:10.1016/j.snb.2004.12.072
24.	K. S. Novoselov, A. K. Geim, S. V. Morozov, D. Jiang, Y. Zhang, S. V. Dubonos, I. V. Grigorieva and A. A. Firsov, science 2004, 306, 666-669.
25.	D. C. Marcano, D. V. Kosynkin, J. M. Berlin, A. Sinitskii, Z. Sun, A. Slesarev, L. B. Alemany, W. Lu and J. M. Tour, ACS nano, 2010, 4, 4806-4814. D01:10.1021/nn1006368
26.	J. Lee, Y.-K. Kim and D.-H. Min, Anal. chem. 2011, 83, 89068912. D0I:10.1021/ac201298r
27.	Y. Yang, X. Chen, F. Ding, P. Zhang, J. Liu and X. Gu, Biomaterials, 2007, 28, 1643-1652.
DOI: 10.1016/j.biomaterials.2006.12.004
28.	L. Soffer, X. Wang, X. Zhang, J. Kluge, L. Dorfmann, D. L. Kaplan and G. Leisk, J. Biomater. Sci., Polym. Ed. 2008, 19, 653-664. D0I:10.1163/156856208784089607
29.	M. K. Hota, M. K. Bera, B. Kundu, S. C. Kundu, C. K. Maiti, Adv. Funct. Mater. 2012, 22, 4493-4499. D0I:10.1002/adfm.201200073
30.	S. Aznar-Cervantes, M. I. Roca, J. G. Martinez, L. Mesegu-er-Olmo, J. L. Cenis, J. M. Moraleda and T. F. Otero, Bioelec-trochemistry, 2012, 85, 36-43. D0I:10.1016/j.bioelechem.2011.11.008
31.	S. Aznar-Cervantes, J. G. Martinez, A. Bernabeu-Esclapez, A. A. Lozano-Perez, L. Meseguer-Olmo, T. F. Otero and J. L. Cenis, Bioelectrochemistry, 2016, 108, 36-45. D0I:10.1016/j.bioelechem.2015.12.003
32.	K. Hu, M. K. Gupta, D. D. Kulkarni and V. V. Tsukruk, Adv. Mater 2013, 25, 2301-2307. D0I:10.1002/adma.201300179
33.	S. Ling, C. Li, J. Adamcik, S. Wang, Z. Shao, X. Chen and R. Mezzenga, ACS Macro Letters, 2014, 3, 146-152. D0I:10.1021/mz400639y
34.	H. Karimi-Maleh, M. Hatami, R. Moradi, M. A. Khalilzadeh, S. Amiri, H. Sadeghifar, Microchim. Acta 2016, 183, 29572964. D0I:10.1007/s00604-016-1946-9
35.	H. Karimi-Maleh, A. F. Shojaei, K. Tabatabaeian, F. Karimi, Sh. Shakeri, R. Moradi, Biosens. Bioelectron. 2016, 86, 879884. D0I:10.1016/j.bios.2016.07.086
36.	H. Karimi-Maleh, F. Amini, A. Akbari, M. Shojaei, J. Colloid Interf. Sci. 2017, 495, 61-67. D0I:10.1016/j.jcis.2017.01.119
37.	S. Cheraghi, M. A. Taher, H. Karimi-Maleh. J. Food Compost. Anal. J. 2017, 62, 254-259. D0I:10.1016/j.jfca.2017.06.006
38.	S. Cheraghi, M. A. Taher, H. Karimi-Maleh. Appl. Ssrf. Sci. 2017, 420, 882-885. D0I:10.1016/j.apsusc.2017.05.218
39.	M. Shabani-Nooshabadi, M. Roostaee, H. Karimi-Maleh. J. Iran. Chem. Soc. 2017, 14, 955-961. D0I:10.1007/s13738-016-1045-1
40.	S. M. Ghoreishi, M. Behpour, S. Sadeghzadeh and M. Goles-taneh, Acta Chim. Slov. 2011, 58, 69-74.
41.	B. Bozzini, P. Bocchetta, A. Gianoncelli, C. Mele and M. Kiskinova, Acta Chim. Slov. 2014, 61, 263-271.
42.	B. Mahltig, H. Haufe, K. Muschter, A. Fischer, Y. H. Kim, E. Gutmann, M. Reibold, D. C. Meyer, T. Textor and C. W. Kim, Acta Chim. Slov. 2010, 57, 451-457.
43.	M. Kaushik, S. Mahendru, M. Kumar, S. Chaudhary and S. Kukreti, Advanced Techniques in Biology & Medicine, 2016, 1-6.
44.	J. Liu, Z. Cao and Y. Lu, Chem. Rev. 2009, 109, 1948-1998. D0I:10.1021/cr030183i
45.	J. N. Wilson, Y. N. Teo and E. T. Kool, J. Am. Chem. Soc. 2007, 129, 15426-15427. DOI:10.1021/ja075968a
46.	J.-Y. Park and S.-M. Park, Sensors, 2009, 9, 9513-9532. DOI:10.3390/s91209513
47.	D. R. Baselt, G. U. Lee, M. Natesan, S. W. Metzger, P. E. Shee-han, R. J. Colton, Biosens. Bioelectron. 1998, 13, 731-739. DOI:10.1016/S0956-5663(98)00037-2
48.	S.-y. Niu, Q.-y. Li, R. Ren and S.-s. Zhang, Biosens. Bioelectron. 2009, 24, 2943-2946. DOI:10.1016/j.bios.2009.02.022
49.	A. Benvidi, N. Rajabzadeh, M. Mazloum-Ardakani and M. M. Heidari, Sens. Actuators, B 2015, 207, 673-682. DOI:10.1016/j.snb.2014.10.043
50.	M. D. Tezerjani, A. Benvidi, M. Rezaeinasab, S. Jahanbani, S. M. Moshtaghioun, M. Youssefi and K. Zarrini, Anal. Methods, 2016, 8, 7507-7515. DOI:10.1039/C6AY01524G
51.	C. Zhao, J. Yao, H. Masuda, R. Kishore and T. Asakura, Biopolymers, 2003, 69, 253-259. DOI:10.1002/bip.10350
52.	R. Jain, A. Sinha and A. L. Khan, Mater. Sci. Eng., C 2016, 65, 205-214. DOI:10.1016/j.msec.2016.03.115
53.	B. Kundu, R. Rajkhowa, S. C. Kundu and X. Wang, Adv. Drug Deliv. Rev. 2013, 65, 457-470. DOI:10.1016/j.addr.2012.09.043
54.	J. R. Lomeda, C. D. Doyle, D. V. Kosynkin, W.-F. Hwang and J. M. Tour, J. Am. Chem. Soc. 2008, 130, 16201-16206. DOI: 10.1021/ja806499w
55.	H. Yin, Y. Zhou, J. Xu, S. Ai, L. Cui and L. Zhu, Anal. Chim. Acta 2010, 659, 144-150. DOI:10.1016/j.aca.2009.11.051
56.	A. Benvidi, A. D. Firouzabadi, S. M. Moshtaghiun, M. Ma-zloum-Ardakani and M. D. Tezerjani, Anal. Biochem. 2015, 484, 24-30. DOI:10.1016/j.ab.2015.05.009
57.	Y.-Q. Zhang, Biotechnol. Adv. 1998, 16, 961-971. DOI:10.1016/S0734-9750(98)00012-3
58.	Y. Xu, Y. Jiang, H. Cai, P.-G. He and Y.-Z. Fang, Anal. Chim. Acta, 2004, 516, 19-27. DOI:10.1016/j.aca.2004.04.013
59.	H. Cai, X. Cao, Y. Jiang, P. He and Y. Fang, Anal. Bioanal. Chem. 2003, 375, 287-293. DOI:10.1007/s00216-002-1652-9
60.	X. Xu, X. Weng, A. Liu, Q. Lin, C. Wang, W. Chen and X. Lin, Anal. Bioanal. Chem., 2013, 405, 3097-3103. DOI:10.1007/s00216-013-6715-6
61.	X. Li, J. Xia and S. Zhang, Ana. chim. acta, 2008, 622, 104110.
62.	H. Qi, X. Li, P. Chen and C. Zhang, Talanta 2007, 72, 10301035. DOI:10.1016/j.talanta.2006.12.032
Povzetek
V tej študiji smo razvili preprost nov elektrokemični biosenzor za detekcijo DNA sekvenc, osnovan na steklasti ogljikovi elektrodi (GCE), modificirani s kompozitom iz grafenovega oksida (GO) in nanovlaken svilenega fibroina (SF) ter z zlatimi nanodelci (MCH/ssDNA/AuNPs/SF/GO/GCE). Procese izdelave elektrokemičnega biosenzorja smo spremljali z vrstično elektronsko mikroskopijo (SEM), FT-IR in z elektrokemičnimi metodami. Optimizirali smo nekatere eksperimentalne pogoje, kot so: čas imobilizacije DNA in čas inkubacije z MCH, čas in temperatura hibridizacije. Pripravljeni biosenzor je izkazal široko linearno območje od 1,0 x 10-16 do 1,0 x 10-8 mol L-1 ter nizko mejo zaznave (3,3 x 10-17 mol L-1) za detekcijo mutacije BRCA1 5382 s tehniko EIS. Izkazal je tudi visoko selektivnost za ločevanje med komplementarnimi (P1C) sekvencami in različnimi nekomplementarnimi sekvencami (P1nC1, P1nC2 in P1nC3). Biosenzor je imel tudi visoko obnovljivost (RSD 7,5% (n = 4)) in visoko stabilnost (92% začetnega odziva po 8 dnevih). Pripravljeni biosenzor ima torej ustrezen potencial za uporabo pri odkrivanju sekvenc raka na dojki v začetnih stopnjah.
DOI: 10.17344/acsi.2017.3698
Acta Chim. Slov. 2018, 65, 289-295
Scientific paper
Interaction of HF, HBr, HCl and HI Molecules with Carbon Nanotubes
Wiem Felah Gtari1 and Bahoueddine Tangour1,*
1 Université de Tunis El Manar, Research Unit of Modeling in Fundamental Sciences and Didactics, Team of Theoretical Chemistry and Reactivity, BP 244, 2092, El Manar 2, Tunisia
* Corresponding author: E-mail: bahoueddine.tangour@ipeiem.utm.tn Tel: +216 98 817468
Received: 13-07-2017
Abstract
The present work applies the density functional theory (DFT) to study the interactions between armchair (n,n) single walled carbon nanotubes (SWCNTs) and hydrogen halides confined along the nanotube axis and perpendicular to it. Calculations are performed using the CAM-B3LYP functional. According to the hydrogen halides orientation and the internal diameter of CNTs hollow space, HF, HCl, HBr and HI behave differently. The nanoconfinement alters the charge distribution and the dipolar moment. The encapsulated hydrogen fluoride (HF) molecule is stable along and perpendicular to the nanotubes (5,5) and (6,6) axis. The hydrogen chloride (HCl), hydrogen bromide (HBr) and hydrogen iodide (HI) form stable systems inside the nanotube (6,6) only at the perpendicular orientation. In addition, other phenomena are observed such as leaving the nanotube or decreasing the bond length of the molecule and even the creation of cova-lent bind between the guest molecule and the host nanotube.
Keywords: Carbon nanotubes; hydrogen halides storage; confinement energy; van der Waals interactions; Mulliken analysis population; DFT/CAM-B3LYP.
1. Introduction
Single walled carbon nanotubes (SWCNTs) attract researchers' interest since their discovery1 in industry and academy, thanks to their unique electrical and mechanical properties and their potential applications in several fields. The greatest advantage of this SWCNTs is their hollow space which could confine numerous molecules in order to storage them2-6 or to contain chemical reactions.7 They are used to remove heavy metals in wastewater treatment8 and in drug delivery.9-15 Carbon nanotubes are known to have a great surface of reactivity outside and inside them.
Doping of the exterior surface of a nanotube or the adsorption of atoms or molecules inside it offers the possibility to create exceptional materials with new properties. In particular, the confinement processes modifies the properties of the confined molecules in different ways.16-20 In previous studies, we investigated the local influence of CNT's walls on small molecules H221,22 and F2. 23 The former molecule H2 allowed us to study the effect of the confinement on the electron of the single bond H-H. Some differences have been detected on H2 behavior between its confinement in CNTs and their boron-nitrogen homo-
logues.22 The latter molecule F2, even apolar in nature, introduced the lone pair effect. This studies focus on the comprehension of the intermolecular interactions nature in endohedral complexes. Differences in behavior of each one of those molecules are CNT's diameter dependent and were rationalized invoking the relatives areas under atomic or van der Walls radii control. The purpose of this paper is to study the interaction between polar molecules that are hydrogen halides (hydrogen fluoride HF, hydrogen chloride HCl, hydrogen bromide HBr and hydrogen iodide HI) and the interior of carbon nanotubes of different diameters.
Hydrogen fluoride HF is toxic and strongly corrosive; it dissolves most minerals (oxides, silicates), metals and plastics. Fluoride ions F- penetrate into deep tissue and react highly with magnesium and calcium. However, HF is a potential fuel generator. It reacts in solution with alkali and light metals by releasing hydrogen (H2). Its storage inside carbon nanotubes would constitute, on the one hand, an adequate way to avoid its corrosion and its toxicity. On the other hand, it would represent an interesting way of controlling production of dihydrogen.
Another application concerns environmental area. Different techniques exist to uptake the excess fluoride
from wastewater. Among them, nanotube supported alumina could highlights a great potential to adsorb and remove fluoride from water. 24
Produced carbon nanotubes still contain impurities like amorphous carbon, and catalytic metal particles. Further physical and chemical applications of CNTs require their removal. Hydrochloric acid (HCl) solution is very often used to purify carbon nanotubes. This in-situ presence of HCl may allow insertion of this gas inside the nanotube generating a doping phenomenon. Such property generated considerable interest because of the possible use of CNTs as gas sensors. 25-27
The aim of this work is twofold. First, to extend and to deepen the knowledge of the encapsulation phenomena inside carbon nanotubes, by including an additional layer of difficulty which is the intervention of the permanent dipole moment. Second, to make a contribution to potential applications of HX acids confinement (X = F, Cl, Br and I).
Unfortunately, there is a lack of study focusing on the encapsulation of these molecules inside or outside carbon nanotubes. The encapsulation of HF dimer inside (n,n) CNTs is recently investigated by Roztoczynska and al. using the M06-2X exchange-correlation functional.28 This work was limited to using a series of energy scans to highlight the orientation influence of HF dimers with respect to carbon nanotubes. Liang and al. revealed the stability of HCl molecule inside the CNT (14,0)29 by studying the electronic and band structure for this complex. There is also few works related to the encapsulation of hydrogen halides inside fullerenes.30-32
2. Methodology
In the present paper, we carried out geometry optimizations for armchair (n,n) carbon nanotubes with n = 3,4, 5 and 6 with HF, HCl, HBr and HI molecules inside using the density functional theory. To gain insight into the interaction between these molecules and carbon nano-tubes, we perform quantum calculation using the new hybrid exchange-correlation function CAM-B3LYP presented by Yanai and al.33 and STO-3G basis set. STO-3G basis
set34 is a minimal basis set, but in term of calculating energy, it gives trusted results 21,23 without consuming a long calculation time. Carbon nanotubes were produced involving three unit cells with TubeGen 3.4 program.35
Terminal carbon atoms are hydrogenated to saturate their valence. The formulas of the considered (3,3), (4,4), (5,5) and (6,6) carbon nanotubes are : C36H12, C48H16, C60H20 and C72H24 respectively. The optimized diameters of the chosen nanotubes are varying from 5.49 A to 8.23 A. All electronic structure calculations were realized using Gaussian 09 suite of programs.36 Kohn -Sham density functional (DFT) is extensively used since its cheap cost and the possibility to employ it to explore several chemical, physical and biological systems. The coulomb attenuated method CAM-B3LYP is an improved version of the B3LYP functional by the inclusion of long range dispersion energy and it is appropriate to describe the noncova-lent interactions.33 This function gives a better description of the energy when the charge transfer is involved.
3. Results and Discussion
Former studies demonstrated that the orientation of a confined molecule affects notably the interaction between the guest molecule and the nanotube.22-23,37-40 For that reason, two orientations of hydrogen halides molecules were considered: parallel (//) and perpendicular (±) to the CNT's axis as shown in figure 1 and will be noted respectively HX(//)@CNT(n,n) and HX(±)@CNT(n,n).
The binding energy (Ebind) of the hydrogen halides and the nanotube is calculated as following: Ebind = E(HX@ CNT(n,n)) - E(H-CNT(n,n)) - E(HX)
Where E(HX@CNT(n,n)), E(H-CNT(n,n)), E(HX) indicate the energy of the inclusion complex, the hydroge-nated CNTs and the isolated HX molecules respectively. The calculated confinement energies were corrected to the basis set superposition error (BSSE).41,42 Figure 2 depicts the final situation of each introduced molecule versus CNT's diameter. Depending on the CNT'S diameter and the halogens radius, halogen halides exhibit different behavior as summered in table 1. To better explain each phenomenon, we will focus on each nanotube separately. First
a)
»

te ^
S
J
b) b)
<i -J
i
s
te qp
Figure 1. HX studied orientations inside SWNT a) parallel to the nanotube axis noted HX(//)@CNT(n,n) b) perpendicular to the nantotube axis noted HX(±)@CNT(n,n)
we discuss the wider nanotube (3,3) which diameter is 4.12 A. HF and HCl, placed in parallel position along the (3,3) nanotube axis, keep their orientation (Figure 2: a1 and b1). All values of the studied parameters are far from the parameters of the unconfined molecules. When they are placed perpendicular to the (3,3) nanotube axis, we notice a reorientation of these two molecules to the parallel position (Figure 2: a2 and b2). The obtained values of energies, bond lengths and dipolar moment are in the same range of the obtained values at parallel position (Table 2). Roztoczynska and al. obtained an energy up to +200 kcal mol-1 for HF dimer enclosed inside the nanotube (3,3).28 This result proves the importance of the repulsion forces inside the wider nanotubes in general, in presence of molecules with large radius. HBr and HI sited parallel and perpendicular to the CNT (3,3) axis react with its cage and establish covalent bonds with it (Figure 2: c1, d1, c2, d2). Those figures display the presence of covalent bonds made by the hydrogen atoms. We expected that this result does not have any chemical significance and shows the limits of the computational chemistry of such systems under constraint. In fact, the electronegativity induces a negative charge accumulation from the halogen atoms side, so we can estimate that they present a radius greater than the radius of the isolated atoms. Br and I atoms almost get into the area under the atomic radius of the carbon atoms and set up real chemical bonds with them (Figure3: 3a and 3e). However, the charge distribution is more destabilized inside the nanotube (3,3). Despite the fact that the mulliken electric charge is dependent of the method and basis set because it is a local observable, it gives an idea about the charges of each atom.
As seen in table 2, the charges observed on F, Cl and Br atoms are negative, the charges of H atoms are positive. However, in the case of HI molecule, mulliken gives a negative charge on H atom and positive charge on I atom. This result is due to the choice of the basis of calculation which should be more suitable for iodine atom. In the case of the encapsulation of
HBr and HI inside the CNT (3,3), H, Br and I atoms are linked to the carbons of the nanotube's cavity, that's why their atomic charges are different from the atomic
charges of unconfined HBr and HI molecules. Starting from the CNT (4,4), all the studied molecules introduced at the parallel position are kept inside the nanotubes (Fig-ure2: a3, b3 c3 and d3). As shown in table 2, HF molecule forms a stable system with the nanotubes (5,5) and (6,6) since the confinement energies values are negative or very week equal to -0.9276 kcal mol-1 and 0.0290 kcal mol-1 repectively. Theoretical studies which investigated the encapsulation of HF molecule inside the fullerene showed that this molecule forms a stable system. Shameema and al, for example reveal a stabilization energy equal to - 2.5 kcal mol-1 using the HF/6-31G method.31 The authors of this study explain that the encapsulation of polar guest molecules polarizes the cage in a way that the carbon atoms placed near the positively charged atoms of the guest species turn into negatively charged and those close to the negatively charged atoms become positively charged. Inside the wider nanotubes, the charge distribution has not a significant change in comparison with the unconfined molecules.
That is why there is a decrease in the net dipole moment of these systems. According to this study, the dipole moment of the free HF molecule is 2.3 Debye, and its dipole moment inside C60 is 0.54 Debye.31 As a general rule, when the diameter of the CNT increases, the confinement energy value is lower. Values of confinement energies inside the nanotube (6,6), are under 0.001 kcal mol-1 in all the studied cases showing the attenuation of the interaction between the guest species and the host cage. In fact, figures 3 a, b, c and d illustrate the interaction between the van der Waals radii of the carbon atoms and the guest molecules. When the nanotube diameter is bigger, the overlap between vdW radiis becomes lower, especially with the fluorure, chlorure and bromure atoms.
At the perpendicular position, only HF molecule (Figure 2a) remains inside the nanotube (4,4), HCl, HBr and HI guest molecules leave it (Figure 2b, 2c, 2d). Outside the nanotube, HCl molecule is re-oriented at the parallel position. Despite the negative energy equal to -3.5 kcal mol-1, the bond length is stretched to 1.3495 A, signifying that even outside the nanotube, HCl molecule is under the influence of van der Waals radii of terminal hydrogen at-
Table 1. Observed phenomena inside the studied nanotubes at parallel and perpendicular orientations
Orientation	Molecule	CNT (3,3)	CNT (4,4)	CNT (5,5)	CNT (6 ,6)
Parallel	HF HCl HBr HI	Destabilized binding Destabilized binding Covalent interaction Covalent interaction	Inside shortness of the bond lengh Destabilized binding Destabilized binding Destabilized binding	Stabilization Confinement Confinement Confinement	Stabilization Confinement Confinement Confinement
Perpendicular	HF HCl HBr HI	Re-orientaion Re-orientaion Covalent interaction Covalent interaction	Inside shortness of the bond length Leaving CNT Leaving CNT Leaving CNT	Stabilization Confinement Confinement Leaving CNT	Stabilization Stabilization Stabilization Confinement
CNT Pos HFgCNT al
//
(3,3)
it
(4,4)
if
(5.5)
(.6,6)
HClgCNT bl
b2
b3
M
VCv ........
iijl»»
0a
b6
b7
bS
HBrgCNT cl
HIgCNT dl
»
¿2
«
c3
d2
%v
d3
dj*
c4
CD
d4
b5	c:
G o
c6
o o
c7
o o
cS
o o
Figure 2. Interaction of HX molecules with the (3,3), (4,4), (5,5) and (6 ,6) CNT's at both parallel and perpendicular orientations
oms. Figure 3.e shows a significant overlap between the vdW radii of halogens and the carbon atoms of the wall of the CNT. As a result, those molecules are "chased" outside the CNT in order to decrease the electrostatic forces involved. HBr and HI molecules are also expelled outside the nanotube (4,4). Their bond lengths and dipolar moments values are higher than those of unconfined molecules (Ta-
ble 2). The charge distribution is highly affected. We notice that when the van der Walls radius of the halogen atom is greater than the radii of the nanotube, the molecule is expelled out of it. In fact, the halogen halide in this condition is trapped inside a repelled area. The same phenomena was observed for water which flow rate varies when the CNT diameter changes.43
a
tr
£
x
CO
a
O
a
Mh
a
>—i 00<N OO O OO OO
i-H (N m I-HO
p oop oo o oo oo
o Lno
o
pop o ooo o l I
OOO 1-H
VO 1—(VO vo vo ^ ^ ^ ^
vo ^ cK <n
<N i-H
\Q\Q \Q
I

£
Tf mmNinm ^
O OO
OO o
ooooooooo
^fofo^mrofo^^ p<Nppp<Nppp
ooooooooo l ill ill
^ l
t^^f Ln
O OO
X T3
1-HCS 00
l cKoo co
OfOfSfO
a
£
»
W
a
£
oomt^oooomoot^oo ooooooooo
00 00 00 00 00 00 00 00 00
ooooooooo I II lllll I
■^fOXH^fSH^O
^ooooocsoo
^fofororomm^'t romrommrofoforo
X
(NXfO(NfSOO(NfS(S <N<N<N<N<N<N<N<N<N
ooooooooo
fSi^fOfSCS'OfOfOfS
vo ^>-H<N oo <N<N^Ln<Nco^^ oooooooo
ooooooooo
O'-HfOfOOO'-HO^
l ^Lnoo^csoo ^o	| NO	II
5
6
a
x
Ln MD rO ^ Ln MD ^ Ln MD ro ^ Ln MD
Figure 3. Schematic overlap between atomic/ van der Waals radius of the CNT and the confined hydrogen halides at both parallel and perpendicular positions
By increasing the carbon nanotube's diameter, only HI molecule leaves the CNT (5,5) at the perpendicular orientation. HF placed perpendicular forms a stable complex with the nanotubes (5,5) and (6,6) with a stabilization energy equal to -0.4017 kcal mol-1 and -0.1864 kcal mol-1, respectively. HCl, HBr and HI molecules form a stable system with the CNT (6,6) as their obtained corrected energies are equal to -1.0119 kcal mol-1, -0.6142 kcal mol-1, -0.1715 kcal mol-1, respectively. In all those cases, the bond lengths of confined molecules reach the value of the molecules at the free state. The atomic charges attain also the same values of the unconfined molecules, with the exception of HI molecule for which the charge distribution is still highly dislocated. The dipolar moments, as men-
tioned above are under the values of the dipolar moments of the free molecules. There is an important overlap (figure 3g and 3h) betweeb van der Waals radiis of the hydrogen halides molecules and the carbon atoms: this overlap has a destabilisant and repulsive nature for the HI molecule and it has a stabilisant and attractive nature for HF, HCl and HBr molecules.
5. Conclusion
Theoretical calculations have been made to investigate the encapsulation of HF, HCl, HBr and HI molecules inside carbon nanotubes (3,3), (4,4), (5,5) and (6,6). Calculations are made using DFT/CAM-B3LYP functional with STO-3G basis sets. Dipolar moments of all confined molecules are affected. At the parallel and perpendicular directions, HF molecule forms a stable system with the nanotubes (5,5) and (6,6). HCl, HBr and HI molecules placed perpendicular, form a stable complex with the CNT (6,6). In all those cases, the bond lengths and the atomic charge of confined molecules reach the values obtained for the unconfined molecules.
6. References
1.	F. S. Ijima, Nature 1991, 354, 56-58. DOI:10.1038/354056a0
2.	E. Bichoutskaia, N.C. Pyper, J. Chem. Phys. 2008, 129, 154701(1)-15.
3.	M. Milko, C. Ambrosch-Draxel, Phys. Review B 2011, 84, 085437(1)-7.
4.	J. Xiao, X. Pan, F. Zhang, H. Li, X. Bao, Chem. Sci. 2016, 8(1):278-283. DOI:10.1039/C6SC02298G
5.	E. I. Calixte, O. N. Samoylova, K. L. Shuford, Phys. Chem. Chem. Phys. 2016, 18, 12204-12212.
DOI: 10.1039/C5CP04446D
6.	F. Cao, W. Ren, X. Xu, Y-X Tong, C. Zhao, Chem. Phys. Lett. 2011, 512, 81-86. DOI:10.1016/j.cplett.2011.07.010
7.	S. A. Miners, G. A. Rance, A. N. Khlobystov, Chem. Soc. Rev. 2016, 45 , 4727-4746. DOI:10.1039/C6CS00090H
8.	Y. H. Li, Y. M. Zhao, W. B. Hu, I. Ahmad, Y. Q. Zhu, X. J. Peng, Z. Luan, J. of Phys.: Conf. Ser. 2007, 61, 698-702.
DOI: 10.1088/1742-6596/61/1/140
9.	S. K. S. Kushwaha, S. Ghoshal, A. K. Rai, S. Singh, Braz. Jour. Pharma. Sci. 2013, 49 (4), 629- 643. DOI:10.1590/S1984-82502013000400002
10.	Y. Belmiloud, M. Ouraghi, M. Brahimi, A. Benaboura, D. Charqaoui, B. Tangour, Jour. Comput. Theor. Nanosci. 2012, 9, 1101-1108. DOI:10.1166/jctn.2012.2150
11.	R. Bessrour, Y. Belmiloud, Z. Hosni, B. Tangour, AIP Conference Proceedings 2012, 1456, 229-239.
DOI: 10.1063/1.4730664
12.	Z. Hosni, R. Bessrour, B. Tangour, J. Comput. Theor. Nanosci. 2014, 11, 318-323. DOI:10.1166/jctn.2014.3354
13.	A. Kumari, R. Singla, A. Guliani, S. Y. Kumar, Excli Jour. 2014, 13, 265-286.
14.	A. Mejri, D. Vardanega, B. Tangour, T. Gharbi, F. Picaud, J. Phys. Chem. B 2015, 119, 604-611. DOI:10.1021/jp5102384
15.	L. M. Dutra, O. V. de Oliveira, J. D. dos Santos, Aust. J. Chem. 2016, 70(3), 252-257. DOI:10.1071/CH16165
16.	K. V. Agrawal, S. Shimizu, L. W. Drahushuk, D. Kilcoyne, M. S. Strano, Nat. Nanotech. 2016, 12, 267-273. DOI:10.1038/nnano.2016.254
17.	S. Dargouthi, S. Boughdiri, B. Tangour , J. Comput. Theor. Nanosci., 2014, 11, 1258-1263. DOI:10.1166/jctn.2014.3491
18.	L. B. da Silva, J. Nanostruct. Chem. 2014, 4:104.
19.	S. Dargouthi, S. Boughdiri, B. Tangour, Acta Chim. Slov. 2015, 62, 445-451. DOI:10.17344/acsi.2014.1080
20.	A. Gannouni, M.Ouraghi, S. Boughdiri, R. Bessrour, A. Ben-aboura, B. Tangour J. Comput. Theor. Nanosci. 2012, 9 (3), 379-383. DOI:10.1166/jctn.2012.2034
21.	W. F. Gtari, B. Tangour, Int. J. Quantum Chem. 2013, 113(21), 2397-2404.
22.	Y. Belmiloud, W. Djitli, H. Abdeljebar, M.L Abdelatif, B. Tangour, M. Brahimi, Super. and Micro. 2017, 101, 547-558. DOI:10.1016/j.spmi.2016.10.081
23.	W. F. Gtari , B. Tangour, Can. J. chem. 2016, 94, 15-19. DOI:10.1139/cjc-2015-0235
24.	Y. H. Li, S. Wang, X. Zhang, J. Wei, C. Xu, Z. Luan, D. Wu and B. Wei, Environmental Technology, 2008, 24:3, 391-398. DOI: 10.1080/09593330309385572
25.	P. G. Collins, K. Bradley, M. Ishigami and A. Zettl, Science, 2000, 287, 1801. DOI:10.1126/science.287.5459.1801
26.	J. Kong, N. R. Franklin, C. Zhou, M. G. Chapline, S. Peng, K. Cho and H. Dai, Science, 2000, 287, 622.
DOI: 10.1126/science.287.5453.622
27.	J. Abraham, A. Vencelova, T. Seyller, F. Hennrich, M. M. Kappes, A. Hirsch and L. Ley, Phys. Chem. Chem. Phys., 2003, 5, 5472-5476. DOI:10.1039/B311016H
28.	A. Roztoczynska, J. Kozlowska, P. Lipkowski, W. Bartkowiak, Phys Chem Chem Phys. 2016, 18, 2417-2427. DOI:10.1039/C5CP04153H
29.	T. Liang, W-X. Li, H. Zhang, J. of Mol. Struct. : Theochem 2009, 905, 44-47. DOI:10.1016/j.theochem.2009.03.007
30.	C. I. Williams, M. A. Whitehead, L. Pang, J. Phys. Chem. 1993, 97, 11652-1 1656.
31.	O. Shameema, C. N. Ramachandraan, N.Sathyamurthy, J. of Phys. Chem. A Let. 2006, 110, 2-4.
32.	Y-F. Chang, B. Hong, L-L. Sun, S-W Tang, R-S. Wang, Chem. Res. In Chin. Univ. 2008, 24, (2):220-222. DOI:10.1016/S1005-9040(08)60045-8
33.	T. Yanai, D. Tew, N. Handy, Chem. Phys. Lett. 2004, 393, 5157. DOI:10.1016/j.cplett.2004.06.011
34.	J. B. Collins, P. v. R. Schleyer, J. S. Binkley, J. A. Pople, J. Chem. Phys. 1976, 64, 5142-5151. DOI:10.1063/1.432189
35.	J. T. Frey, D. J. Doren TubeGen 3.4 University of Delaware, Newark DE, 2011. http://turin.nss.udel.edu/research/tube-genonline.html. Accessed on 2014.
36. Gaussian 09, Revision D.01, M. J. Frisch, G. W. Trucks,H. B. Schlegel, G. E. Scuseria, M. A. Robb, J. R. Cheeseman, G. Scalmani, V. Barone, B. Mennucci, G. A. Petersson, H. Na-katsuji, M. Caricato, X. Li, H. P. Hratchian, A. F. Izmaylov, J. Bloino, G. Zheng, J. L. Sonnenberg, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M. Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai, T. Vreven, J. A. Montgomery, Jr., J. E. Peralta, F. Ogliaro, M. Bearpark, J. J. Heyd, E. Brothers, K. N. Kudin, V. N. Staroverov, R. Kobayashi, J. Normand, K. Raghavachari, A. Rendell, J. C. Burant, S. S. Iyengar, J. Tomasi, M. Cossi, N. Rega, J. M. Millam, M. Klene, J. E. Knox, J. B. Cross, V. Bakken, C. Adamo, J. Jaramillo, R. Gomperts, R. E. Stratmann, O. Yazyev, A. J. Austin, R. Cammi, C. Pomelli, J. W. Ochterski, R. L. Martin, K. Morokuma, V. G. Zakrzewski, G. A. Voth, P. Salvador, J. J. Dannenberg, S. Dapprich, A. D. Daniels, Ö. Farkas, J. B. Foresman, J. V. Ortiz, J. Cioslowski, , D. J. Fox, Gaussian, Inc., Wallingford CT, 2009.
37.	S. S. Han, H.M. Lee, Carbon 2004, 42, 2169-2177. D01:10.1016/j.carbon.2004.04.025
38.	J. Sloan, G. Matthewman, C. Dyer-Smith, A-Y. Sung, Z. Liu, K. Suenaga, A. I. Kirkland, E. Flahaut, ACS Nano 2008, 2, 966-976. D0I:10.1021/nn7002508
39.	D. Henwood, J. D. Carey, Phys. Rev. B 2007, 75, 245413: 1-10.
40.	C. N. Ramachandran, D. De Fazio, N. Sathyamurthy, V Aqui-lanti, Chem. Phys. Lett. 2009, 473, 146-150. D0I:10.1016/j.cplett.2009.03.068
41.	H. B. Jansen, P. Ros, Chem. Phys. Lett. 1969, 3, 140-143. DOI: 10.1016/0009-2614(69)80118-1
42.	S. F. Boys, F. Bernardi, Molec. Phys. 1970, 19, 553-566. DOI: 10.1080/00268977000101561
43.	A. T. John, A. J. H. McGaughey, Phy. Rev. Lett. 2009, 102, 184502: 1-4.ww
Povzetek
V tem delu smo s teorijo gostotnega funcionala (DFT) preučevali interakcije med armchair (n,n) enojnimi panelnimi ogljikovimi nanocevkami (SWCNT)s in vodikovimi halogenidi, ujetimi vzdolž osi nanocevk in pravokotno nanjo. Izračune smo izvedli z uporabo CAM-B3LYP funkcionala. V skladu z orientacijo vodikovih halogenidov in notranjim premerom praznin CNTs, se HF, HCl, HBr in HI različno obnašajo, ker ujetost v nano praznino spremeni porazdelitev naboja in dipolni moment. Inkapsulirana molekula vodikovega fluorida (HF) je stabilna vzdolž in pravokotno na osi (5,5) in (6,6) nanocevk. Vodikov klorid (HCl), vodikov bromid (HBr) in vodikov jodid (HI) tvorijo stabilne sisteme znotraj (6,6) nanocevk le v navpični smeri. Poleg tega opazimo druge pojave, kot so zapuščanje nanocevke ali zmanjšanje dolžine vezi molekule in celo tvorbo kovalentne vezi med molekulo in nanocevko.
Scientific paper
Theoretical Study of Ability of Boron Nitride Nanocone to Oxidation of Sulfur Monoxide
Xuewu Zuo,1 Kourosh Behradfar,2 Jia-Bao Liu,3'* Milad Janghorban Lariche4'* and Meysam Najafi5'*
1	Department of Common Course Teaching, Anhui Xinhua University, Hefei 230088, Anhui, P. R. China
2	Department of Chemical Engineering, Quchan Branch, Islamic Azad University, Quchan, Iran.
3 Jia-Bao Liu, School of Mathematics and Physics, Anhui Jianzhu University, Hefei 230601, P.R. China 4 Abadan School of Medical Sciences, Abadan, IRAN. 5 Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah 67149-67346, Iran
* Corresponding author: E-mail: liujiabaoad@163.com, janghorban@abadanums.ac.ir and meysamnajafi2016@gmail.com
Received: 18-10-2017
Abstract
In recent years, the discovery of suitable catalyst to oxidation of sulfur monoxide (SO) in normal temperature is a major concern in the industry. In this study, in first step; the boron nitride nanocone (BNNC) with Ge were doped and the surface of Ge-BNNC by using of the O2 molecule were activated. In second step; oxidation of SO on surface of Ge-BNNC through the Langmuir Hinshelwood (LH) and Eley Rideal (ER) mechanisms was investigated. Calculated data reveal that surface of O2-Ge-BNNC oxide the SO molecule with Ge-BNNC-O-O* + SO ■ Ge-BNNC-O-O*-SO ■ Ge-BNNC-O* + SO2 and Ge-BNNC-O* + SO ■ Ge-BNNC + SO2 reactions. It can be concluded, the energy barrier of LH mechanism to oxidation of SO on Ge-BNNC is lower than ER mechanism. Finally, the Ge-BNNC is acceptable catalyst with low price and high performance to oxidation of SO in normal temperature.
Keywords: Catalyst; nanostructure; metal adoption; oxidation reaction; adsorption energy
1. Introduction
Refiners, industries, mines and factories product the toxic gases that removing of produced toxic gases by oxidation reactions are important to reduce air pollution.1-3 In recent years, researchers were done various works to oxidation of the toxic gases via catalysts with high performance.4-6
In industry, catalysts containing various metals have great activity, proper performance and high sensitivity and dispersed metal catalysts were used in vital chemical reactions, generally.7-9 Previous works about oxidation of important toxic gases via metal catalysts proved that metal catalysts were expensive and they have great energy barrier and also they needed high temperature to have appropriate efficiency.10-12
In order to overcome mentioned problems and discover the novel catalyst with low price, high stability and high action in normal temperature; the nano clusters and nanostructures as catalysts of oxidation reactions of important toxic gases were used.13-18
Recently many of nanostructures because of their remarkable properties such as big surface-to-volume relationship, comfort of adopting and functionalization, high
efficiency in normal temperature were used as sensor of toxic gases.19-21 Previous studies show that functionalization of nanostructures via organic groups and doping of nanostructures via suitable metal atoms can improve the physical and chemical properties of nanostructures. The functionalization and adoption of nanostructures can improve the response and sensitivity of nanostructures to toxic gases.22-27
The oxidation of sulfur monoxide (SO) as deadly gas can reduce the environmental complications, significantly. Commonly, nanostructures as catalyst can oxide the SO molecule via Langmuir-Hinshelwood (LH) and Eley-Ri-deal (ER) mechanisms.28-30 In previous studies, oxidation of toxic gases on metal-adopted nanostructure surfaces via LH and ER mechanisms were investigated. Results show that oxidation mechanism of toxic gases depends on the type of nanostructures and adopted metals. Results indicated that adopted-metals on the nanostructure surface can improve the rate and quality of oxidation reaction of toxic gases, significantly.31-33
In LH mechanism the oxygen molecule (O2) and SO were adsorbed on surface of catalyst and also in surface of catalyst an intermediate state were formed and finally sulfur dioxide (SO2) were separated. In ER mechanism, strai-
ghtforward reaction between the pre-adsorbed O2 and adsorbed SO were performed.34-36
In previous studies, the potential of metal-adopted nanostructure as catalysts of toxic gases oxidation via LH and ER mechanisms were investigated. Results proved that metal-adopted nanostructures were acceptable catalysts with high performance and lower energy barrier.37-40 Therefore, metal-adopted nanostructures can propose the novel high performance and low price catalysts for toxic gases oxidation at normal temperature.41-43
In this study, the surface of boron nitride nanocone were adopted by Ge atom and the SO oxidation on Ge-a-dopted BNNC low price as catalyst via LH and ER mechanisms were investigated by theoretical methods. The main questions that were answered in this work are: (1) How much adoption energy is needed to adoption of Ge on BNNC surface? (2) How much adsorption energy is needed to O2 and SO adsorption on Ge-BNNC surface? (3) Can Ge-BNNC be a low price catalyst for SO oxidation in normal temperature? (4) How much barrier and adsorption energies are needed to SO oxidation on Ge-BNNC surface? (5) Which mechanisms are more appropriate for SO oxidation on Ge-BNNC surface?
1.	1. Computational Details
In this study the geometry optimization and frequency calculations of studied nanostructures and their complexes with SO and O2 were done by DFT/ M06-2X method and 6-311G (2d, 2p) basis set in GAMESS software.44-48 In this study, the unsaturated border effects by adding the hydrogen atoms to Ge-BNNC and corresponding studied complexes were avoided. The adsorption energy (Ead) values of studied molecules on Ge-BNNC surfaces were equal with difference in energies between of complexes and corresponding monomers.49,50
2. Results and Discussions
2.	1. The Ge Adoption of BNNC and
Adsorption of SO and O2 on Ge-BNNC Surface
Gao et al.51 determined the reverse eccentric connectivity index of one family of pentagonal carbon nano-cones and three infinite families of fullerenes based on graph analysis and computation derivation, and their results suggested the theoretical basis for material properties.
Gao et al.52 investigated the oxidation of CN on surface of the Ge-CNT via the Langmuir Hinshelwood and the Eley Rideal mechanisms. Their results show that oxidation of CN on surface of Ge-CNT via the LH mechanism has lower energy barrier than ER mechanism. Their results shown that reveal that Ge-CNT is acceptable catalyst with high performance for CN oxidation.
Gao et al.53 by means of graph structure analysis and edge dividing technology, formulate for calculating the fifth geometric arithmetic index of bridge graph was given. They presented the fifth geometric-arithmetic index of carbon nanocones.
In previous studies, results show that adoption of BNNCs with metal atoms can modify their electrical properties, chemical activity and reaction potential, efficiently.22-27 In this study, first the structure of BNNC and Ge--BNNC were optimized and their binding distances were reported in figure 1.
In figure 1, the Ge atom was adopted to BNNC and Ge atom was formed three bonds by bordering C atoms. Figure 1 show that, average of calculated bond lengths of Ge atom with three bordering N atoms is ca 1.91 A. Calculated bond length of each N atom with three bordering B atoms is ca 1.40 A. These growth in the Ge-N rather than B-N were interpreted by forcing of bordering N atoms via the Ge atom and so the locations of the Ge atom and bordering N atoms were perturbed toward out of the main plane.
Table 1. Obtained parameters for Ge adoption of BNNC and calculated parameters for SO and O2 adsorption on Ge-BNNC surface.
Nanoparticles	AEad	AHad	AGad	q (e)	ehlg
	(eV)	(eV)	(eV)		(eV)
Ge-BNNC	-1.22	-1.18	-0.75	0.64	2.35
Ge-BNNC-SO	-0.43	-0.37	0.32	0.11	2.36
Ge -BNNC-O2	-1.32	-1.28	-0.64	0.79	2.98
The adoption energy (AEad), enthalpy (AHad), Gibes free energy (AGad) and energy of HOMO-LUMO gap (Ehlg) of Ge-BNNC were calculated. The transferred charge (q) between Ge atom and BNNC surface were calculated and obtained results reported in table 1. Results shown that, the calculated AEad, AHad, AGad, EHLG and q values of Ge-B-NNC were -1.22, -1.18, -0.75, 2.35 eV and 0.64 electron, respectively. The large energy and charge transfer values were proved that in Ge-BNNC there are three strong cova-lent bonds between Ge atom and bordering N atoms.
The study of SO and O2 adsorption on Ge-BNNC surface has high important in order to investigation of SO oxidation. In this step the adsorption ability of SO and O2 on Ge-BNNC surface were investigated and the most stable Ge-BNNC-SO and Ge-BNNC-O2 complexes from the energy viewpoint were shown in figure 1.
Structure of Ge-BNNC-SO complex in figure 1 show that the distance between SO and Ge-BNNC was 3.53 A. The adsorption parameters in table 1 show that, the calculated AEad, AHad, AGad values of Ge-BNNC-SO were -0.43, -0.37 and 0.32 eV, respectively. The calculated q value for interaction between SO and Ge-BNNC is ca 0.11 electron. Additionally, Ehlg parameter in order to determination of changing in electronic properties of Ge-BNNC after SO adsorption was calculated and obtained results reported in table 1.
Figure 1. Structures of BNNC, Ge-BNNC, Ge-BNNC-O2 and Ge-BNNC-SO (bond distances (A)).
Results indicated that Ge-BNNC and Ge-BNNC-SO have same EHLG values. The low charge transfer from Ge--BNNC to SO show that SO adsorption on Ge-BNNC surface cannot modify the activity of Ge-BNNC, significantly. The low AEad and AHad values and positive AGad values of Ge-BNNC-SO show that interactions SO with Ge-BNNC were weakly and SO adsorption on Ge-BNNC surface was impossible from energy viewpoint.
As seen in figure 1, in Ge-BNNC-O2 the distance between of O2 and Ge-BNNC was 1.87 A. The adsorption parameters in table 1 show that, the calculated AEad, AHad, AGad values of Ge-BNNC-O2 were -1.32, -1.28 and -0.64 eV, respectively. The large calculated AEad, AHad and AGad values confirm that O2 and Ge-BNNC have appropriate chemical interactions.
The O2 bond length in Ge-BNNC-O2 is 1.32 A that is longer than bond length in single O2 ca 0.11 A. Results show, when Ge-BNNC-O2 is formed the O2 bond length is elongated and O2 on Ge-BNNC surface is activated. The obtained q value of chemical interaction between O2 and Ge-BNNC is ca 0.79 electron. Calculated EHLG value show that Ge-BNNC-O2 has higher EHLG values rather than Ge--BNNC ca 0.63 eV. Therefore results show that O2 adsorption on Ge-BNNC surface can modify the chemical
structure of Ge-BNNC and O2 adsorption improve the chemical activity of Ge- BNNC, efficiently.
In finally, results in table 1 show that O2 adsorption on Ge-BNNC surface improve the chemical properties of Ge-BNNC because of large q, AEad and AHad values. Also results confirm that when the equal amount of SO and O2 molecules were in nearby of Ge-BNNC structure the Ge--BNNC surface covered by adsorbed O2 molecule exactly. So the Ge-BNNC-O2 formation can be considered as first step in SO oxidation process.
2. 2. SO Oxidation on Activated Ge-BNNC Surface via ER and LH Mechanisms
As illustrious in introduction the ER and LH were possible mechanisms to SO oxidation on surface of na-nostructures. In ER mechanism, SO molecule was neared to surface of activated Ge-BNNC, but in LH mechanism first SO and O2 groups adsorbed and then oxidation done on Ge-BNNC surface. In previous studies, the ER and LH mechanisms for toxic gas oxidation on metal-adopted na-nostructures were investigated and results show that metal-adopted nanostructures were acceptable catalyst to toxic gas oxidation.28-36
In this section the potential of Ge-BNNC surface for SO oxidation were investigated and energy path ways for SO oxidation in both ER and LH mechanisms were exanimated. The SO oxidation path ways on Ge-BNNC surface in figures 2 and 3 were shown. The calculated activation energies (Eac) and thermodynamic indexes (AEad, AHad and AGad) of studied path ways were reported in table 2.
Results in table 2 show that, energy barrier of SO oxidation on O2 activated Ge-BNNC surface via LH mechanism was lower than corresponding value of ER mechanism. Therefore, the LH mechanism were considered in two following reactions; first reaction is Ge-BNNC--O-O* + SO — Ge-BNNC-O-O-SO — Ge-BNNC-O* + SO2, and second reaction is Ge-BNNC-O* + SO — Ge-B-NNC + SO2. The important structures in path way of two above reactions were geometry optimized and corresponding structures involving the initial state (IS), final state (P) and transition state (TS) structures were shown in figures 2 and 3.
In first reaction (Ge-BNNC-O-O* + SO — Ge-BNN-C-O-O*-SO — Ge-BNNC-O* + SO2) the Ge-BNNC-O-O*-SO, Ge-BNNC-O* and Ge-BNNC-O-O* were TS, P and IS
structures, respectively (structures were shown in figure 2). Calculated results in table 2 show that, Eac, AEad, AHad and AGad values of first reaction were 0.85, -3.43, -3.37 and -3.28 eV, respectively.
Figure 2 show that in IS structure the SO was neared to Ge-BNNC-O-O* and the O-O was lengthened from 1.32 to 1.48 Â and in IS structure the distance between SO and O2 was 2.99 Â. Figure 2 indicated that in TS structure the Ge-BNNC-O-O*-SO was designed and the O-O* and O*-S were 1.59 and 1.44 Â, respectively. Therefore results in first reaction show that a SO2 molecule was formed at room temperature because the interaction of Ge-BNNC--O* with SO2 was weakly.
In second reaction (Ge-BNNC-O* + SO - Ge-B-NNC + SO2) the Ge-BNNC-O*-SO, Ge-BNNC and Ge-B-NNC-O* were TS, P and IS structures, respectively (structures were shown in figure 3). Calculated results in table 2 show that, Eac, AEad, AHad and AGad values of second reaction were 0.18, -2.99, -2.92 and -2.84 eV, respectively.
Figure 3 show that in IS structure the SO was neared to Ge-BNNC-O* and the O*-S and Ge-O* bonds were 2.95 and 1.80 Â, respectively. Figure 3 indicated that in TS structure the Ge-BNNC-O*-SO was designed and the Ge-O*
t
À ^
r
Or l.«l
-K
- -XT < ~r


-tr


i v^
j, '
^ s

»
te- V**
T >
y- < -A >" Jf
HT*.
, « < y
< ^ H >>-
tfi -«A
-V-
..fT

jf»
, % ^, tV ^S^v^
.V-'
TS



g
c Ï
y o£
IS
4.28

■V	Reaction Patli
Figure 2. Plan of Ge-BNNC-O-O* + SO — Ge-BNNC-O + SO2 reaction (Bond distances (A) and relative energies (eV)).
Table 2. Obtained parameters for Ge-BNNC-O-O* + SO ■ Ge-BNNC-O + SO2 and Ge-BNNC-O* + SO ■ Ge-BNNC + SO2 reactions.
Reactions_EaC (eV) AEad (eV) AHad (eV) AGad (eV)
Ge-BNNC-O-O* + SO ■ Ge-BNNC-O + SO2	0.85	-3.43	-3.37	-3.28
Ge-BNNC-O* + SO ■ Ge-BNNC + SO2	0.18	-2.99	-2.92	-2.84
yL tXXs y T H IV t-u H M—'m - /V V> > ^ >. i ^O-wCv J >- ** v ^ » t-Htffr H	M « H ^ Jc <i A v « -<r * r v > - H -V / » ^	
& .. HIv h H "Y r H H	Relative Kncrgy	rs 0.18 15 P
		
„		Réaction Path
Figure 3. Plan of Ge-BNNC-O* + SO ■ Ge-BNNC + SO2 reaction (Bond distances (A) and relative energies (eV)).
and O*-S were 1.84 and 2.15 A, respectively. Therefore results show that in second reaction a SO2 molecule was formed at room temperature because the interaction of Ge-B-NNC with SO2 was weakly.
That is remarkable that two investigated reactions (Ge-BNNC-O-O* + SO - Ge-BNNC-O-O-SO - Ge-B-NNC-O* + SO2 and Ge-BNNC-O* + SO - Ge-BNNC + SO2) in figures 2 and 3 were exothermic. The calculated AGad in table 2 propose that the two studied reactions were negative in normal temperature and so the SO oxidation via Ge-BNNC-O* and Ge-BNNC-O-O* was favorable from thermodynamic view point. Finally results show that, Ge-BNNC can be remarkable catalyst for SO oxidation via LH mechanism with high efficiency due to low barrier energy in normal temperature.
3. Conclusion
The DFT method used to SO oxidation on activated Ge-BNNC surface via LH and ER mechanisms. Results indicated that Ge-BNNC can be an efficient catalyst to SO oxidation with low cost in normal temperature. Results show that O2 adsorption on Ge-BNNC surface cause greater effects on properties of Ge-BNNC. Results show that AEad and q values of Ge-BNNC-O2 were higher than Ge-BNNC-SO. Results show when the SO and O2 reached to Ge-BNNC the Ge-BNNC surface surround with O2, concurrently. Results show that SO oxidation on Ge-BNNC surface via the LH mechanism has lower energy barrier than ER mechanism. Finally, results propose that O2 activated Ge-BNNC can be a novel catalyst
to SO oxidation with high efficient and low price in normal temperature.
4. Acknowledgment
The authors would like to thank all chemistry teachers for scientific supports.
5. References
1.	A. Kiani, P. Haratipour, M. Ahmadi, R. Zare-Dorabei, A. Mahmoodi, J. Water Supply. Res. 2017, 66, 239-248.
2.	Z. Parsaee, P. Haratipour, M. Janghorban Lariche, A. Vojood, Ultrason. Sonochem. 2018, 41, 337-349. DOI:10.1016/j.ultsonch.2017.09.054
3.	P. Haratipour, A. Baghban, A. H. Mohammadi, S. H. Hosseini Nazhad, A. Bahadori, J. Mol. Liq. 2017, 242, 146-159. DOI:10.1016/j.molliq.2017.06.123
4.	M. H. Doranehgard, H. Samadyar, M. Mesbah, P. Haratipour, S Samiezade, Fuel, 2017, 202, 29-35. DOI:10.1016/j.fuel.2017.04.014
5.	A. Baghban, J. Sasanipour, P. Haratipour, M. Alizad, M. Vafaee Ayouri, Chem. Eng. Res. Des. 2017, 126, 67-75. DOI:10.1016/j.cherd.2017.08.007
6.	W. Gao, P. Haratipour, M. R. R. Kahkha, A. Tahvili, Ultrason. Sonochem. 2018, 44, 152-161. DOI:10.1016/j.ultsonch.2018.02.020
7.	H. J. Freund, G. Meijer, M. Scheffler, Angew. Chem. 2011, 50, 10064-10094. DOI:10.1002/anie.201101378
8.	R. S. Johnson, A. DeLaRiva, V. Ashbacher, Phys. Chem. Chem. Phys. 2013, 15, 7768-7776. DOI:10.1039/c3cp00126a
9.	H. Y. Su, M. M. Yang, X. H. Bao, W. X. Li, J. Phys. Chem. C 2008, 112, 17303-17310. DOI:10.1021/jp803400p
10.	M. S. Chen, Y. Cai, Z. Yan, Surf. Sci. 2007, 601, 5326-5331. DOI:10.1016/j.susc.2007.08.019
11.	S. Piccinin, M. Stamatakis, ACS Catal. 2014, 4, 2143-2152. DOI:10.1021/cs500377j
12.	W. Liu, Y. Zhu, J. Lian, Q. Jiang, J. Phys. Chem. C 2007, 111, 1005-1009. DOI:10.1021/jp0661488
13.	D. J. Liu, J. Phys. Chem. C 2007, 111, 14698-14706. DOI:10.1021/jp071944e
14.	W. T. Wallace, R. L. Whetten, J. Am. Chem. Soc. 2002, 124, 7499-7505. DOI:10.1021/ja0175439
15.	C. Chang, C. Cheng, C. Wei, J. Chem. Phys. 2008, 128, 124710-124710. DOI:10.1063/1.2841364
16.	J. Du, G. Wu, J. Wang, J. Phys. Chem. A 2010, 114, 1050810514. DOI:10.1021/jp106321s
17.	Sharifian S, Harasek M, Haddadi B, Chem. Prod. Process Mod. 2016, 11, 67-72.
18.	Sharifian S, Miltner M, Harasek M, Chem. Eng. Trans. 2016, 52, 565-570.
19.	Sharifian S, Harasek M, Chem. Eng. Trans. 2015, 45, 409-414.
20.	Sharifian S, Harasek M, Chem. Eng. Trans. 2015, 45, 10031008.
21.	L. Ci, Z. Xu, L. Wang, W. Gao, F. Ding, Nano Res. 2008, 1, 116-122. DOI:10.1007/s12274-008-8020-9
22.	C. Lee, X. Wei, J. W. Kysar, J. Hone, Science 2008, 321, 385388. DOI: 10.1126/science.1157996
23.	K. S. Novoselov, A. K. Geim, S. Morozov, Science 2004, 306, 666-669. DOI: 10.1126/science.1102896
24.	A. K. Geim, K. S. Novoselov, Nat. Mater. 2007, 6, 183-191. DOI:10.1038/nmat1849
25.	S. Morozov, K. Novoselov, M. KatGeelson, Phys. Rev. Lett. 2008, 100, 016602. DOI:10.1103/PhysRevLett.100.016602
26.	A. K. Geim, Science 324, 2009, 1530-1534. DOI: 10.1126/science.1158877
27.	K. R. Ratinac, W. Yang, S. P. Ringer, F. Braet, Environ. Sci. Technol. 2010, 44, 1167-1176. DOI:10.1021/es902659d
28.	A. Hornes, A. B. Hungria, J. Am. Chem. Soc. 2010, 132, 34-37. DOI:10.1021/ja9089846
29.	X. Hu, Y. Wu, Z. Zhang, J. Mater. Chem. 2012, 22, 1519815205. DOI:10.1039/c2jm33490a
30.	Y. Tang, X. Dai, Z. Yang, Z. Liu, L. Pan, D. Ma, Z. Lu, Carbon 2014, 71, 139-143. DOI:10.1016/j.carbon.2014.01.022
31.	Y. Li, Z. Zhou, G. Yu, W. Chen, Z. Chen, J. Phys. Chem. C
2010,	114, 6250-6255. DOI:10.1021/jp911535v
32.	E. H. Song, Z. Wen, Q. Jiang, J. Phys. Chem. C 2011, 115, 3678-3683. DOI:10.1021/jp108978c
33.	Y. Tang, Z. Yang, X. Dai, Phys. Chem. Chem. Phys. 2012, 14, 16566-16569. DOI:10.1039/c2cp41441d
34.	Y. Tang, Z. Liu, X. Dai, Z. Yang, W. Chen, Z. Lu, Appl. Surf. Sci. 2014, 308, 402-407. DOI:10.1016/j.apsusc.2014.04.189
35.	S. Lin, X. Ye, J. Huang, Phys. Chem. Chem. Phys. 2015, 17, 888-893. DOI:10.1039/C4CP05007J
36.	S. A. Taw fi k, X.Y. Cui, D.J. Carter, C. Stampfl, Phys. Chem. Chem. Phys. 2015, 17, 62-69.
37.	A .G. Davies, Organotin Chemistry, 2nd edition, Wiley-VCH, Weinheim, 2004. DOI:10.1002/3527601899
38.	H. Song, L. Zhang, C. He, Y. Qu, Y. Tian, Y. Lv, J. Mater. Chem.
2011,	21, 5972-5975. DOI:10.1039/c0jm04331a
39.	Q. Zhou, C. Wang, Z. Fu, Y. Tang, H. Zhang, Comput. Mater. Sci. 2014, 83, 398-402. DOI:10.1016/j.commatsci.2013.11.036
40.	A.V. Krasheninnikov, P.O. Lehtinen, A.S. Foster, Phys. Rev. Lett. 2009, 102, 400-430.
DOI: 10.1103/PhysRevLett.102.126807
41.	F. Li, J. Zhao, Z. Chen, J. Phys. Chem. C 2012, 116, 2507-2514. DOI:10.1021/jp209572d
42.	X. Wang, X. Li, L. Zhang, Y. Yoon, P.K. Weber, Science 2009, 324, 768-771. DOI:10.1126/science.1170335
43.	A. L. M. Reddy, A. Srivastava, S.R. Gowda, H. Gullapalli, ACS Nano 2010, 4, 6337-6342. DOI:10.1021/nn101926g
44.	Y. Zhao, D.G. Truhlar, Theor. Chem. Acc. 2008, 120, 215-241. DOI:10.1007/s00214-007-0310-x
45.	J. Andzelm, C. Kolmel, J. Chem. Phys. 1995, 103, 9312-9320. DOI: 10.1063/1.469990
46.	L. H. Gan, J. Q. Zhao, Physica E 2009, 41, 1249-1252. DOI:10.1016/j.physe.2009.02.014
47.	S. F. Boys, F. Bernardi, Mol. Phys. 1970, 19, 553-566. DOI: 10.1080/00268977000101561
48.	L. Ma, J. M. Zhang, K. W. Xu, V. Ji, Appl. Surf. Sci. 2015, 343, 121-127. D01:10.1016/j.apsusc.2015.03.068
49.	T. Zhang, Q. Xue, M. Shan, Z. Jiao, J. Phys. Chem. C 2012, 116, 19918-19924. D0I:10.1021/jp3073359
50.	M. Wu, C. Cao, J. Jiang, J. Phys. 2010, 12, 063020-063024.
51.	W. Gao, M. R. Farahani, J. Nanotechno. 2016, 2016, 1-6.
52.	W. Gao, S. M. Abrishamifar, G. E. Rajaei, R. Razavi, M. Najafi, Chem. Phys. Lett. 2018, 695, 44-50. D01:10.1016/j.cplett.2018.01.056
53.	W. Gao, W. F. Wang, J. Differ. Equations Appl. 2017, 23, 100109. DOI: 10.1080/10236198.2016.1197214
Povzetek
V zadnjih letih se industrija veliko ukvarja z razvojem učinkovitih in poceni katalizatorjev za oksidacijo žveplovega monoksida (SO) pri normalni temperaturi. S tem namenom smo preučevali nanostožec borovega nitrida (BNNC) dop-iranega z Ge, čigar površino smo aktivirali z molekulo O2. Nato smo z uporabo Langmuir Hinshelwood (LH) in Eley Rideal (ER) mehanizmov raziskali oksidacijo SO na aktivirani površini Ge-BNNC. Rezultati kažejo, da tako aktivirana površina Ge-BNNC oksidira molekulo SO ter da ta proces lahko opišemo z zaporedjem reakcij Ge-BNNC-OO * + SO ■ Ge-BNNC-OO * -SO ■ Ge-BNNC-O * + SO2 in Ge-BNNC-O * + SO ■ Ge-BNNC + SO2. Izkazalo se je, da oksidacija SO na aktivirani površini Ge-BNNC pri uporabi LH mehanizma poteka pri nižji energetski barieri kot pri ER mehanizmu. Izračunani parametri kažejo, da je aktiviran Ge-BNNC sprejemljiv katalizator z nizko ceno in visoko zmogljivostjo za oksidacijo SO pri normalni temperaturi.
DOI: 10.17344/acsi.2017.3925
Acta Chim. Slav. 2018, 65, 303-311
Scientific paper
Possibility of C38 and Si19Ge19 Nanocages in Anode of Metal Ion Batteries: Computational Examination
Rong-Jun Bie,1 Muhammad Kamran Siddiqui,2 Razieh Razavi,3,* Milad Taherkhani4 and Meysam Najafi^*
1 School of Mathematics and Physics, Anhui Jianzhu University, Hefei 230601, China 2 Department of Mathematics, Comsats Institute of Information Technology Sahiwal, Pakistan 3 Department of Chemistry, Faculty of Science, University ofJiroft, Jiroft, Iran
4	Department of Chemical Engineering, Amirkabir University of Technology (Tehran Polytechnic), Tehran, Iran
5	Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah 67149-67346, Iran
* Corresponding author: E-mail: R.Razavi@ujiroft.ac.ir and meysamnajafi2016@gmail.com Phone: +98-8337243181 Fax: +98-8337243181
Received: 18-10-2017
Abstract
In this study, the potential of C38 and Si19Ge19 as anode electrodes of Li-ion, Na-ion and K-ion batteries via density functional theory was investigated. Obtained results showed that Si19Ge19 as anode electrode in metal-ion batteries has higher potential than C38 ca 0.18 V. Calculated results illustrated that K-ion battery has higher cell voltage and higher performance than Li-ion and Na-ion batteries ca 0.15 and 0.31 V, respectively. Results showed that halogen adoption increased the cell voltage of studied metal-ion batteries ca 1.5-2.2 V. Results show that, Vcen values of studied metal-ion batteries in water are higher than gas phase ca 0.46 V. Finally it can be concluded that F-doped Si18Ge19 as anode electrode in K-ion battery has the highest performance and it can be proposed as novel metal-ion batteries with high performance.
Keywords: Battery; nanocage; adoption; voltage; anode and halogen
1. Introduction
A rechargeable battery is a kind of electronic battery that has many electro-chemical various cells and it can be recharged several times. The cost of buying the rechargeable cells are higher than disposable cells, though rechargeable cells have lower destructive effects on environment. The rechargeable batteries have been used in starter of car, consumer devices and battery reservoir center.1-6
In lithium-ion battery (LIB) there are two processes; in charging process the lithium ions transferred from the positive to negative electrode and in discharge process the motion of lithium ions is the reverse of charge process. LIBs have high energy compression, high storage capacity, small memory effect and small self-evacuation.7-12 The LIBs are expensive at actual, and a leakage of Lithium employed in LIBs can convert to an important issue in future.13-18 The novel metal-ion batteries as the electrical
storage batteries must have high capacity, high performance and high rate in charge and discharge process-es.18-23 The graphite due to low cost, cyclic durability, high energy stability has been used for anode electrode. In previous works, potential of some compounds such as germanium, transition metals and silicon for anode electrode have been examined.24-33 In previous works the potential and capacities of nanoelectrods have been investigated and obtained results shown that nanotubes and nanocages have higher valences and energy capacitor than the graph-ite.34-44 In previous studies, results confirmed that hydrogenation, adoption and functionalization of nanostruc-tures improved their performances as anode materials in metal-ion batteries.45-52 Due to positive effects of hydrogenation, adoption and functionalization of nanostructures on potentials of metal-ion batteries, many works have been done on usage of nanostructures as anode electrodes in metal-ion batteries.52-55
Figure 1. Structures of studied complexes.
In this study, in first step; the potential of C38 and Si19Ge19 nanocages as anode electrode in Li-ion battery via density functional theory was investigated. In second step; the C38 and Si19Ge19 nanocages doped with halogen atoms and effects of these adoptions on ability of Li-ion battery were examined. In third step; the potential of sodium-ion battery (NIB) and potassium-ion battery (KIB) were compared with Li-ion battery. In fourth step; the effects of halogen adoption on potential of studied NIBs and KIBs were investigated. In fifth step; novel metal-ion battery with high performance to use in industry will be proposed.
The main questions have been answered in this work are: (1) How much dose cell voltages of LIBs C38 and Si19Ge19 as anode electrodes? (2) Can NIBs and KIBs be suitable batteries with high performance? (3) Can halogen adoption increase the cell voltage of LIBs? (4) Which metal-ion batteries have high performance?
2. Computational Details
In this study, the geometries of C38 and Si19Ge19 were optimized via GAMESS software via DFT/ M06-2X theory and 6-311+G (2d, 2p) basis set. The adsorption of C38 and Si19Ge19 with halogen atoms (X = F, Cl, Br) were investigated and geometries of X-C38 and X-Si19Ge19 complexes were optimized at mentioned level of computational.
In this study the vibrational frequency calculations of all studied via DFT/M06-2X theory and 6-311+G (2d, 2p) basis set were done in order to evidence that all of the optimized geometries are factual local minima and also thermodynamic parameters of studied reactions were calculated by using of vibrational frequency analysis.56-58
The Gibbs free energy of process of adsorption of halogen atom (X = F, Cl, Br) on studied nanostructures were calculated via: Gad = G (X-nanostructure) - G (nano-structure) - 0.5 G (X2), where X-nanostructure corresponds to the Gibbs free energy of complexes of nano-structure with halogen atom, G (X2) is the Gibbs free energy of the halogen molecule and G (nanostructure) is the Gibbs free energy of the nanostructure.59-61
The Gibbs free energy of adsorption of metal on nanostructure surfaces were calculated via: Gad = G (M-nanostructure) - G (nanostructure) - G (M); where G (M-nanostructure) corresponds to the Gibbs free energy of complexes of nanostructure with metal and G (M) is the Gibbs free energy of the metal and G (nanostructure) is Gibbs free energy of the nanostructure.62-64
In this study, the energies of the basis set superposition error (Ebsse) for studied interactions between nanostructures and metals were calculated by using of counterpoise correction method and obtained results showed that EBSSE values are ca 0.05 Kcal/mol.
The energy difference between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of studied nanostructures defined as HOMO-LUMO Gap (EHLG) and it calculated via (Ehlg = Elumo - Ehomo); where Elumo and Ehomo are energies of LUMO and HOMO of studied nanostruc-tures.65-67
In the cathode and anode of LIBs, NIBs and KIBs with hypothetical nanostructure anode it can be expressed the anode reaction is (M/nanostructure ^ M + + e-) and cathode reaction is (M + + e- ^ M). The complete reaction for the LIBs, NIBs and KIBs can be defined via (M + + M/nanostructure ^ M +/nanostructure + M + AGceu). Finally, in order to calculate the cell voltage (Vcen) the Nernst equation are Vcen = -AGcen / zF; where F is the Faraday constant (96,500 C/mol) and z is the charge of
M+.68-70
3. Results and Discussion
3. 1. C38 and Si19Ge19 as Anode in Metal-ion Batteries
Peyghan et al.71 investigated the viability of using a BN nanotube for detection of para-chloroaniline molecule by means of density functional theory calculations. Their results showed that the molecule prefers to be adsorbed on the intrinsic BN nanotube from its N atom, releasing energy of 0.65 eV without significant effect on the electrical conductivity of the tube. Their results showed that Si-doped tube detected its presence because of the drastic increase of the electrical conductivity of the tube. Peyghan et al.72 investigated the adsorption of two anions (F and Cl) and two cations (Li and Na) on the surface of aluminum nitride nanotubes (AlNNTs) by density functional theory. Their results showed that adsorption of anions may facilitate the electron emission from the AlNNT surface by reducing the work function due to the charge transfer occurs from the anions to the tube.
Hosseini et al.73 investigated the performance of B12N12, and its structurally manipulated forms as anode materials for Li-ion batteries (LIBs) by means of density functional theory calculations. Their results shown that encapsulating a fluoride inside the B12N12 significantly increased the electrochemical cell voltage (Vcen) of B12N12.
Najafi et al.74 examined the applications of B30N30, B36N36, BNNT (8, 0) and BNNT (10, 0) as anode materials for lithium-ion batteries by density functional theory. Their results shown that Vcell of BNNT (8, 0) and BNNT (10, 0) were higher than B30N30 and B36N36. Their results shown that F functionalization of studied BN-nanostruc-tures improved the potential of anode materials of lithium-ion batteries.
Nejati et al.75 investigated the potential of B12N12 nanocages as anode in Na-ion batteries by density func-
tional theory. Their results shown that encapsulation of different halides (X = F-, Cl-, Br-) into BN nanocage increased the cell voltage.
Hosseinian et al.76 investigated the potential of BN nanosheets in anode of Na-ion batteries by means of density functional theory. Their results shown that replacing three N atoms of the hexagonal ring with larger P atoms increased the performance of the BN nanosheet as an anode of a Na-ion battery but the replacement of B by Al decreased its performance.
Ruiz et al.77 proven that DFT/M06-2X method can describe the structure and energetics of hybrid inorganic-organic systems with high accuracy. Their results showed that calculated energy error bar values for hybrid inorganic-organic systems correspond to typical experimental error estimates. Their results showed that DFT/ M06-2X method has the most accurate results for the binding distance and adsorption energy.
Zhao et al.78 compared the accuracy and energy error bar of M06-2X functional with 12 other functionals and Hartree Fock theory for 403 energetic data in 29 diverse databases. They recommend M06-2X functional for calculate the thermochemistry, noncovalent interactions and electronic excitation energies to valence and Rydberg states. They suggested the M06-2X functional with high accurate for application in organometallic and inorgano-metallic chemistry and for noncovalent interactions.
Mahmood et al.79 examined the performance of 26 combinations of DFT functionals and basis sets were evaluated for the calculation of the activation energy of meth-ylation reactions of nitronates. Their results showed that DFT method and M06-2X functional provided the most accurate results.
Wheeler et al.80 calculated the enthalpies for bond-forming reactions by using of six DFT functionals and reaction enthalpies were decomposed into contributions from changes in bonding and other intramolecular effects via the hierarchy of homodesmotic reactions. Their results showed that M06-2X has most accurate performance for studied reactions and M06-2X is one of the more accurate functionals for the underlying bond transformations.
Hohenstein et al.81 showed that M06-2X provide significant improvements over traditional density func-tionals for the noncovalent interactions. Their results showed that M06-2X correction greatly increases the accuracy of calculations without increasing the computational cost in any significant way. Therefore in previous studies, it can be concluded that DFT/M06-2X method was used for calculation of interactions and energies of various organic and inorganic systems and results showed that DFT/ M06-2X has high accuracy.77-81
In this section the potential of C38 and Si19Ge19 as anodes in LIB, NIB and KIB via DFT method was investigated and novel metal-ion batteries with higher performance were identified. The structures of complexes of C38
Table 1. Calculated Gad (kcal/mol) and bond length (A) values of studied complexes.
Complex	Gad		Complex	Gad	Complex		Gad
F-C37	-39.99		Cl-C37	-37.84	Br-C37		-35.70
F-Si18Ge19	-45.98		Cl-Sii8Gei9	-43.52	Br-Si	18Ge19	-41.06
Complex	Bond		Length	Complex	Bond		Length
Li-C38	Li-—	-C	2.33	Li-Sii9Gei9	Li--	---Si	2.73
Na-C38	Na----	-- C	2.47	Na-Si19Ge19	Na--	----Si	2.86
K-C38	K-----	-C	3.15	K-Sii9Gei9	K---	---Si	3.55
L1-F-C37	Li-----	-F	2.13	Li-F-Si18Ge19	Li--	---- F	2.16
Na-F-C37	Na----	-- F	2.25	Na-F-Si18Ge19	Na--	---- F	2.29
K-F-C37	K-----	-F	2.43	K-F-Si18Ge19	K--	---- F	2.43
L1-F-C37	F-----	-C	1.37	Li-F-Si18Ge19	F----	--Ge	1.78
Na-F-C37	F-----	-C	1.34	Na-F-Si18Ge19	F----	--Ge	1.76
K-F-C37	F-----	-C	1.36	K-F-Si18Ge19	F----	--Ge	1.77
Li-Cl-C37	Li-----	-Cl	2.51	Li-Cl-Si18Ge19	Li---	---Cl	2.54
Na-Cl-C37	Na-----	-Cl	2.65	Na-Cl-Si18Ge19	Na--	----Cl	2.65
K-Cl-C37	K------	Cl	3.36	K-Cl-Si18Ge19	K---	---Cl	3.34
Li-Cl-C37	Cl-----	-C	1.73	Li-Cl-Si18Ge19	Cl---	---Ge	2.18
Na-Cl-C37	Cl-----	-C	1.77	Na-Cl-Si18Ge19	Cl---	---Ge	2.17
K-Cl-C37	Cl-----	-C	1.75	K-Cl-Si18Ge19	Cl---	---Ge	2.16
Li-Br-C37	Li-----	-Br	2.66	Li-Br-Si18Ge19	Li---	---Br	2.67
Na-Br-C37	Na-----	-Br	2.87	Na-Br-Si18Ge19	Na--	----Br	2.86
K-Br-C37	K------	Br	3.47	K-Br-Si18Ge19	K---	---Br	3.89
Li-Br-C37	Br-----	-C	1.93	Li-Br-Si18Ge19	Br---	---Ge	2.34
Na-Br-C37	Br-----	-C	1.92	Na-Br-Si18Ge19	Br---	---Ge	2.32
K-Br-C37	Br-----	-C	1.91	K-Br-Si18Ge19	Br---	---Ge	2.34
and Si19Ge19 with Li, Na and K were presented in figure 1. The bond lengths in  of Li, Na and K with C38 and Si19Ge19 were reported in table 1.
The calculated values of the Gibes free energy (Gad) in kcal/mol of adsorbed metals and metal ions on surfaces of C38 and Si19Ge19 were presented in table 2. Results show that, all calculated Gad values were negatives and so the studied adsorption were possible from thermodynamic view point. Results show that Gad value of K-C38 is higher than Gad values of Li-C38 and Na-C38. Also Gad value of K-Si19Ge19 is higher than Gad values of Na-Si19Ge19 and K-Si19Ge19. Results show that Gad values of Li, Na and K on Si19Ge19 are higher than Gad values on C38.
Results show that, Gad values of metal ions on C38 and Si19Ge19 are higher than Gad values of metal on C38 and Si19Ge19 and the Gad values for studied metal and metal ions have same trends. The Gad values of metal-nanostruc-ture complexes were decreased as following: Li-C38 < Na-C38 < Li-Si19Ge19 < K-C38 < Na-Si19Ge19 < K-Si19Ge19 and for metal ion-nanostructure complexes were decreased as following: Li+-C38 < Na+-C38 < Li+-Si19Ge19 < K+-C38 < Na+-Si19Ge19 < K+-Si19Ge19. So it can be concluded that K or K+-Si19Ge19 and Li or Li+-C38 have the highest and the lowest Gad absolute values, respectively.
The calculated EHOMO, ELUMO and EHLG values in eV of complexes of Li, Na and K with C38 and Si19Ge19 were reported in table 3. Results show that, EHOMO value of
K-C38 is lower than EHOMO values of Li-C38 and Na-C38. Also Ehomo value of K-Si19Ge19 is lower than EHOMO values of Li-Si19Ge19 and Na-Si19Ge19. Results display that EHOMO values of Li, Na and K on Si19Ge19 are lower than Ehomo values on C38.
Results in table 3 show that, EHLG value of K-C38 is lower than EHLG values of Li-C38 and Na-C38. Also EHLG value of K-Si19Ge19 is lower than EHLG values of Li-Si19Ge19 and Na-Si19Ge19. Results show that, the EHLG values of studied metal-nanostructures were decreased as following: Li-C38 > Na-C38 > K-C38 > Li-Si19Ge19 > Na-Si19Ge19 > K-Si19Ge19. So it can be concluded that K-Si19Ge19 and Li-C38 have the lowest and the highest EHLG values, respectively.
Hosseini et al.73 investigated the £HLG values of B12N12 and H12B12N12 via B3LYP functional and 6-31G (d) basis set and their results shown that £HLG values of B12N12 and H12B12N12 were 6.84 and 2.51 eV, respectively. Also they calculated the £HLG values of complexes of B12N12 and H12B12N12 with Li atom and their results shown that the £hlg values of Li-B12N12 and Li-H12B12N12 were 6.10 and 2.38 eV, respectively.
Nejati et al.75 calculated the EHLG value of B12N12 cage via B3LYP functional and 6-31G (d) basis set in GAMESS software and their results shown that EHLG values of B12N12 and Na-B12N12 were 6.84 and 1.59 eV, respectively. The Ehlg values of complexes of F-B12N12, Cl-
B12N12 and Br-B12N12 with Na atom and their results shown that the EHLG values of Na-F-B12N12, Na-Cl-B12N12 and Na-Br-B12N12 were 1.67, 1.65 and 2.01 eV, respectively.
Hosseinian et al.76 calculated the EHLG values of BN-nanosheets via B3LYP functional and 6-31G (d) basis set and their results shown that EHLG values of BN-nanosheet, Al-BN-nanosheet and P-BN-nanosheet were 5.88, 4.98 and 5.38 eV, respectively. Also they calculated the EHLG values of complexes of nanosheets with Na atom and their results shown that the EHLG values of Na-BN-nanosheet, Na-Al-BN-nanosheet and Na-P-BN-nanosheet were 1.64, 2.09 and 1.17 eV, respectively.
The calculated Vcen in V of complexes of Li, Na and K with C38 and Si19Ge19 were reported in table 2. Results show that, Vcell value of K-C38 is higher than Vcen values of Li-C38 and Na-C38. Also Vcen value of K-Si19Ge19 is higher than Vcell values of Li-Si19Ge19 and Na-Si19Ge19. Results display that Vcell values of Li, Na and K on Si^Ge^ are higher than Vcell values on C38. Results show that, the Vcell values of studied complexes were decreased as following: Li-C38 < Na-C38 < K-C38 < Li-Si19Ge19 < Na-Si19Ge19 < K-Si19Ge19. So it can be concluded that K-Si19Ge19 and Li-C38 have the highest and the lowest Vcell values, respectively.
Finally, it can be concluded: (1) the Si19Ge19 as anode in metal-ion batteries has higher potential than C38 ca 0.18 V (2) the KIB has higher Vcen and higher performance than NIB and KIB ca 0.15 and 0.31 V, respectively.
3. 2. Halogen Adoption of C38 and Si19Ge19
Hosseini et al.73 calculated the Gcen and Vcen values of B12N12 and F-B12N12 as anode electrodes of Li-ion battery. Their results shown that encapsulating a fluoride inside the BN nanocage can be considered as suitable strategy to improvement the performance of BN nanocage as anode electrode of Li-ion batteries.
Nejati et al.75 calculated the Gcen and Vcen values of B12N12 as anode electrode of Na-ion battery. Their results shown that the Gcen values of F-B12N12, Cl-B12N12 and Br-B12N12 were -85.3, -87.9 and -90.5 kcal/mol, respectively.
In this section the effects of F, Cl and Br adoption on performance of C38 and Si19Ge19 as anodes of metal-ion batteries via DFT method were investigated. The calculated Gad values of F-, Cl- and Br-doped C38 and Si19Ge19 were presented in table 1. Results show that, all calculated Gad values were negatives and so the adoption of C38 and Si19Ge19 with F, Cl and Br were possible from thermodynamic view point.
Results show that Gad value of F-C37 is higher than Gad values of Cl-C37 and Br-C37. Also Gad value of F-Si^Ge^ is higher than Gad values of Cl-Si18Ge19 and Br-Si18Ge19. Results show that, adoption of C38 and Si19Ge19 with F atom are possible processes from thermodynamic view point and F-C37 and F-Si18Ge19 can be suitable candidates as anodes of metal-ion batteries.
In this section the potential of F-, Cl- and Br-doped C37 and Si18Ge19 as anodes in LIB, NIB and KIB via DFT
Table 2. Calculated Gad (kcal/mol) and Vceu (V) values of studied complexes.
Complex	Gad	Vcell	Complex	Gad	Vcell
K-C38	-7.96	1.44	K-Si19Ge19	-9.16	1.66
Na-C38	-7.11	1.29	Na-Si19Ge19	-8.18	1.48
Li-C38	-6.35	1.15	Li-Si^Ge^	-7.30	1.32
K-F-C37	-17.84	3.23	K-F-Si18Ge19	-20.51	3.71
Na-F-C37	-15.93	2.88	Na-F-Si18Ge19	-18.31	3.31
Li-F-C37	-14.22	2.57	Li-F-Si18Ge19	-16.35	2.96
K-Cl-C37	-16.88	3.05	K-Cl-Si18Ge19	-19.41	3.51
Na-Cl-C37	-15.07	2.73	Na-Cl-Si18Ge19	-17.33	3.14
Li-Cl-C37	-13.46	2.43	Li-Cl-Si18Ge19	-15.48	2.80
K-Br-C37	-15.93	2.88	K-Br-Si18Ge19	-18.31	3.31
Na-Br-C37	-14.22	2.57	Na-Br-Si18Ge19	-16.35	2.96
Li-Br-C37	-12.70	2.30	Li-Br-Si18Ge19	-14.60	2.64
K+-C38	-41.14		K+-Si19Ge19	-47.32	
Na+-C38	-36.73		Na+-Si19Ge19	-42.25	
Li+-C38	-32.80		Li+-Si19Ge19	-37.72	
K+-F-C37	-92.16		K+-F-Si18Ge19	-105.98	
Na+-F-C37	-82.29		Na+-F-Si18Ge19	-94.62	
Li+-F-C37	-73.47		Li+-F-Si18Ge19	-84.49	
K+-Cl-C37	-87.22		K+-Cl-Si18Ge19	-100.30	
Na+-Cl-C37	-77.87		Na+-Cl-Si18Ge19	-89.55	
Li+-Cl-C37	-69.53		Li+-Cl-Si18Ge19	-79.97	
K+-Br-C37	-82.29		K+-Br-Si18Ge19	-94.62	
Na+-Br-C37	-73.47		Na+-Br-Si18Ge19	-84.49	
Li+-Br-C37	-65.60		Li+-Br-Si18Ge19	-75.44	
method was investigated. The structures of complexes of halogen-C37 and halogen-Si18Ge19 with Li, Na and K were presented in figure 1. The bond lengths of Li, Na and K with halogen-C37 and halogen-Si18Ge19 and also bond lengths of halogen atoms with bordering C or Ge atoms were reported in table 1.
The calculated Gad values of complexes of metals with halogen-C37 and halogen-Si18Ge19 were presented in table 2. Results show that, all calculated Gad values were negatives and so the studied adsorption were possible from thermodynamic view point. Results show that Gad value of K-halogen-C37 are higher than Gad values of Li-halogen-C37 and Na-halogen-C37. Also Gad value of K-halogen-Si18Ge19 are higher than Gad values of Na-halo-gen-Si18Ge19 and K-halogen-Si18Ge19. Results display that Gad values of Li, Na and K on halogen-Si18Ge19 are higher than Gad values on halogen-C37.
Results show that Gad values of F-Si18Ge19 and F-C37 are higher than Gad values of Cl or Br-Si18Ge19 and Cl or Br-C37. The Gad values of complexes of metals with halo-gen-C37 and halogen-Si18Ge19 were decreased as following: M-Br-C37 < M-Cl-C37 < M-F-C37 < M-Br-Si18Ge19 < M-Cl-Si18Ge19 < M-F-Si18Ge19. So it can be concluded that K-F-Si18Ge19 and Li-Br-C38 have the highest and the lowest Gad absolute values, respectively.
The calculated EHOMo, ELUMO and EHLG values in eV of complexes of Li, Na and K with halogen-C37 and halo-gen-Si18Ge19 were reported in table 3. Results show that, Ehomo value of K-halogen-C37 are lower than EHOMO values of Li-halogen-C37 and Na-halogen-C37. Also EHoMo value of K-helogen-Si18Ge19 are lower than EHOMO values of Li-halogen-Si18Ge19 and Na-halogen-Si18Ge19. Results display that EHOMO values of Li, Na and K on halo-gen-Si18Ge19 are lower than EHOMO values of halogen-C37.
Results show that, EHLG value of K-halogen-C37 are lower than EHLG values of Li-halogen-C37 and Na-halo-gen-C37. Also EHLG value of K-halogen-Si18Ge19 are lower than Ehlg values of Li-halogen-Si18Ge19 and Na-halo-gen-Si18Ge19. Results show that, the EHLG values of studied complexes were decreased as following: Li-halogen-C37 <
Na-halogen-C37 < K-halogen-C37 < Li-halogen-Si18Ge19 < Na-halogen-Si18Ge19 < K-halogen-Si18Ge19. So it can be concluded that K-F-Si18Ge19 and Li-Br-C37 have the lowest and the highest EHLG values, respectively.
The calculated Vcen of complexes of Li, Na and K with halogen-C37 and halogen-Si18Ge19 were reported in table 2. Results show that, Vcen value of K-halogen-C37 are higher than Vcell values of Li-halogen-C37 and Na-halogen-C37. Also Vcell value of K-halogen-Si18Ge19 are higher than Vcen values of Li-halogen-Si18Ge19 and Na-halogen-Si18Ge19. Results display that Vcell values of Li, Na and K on halo-gen-Si18Ge19 are higher than Vcen values on halogen-C37. Results show that, the Vcell values of studied structures were decreased as following: Li-halogen-C37 < Na-halo-gen-C37 < K-halogen-C37 < Li-halogen-Si18Ge19 < Na-hal-ogen-Si18Ge19 < K-halogen-Si18Ge19. So it can be concluded that K-F-Si18Ge19 and Li-Br-C37 have the highest and the lowest Vcell values, respectively.
Table 3. Calculated Vcell (V) values of studied complexes in water.
Complex	Vcell	Complex	Vcell
K-C38	1.71	K-Si^Ge^	1.97
Na-C38	1.53	Na-Si19Ge19	1.75
Li-C38	1.36	Li-Si^Ge^	1.56
K-F-C37	3.83	K-F-Si18Ge19	4.39
Na-F-C37	3.41	Na-F-Si18Ge19	3.92
Li-F-C37	3.04	Li-F-Si18Ge19	3.51
K-Cl-C37	3.61	K-Cl-Si18Ge19	4.16
Na-Cl-C37	3.24	Na-Cl-Si18Ge19	3.72
Li-Cl-C37	2.87	Li-Cl-Si18Ge19	3.33
K-Br-C37	3.41	K-Br-Si18Ge19	3.92
Na-Br-C37	3.04	Na-Br-Si18Ge19	3.51
Li-Br-C37	2.73	Li-Br-Si18Ge19	3.13
Finally, it can be concluded: (1) the halogen adoption of nanostructures increased the Vcell of studied metal-ion batteries ca 1.5-2.2 V; (2) the F-doped metal-ion batteries have higher Vcen than Cl- and Br-doped metal-ion batteries 0.3 and 0.6 V, respectively; (3) K-F-Si18Ge19 can
Table 3. Calculated EHOMO, ELUMO and EHLG (eV) values of studied complexes.
Complex	ehomo	elumo	ehlg	Complex	EHOMO	elumo	ehlg
K-C38	-4.09	-1.15	2.94	K-Si19Ge19	-3.78	-1.31	2.48
Na-C38	-4.20	-1.03	3.16	Na-Si19Ge19	-3.88	-1.17	2.72
Li-C38	-4.30	-0.92	3.38	Li-Si19Ge19	-3.98	-1.04	2.94
K-F-C37	-3.55	-2.58	0.96	K-F-Si18Ge19	-3.39	-2.78	0.62
Na-F-C37	-3.79	-2.31	1.48	Na-F-Si18Ge19	-3.50	-2.65	0.85
Li-F-C37	-4.02	-2.05	1.97	Li-F-Si18Ge19	-3.69	-2.35	1.34
K-Cl-C37	-3.67	-2.44	1.23	K-Cl-Si18Ge19	-3.47	-2.65	0.82
Na-Cl-C37	-3.90	-2.18	1.72	Na-Cl-Si18Ge19	-3.59	-2.50	1.09
Li-Cl-C37	-4.11	-1.95	2.17	Li-Cl-Si18Ge19	-3.78	-2.23	1.54
K-Br-C37	-3.79	-2.31	1.48	K-Br-Si18Ge19	-3.55	-2.54	1.01
Na-Br-C37	-4.02	-2.05	1.97	Na-Br-Si18Ge19	-3.69	-2.35	1.34
Li-Br-C37	-4.22	-1.83	2.38	Li-Br-Si18Ge19	-3.87	-2.10	1.77
be proposed as novel metal-ion batteries with highest performance.
3.3. Solvent Effects on Potential of Studied Metal-ion Batteries
In this section the effects of water as polar solvent on performance of C38, Si19Ge19, and their halogen-doped nanostructures as anode electrodes of metal-ion batteries via via DFT/ M06-2X theory, 6-311+G (2d, 2p) basis set and polarized continuum model (PCM) as solvent model were investigated.56-61 The calculated Vcen values of metal-ion batteries with C38, Si19Ge19, and their halogen-doped nano-structures as anode electrodes were presented in table 3.
Results show that, Vcen value of K-C38 is higher than Vcell values of Li-C38 and Na-C38 in water. Results display that Vcell values of Li, Na and K on S%Ge19 are higher than Vcell values on C38 in water. Results show that in water, Vcell value of K-halogen-C37 are higher than Vcen values of Li-halogen-C37 and Na-halogen-C37. Also Vcen value of K-halogen-Si18Ge19 are higher than Vcell values of Li-halo-gen-Si18Ge19 and Na-halogen-Si18Ge19 in water. Results display that Vcen values of Li, Na and K on halogen-Si18Ge19 are higher than Vcen values on halogen-C37 in water. Results show that, Vcell values of studied metal-ion batteries in water are higher than gas phase ca 0.46 V.
4. Conclusion
In this study, the potential of C38 and Si19Ge19 as anode electrode of Li-ion, Na-ion and K-ion batteries via density functional theory was investigated. Also the effects of halogen adoption of C38 and Si19Ge19 on ability of metal-ion battery were examined. Obtained results in preset paper are: (1) the Si19Ge19 as anode in metal-ion batteries has higher potential than C38 ca 0.18 V; (2) the KIB has higher Vcell and higher performance than NIB and KIB ca 0.15 and 0.31 V, respectively; (3) the halogen adoption increased the Vcell of studied metal-ion batteries ca 1.5-2.2 V; (4) the F-doped metal-ion batteries have higher Vcen and higher performance than Cl- and Br-doped metal-ion batteries; (5) K-F-Si18Ge19 can be proposed as novel metal-ion batteries with high performance; (6) Results show that, Vcen values of studied metal-ion batteries in water are higher than gas phase ca 0.46 V.
5. Acknowledgment
Thanks for all teachers.
6. References
1. M. D. Slater, D. Kim, E. Lee, C. S. Johnson, Adv. Funct. Mater.
2013, 23, 947-958. DOI:10.1002/adfm.201200691
2.	Z. Parsaee, P. Haratipour, M. Janghorban Lariche, A. Vojood, Ultrason. Sonochem. 2018, 41, 337-349.
DOI: 10.1016/j.ultsonch.2017.09.054
3.	J. Barker, M. Y. Saidi, J. L. Swoyer, Electrochem. Solid-State Lett. 2003, 6, 1-4. DOI:10.1149/1.1523691
4.	D. Er, J. Li, M. Naguib, ACS Appl. Mater. Interfaces 2014, 6, 11173-11179. DOI:10.1021/am501144q
5.	Z. Parsaee, P. Haratipour, M. J. Lariche, A. Vojood, Ultrason. Sonochem. 2018, 41, 337-349. DOI:10.1016/j.ultsonch.2017.09.054
6.	W. Gao, P. Haratipour, M. R. R. Kahkha, A. Tahvili, Ultrason. Sonochem. 2018, 44, 152-161. DOI:10.1016/j.ultsonch.2018.02.020
7.	V. Palomares, P. Serras, I. Villaluenga, Energy Environ. Sci. 2012, 5, 5884-5901. DOI:10.1039/c2ee02781j
8.	B. J. Landi, M. J. Ganter, C. D. Cress, Energy Environ. Sci. 2009, 2, 638-643. DOI:10.1039/b904116h
9.	A. A. Peyghan, Struct. Chem. 2012, 23, 1567-1572. DOI:10.1007/s11224-012-9970-9
10.	A. Rahimi, M. Sepehr, M. J. Lariche, M. Mesbah, A. Ka-saeipoor, E. H. Malekshah, Physica E: Low Dimens. Syst. Nano-struct. 2018, 97, 347-362. DOI:10.1016/j.physe.2017.12.003
11.	O. Baris, Malcioglu, S. Erkoc, J. Mol. Graphics Modell. 2005, 23, 367-371. DOI:10.1016/j.jmgm.2004.11.002
12.	Z. Bagheri, A. A. Peyghan, Comp. Theor. Chem. 2013, 1008, 20-26. DOI:10.1016/j.comptc.2012.12.011
13.	N. L. Hadipour, A. Ahmadi Peyghan, J. Phys. Chem. C 2015, 119, 6398-6404. DOI:10.1021/jp513019z
14.	A. Khataee, G. Bayat, J. Azamat, J. Mol. Graphics Modell. 2017, 71, 176-183. DOI:10.1016/j.jmgm.2016.11.017
15.	A. Afshar, M. Salami Hosseini, E. Behzadfar, Sci. Iran. Trans. C 2014, 21, 2107-2115.
16.	W. An, X. Wu, X. C. Zeng, J. Phys. Chem. C 2008, 112, 57475755. DOI:10.1021/jp711105d
17.	Z. Mahdavifar, J. Mol. Graphics Modell. 2014, 54, 32-45. DOI:10.1016/j.jmgm.2014.08.006
18.	J. Beheshtian, A. Ahmadi Peyghan, Physica E 2012, 44, 19631968. DOI:10.1016/j.physe.2012.06.003
19.	X. Wu, W. An, X. C. Zeng, J. Am. Chem. Soc. 2006, 128, 12001-12006 DOI:10.1021/ja063653+
20.	J. Beheshtian, Monatshefte für Chemie/Chemical Monthly 2012, 143, 1623-1626.
21.	H Guo, N Lu, J Dai, X Wu, XC Zeng, J. Phys. Chem. C 2014, 118, 14051-14059 DOI:10.1021/jp505257g
22.	J. Beheshtian, H. Soleymanabadi, Appl. Surf. Sci. 2012, 268, 436-441. DOI:10.1016/j.apsusc.2012.12.119
23.	P. Lu, X. Wu, W. Guo, X. C. Zeng, Phys. Chem. Chem. Phys. 2012, 14, 13035-13040. DOI:10.1039/c2cp42181j
24.	E. Vessally, S. Soleimani-Amiri, Appl. Surf. Sci. 2017, 396, 740-745. DOI:10.1016/j.apsusc.2016.11.019
25.	J. Beheshtian, A. A. Peyghan, Z. Bagheri, Appl. Surf. Sci. 2012, 258, 8980-8984. DOI:10.1016/j.apsusc.2012.05.134
26.	Y. Gao, N. Shao, Y. Pei, Z. Chen, X. C. Zeng, ACS nano 2011, 5, 7818-7829. DOI:10.1021/nn201817b
27.	A. A. Peyghan, M. Noei, M. B. Tabar, J. Mol. Model. 2013, 19, 3007-3014. DOI:10.1007/s00894-013-1832-x
28.	W. Zhou, J. Zhou, J. Shen, C. Ouyang, J. Phys. Chem. Solids
2012,	73, 245-251. D01:10.1016/j.jpcs.2011.10.035
29.	M. Jeong, T. Ahn, H. Nara, T. Momma, Nano Energy. 2016, 28, 51-62. D0I:10.1016/j.nanoen.2016.08.022
30.	Q. Jiang, Z. Zhang, S. Yin, Z. Guo, Appl. Surf. Sci. 2016, 379, 73-82. D0I:10.1016/j.apsusc.2016.03.204
31.	D. Shao, D. Tang, J. Yang, Y. Li, J. Power Sources 2015, 297, 344-350. D0I:10.1016/j.jpowsour.2015.08.037
32.	P. Subalakshmi, A. Sivashanmugam, J. Alloys Compd. 2017, 690, 523-531. D0I:10.1016/j.jallcom.2016.08.157
33.	B. Chen, S. Chu, R. Cai, S. Wei, R. Hu, Comput. Mater. Sci 2016, 123, 44-51. D0I:10.1016/j.commatsci.2016.06.007
34.	A. A. Peyghan, M. Noei, J. Mex. Chem. Soc. 2014, 58, 46-51.
35.	A. Gurung, R. Naderi, Electrochim. Acta 2016, 211, 720-725. D0I:10.1016/j.electacta.2016.06.065
36.	S. W. Lee, N. Yabuuchi, Nat. Nanotechnol. 2010, 5, 531-537. D0I:10.1038/nnano.2010.116
37.	M. Li, Y.-J. Liu, J.-x. Zhao, Appl. Surf. Sci. 2015, 345, 337-343. D0I:10.1016/j.apsusc.2015.03.144
38.	L. Qie, W. M. Chen, Z. H. Wang, Adv. Mater. 2012, 24, 20472050. D0I:10.1002/adma.201104634
39.	Z.-S. Wu, W. Ren, L. Xu, F. Li, ACS Nano 2011, 5, 5463-5471. D0I:10.1021/nn2006249
40.	Y. Liu, V. I. Artyukhov, M. Liu, J. Phys. Chem. Lett. 2013, 4, 1737-1742. D0I:10.1021/jz400491b
41.	R. P. Hardikar, D. Das, S. S. Han, Phys. Chem. Chem. Phys.
2014,	16, 16502-16508. D0I:10.1039/C4CP01412J
42.	A. A. Peyghan, M. Noei, S. Yourdkhani, Superlattices Micro-struct. 2013, 59, 115-122. D0I:10.1016/j.spmi.2013.04.005
43.	X. Ouyang, M. Lei, S. Shi, C. Luo, D. Liu, J. Alloys Compd. 2009, 476, 462-465. D0I:10.1016/j.jallcom.2008.09.028
44.	A. A. Peyghan, Z. Bagheri, Struct. Chem. 2013, 24, 1565-1570. D0I:10.1007/s11224-012-0189-6
45.	S. Shi, P. Lu, Z. Liu, Y. Qi, L.G. Hector, J. Am. Chem. Soc. 2012, 134, 15476-15487. D0I:10.1021/ja305366r
46.	A. A. Peyghan, A. Soltani, A. A. Pahlevani, Appl. Surf. Sci.
2013,	270, 25-32. D0I:10.1016/j.apsusc.2012.12.008
47.	S. Shi, C. Ouyang, M. Lei, W. Tang, J. Power Sources 2007, 171, 908-912. D0I:10.1016/j.jpowsour.2007.07.005
48.	A. Ahmadi, J. Beheshtian, M. Kamfiroozi, J. Mol. Model. 2012, 18, 1729-1734. D0I:10.1007/s00894-011-1202-5
49.	S. Shi, J. Gao, Y. Liu, Y. Zhao, Q. Wu, W. Ju, Chin. Phys. B
2015,	25, 018212.
D01:10.1088/1674-1056/25/1/018212
50.	A. Soltani, A. Ahmadi Peyghan, Z. Bagheri, Physica E 2013, 48, 176-180. D0I:10.1016/j.physe.2013.01.007
51.	L. Safari, E. Vessally, A. Bekhradnia, L. Edjlali, Thin Solid Films 2017, 623, 157-163. D0I:10.1016/j.tsf.2017.01.006
52.	A. A. Peyghan, M. T. Baei, M. Moghimi, Comp. Theor. Chem. 2012, 997, 63-69. D0I:10.1016/j.comptc.2012.07.037
53.	D. Golberg, Y. Bando, Y. Huang, ACS Nano 2010, 4, 29792993. D0I:10.1021/nn1006495
54.	X. Chen, P. Wu, M. Rousseas, D. Okawa, J. Am. Chem. Soc. 2009, 131, 890-891. D0I:10.1021/ja807334b
55.	M. Kamfiroozi, Z. Bagheri, Chin. J. Chem. Phys. 2012, 25, 60-64. D0I:10.1088/1674-0068/25/01/60-64
56.	Y. Zhao, D. G. Truhlar, Theor. Chem. Acc. 2008, 120, 215-241. D0I:10.1007/s00214-007-0310-x
57.	J. Andzelm, C. Kolmel, J. Chem. Phys. 1995, 103, 9312-9320. D01:10.1063/1.469990
58.	L. H. Gan, J. Q. Zhao, Physica E 2009, 41, 1249-1252. D0I:10.1016/j.physe.2009.02.014
59.	S. F. Boys, F. Bernardi, Mol. Phys. 1970, 19, 553-566. D01:10.1080/00268977000101561
60.	L. Ma, J. M. Zhang, K. W. Xu, V. Ji, Appl. Surf. Sci. 2015, 343, 121-127. D0I:10.1016/j.apsusc.2015.03.068
61.	J. Beheshtian, H. Soleymanabadi, J. Mol. Model. 2012, 18, 2343-2348. D01:10.1007/s00894-011-1256-4
62.	Z. Bagheri, M. Kamfiroozi, Struct. Chem. 2012, 23, 653-657. D0I:10.1007/s11224-011-9911-z
63.	A. A. Peyghan, Z. Bagheri, Comput. Mater. Sci. 2012, 62, 7174. D0I:10.1016/j.commatsci.2012.05.041
64.	R. R. Q. Freitas, G. K. Gueorguiev, Chem. Phys. Lett. 2013, 583, 119-124. D0I:10.1016/j.cplett.2013.07.077
65.	M. T. Baei, A. A. Peyghan, Z. Bagheri, Chin. Chem. Lett. 2012, 23, 965-968. D0I:10.1016/j.cclet.2012.06.027
66.	M. Baei, H. Mohammadian, Bulg. Chem. Commun 2014, 46, 735-742.
67.	J. Beheshtian, Z. Bagheri, M. Kamfiroozi, J. Mol. Model. 2011, 42, 1400-1403.
68.	J. Beheshtian, Z. Bagheri, M. Kamfiroozi, J. Mol. Model. 2012, 18, 2653-2658. D0I:10.1007/s00894-011-1286-y
69.	J. Hosseini, A. Rastgou, R. Moradi, J. Mol. Liq. 2017, 225, 913-918. D0I:10.1016/j.molliq.2016.11.025
70.	L. Saw, Y. Ye, A. Tay, Appl. Therm. Eng. 2014, 73, 154-161. D0I:10.1016/j.applthermaleng.2014.06.061
71.	M. Eslami, V. Vahabi, A. A. Peyghan, Physica E, 2016,76, 6-11. D0I:10.1016/j.physe.2015.09.043
72.	M. Samadizadeh, S. F. Rastegar, A. A. Peyghan, Physica E, 2015, 69, 75-80. D0I:10.1016/j.physe.2015.01.021
73.	J . Hosseini, A. Rastgou, R. Moradi, J. Mol. Liq. 2017, 225, 913-918. D0I:10.1016/j.molliq.2016.11.025
74.	M. Najafi M, Can. J. Chem. 2017, 95. 687-690. D0I:10.1139/cjc-2017-0070
75.	K. Nejati, A. Hosseinian, A. Bekhradnia, E. Vessally, J. Mol. Graph. Mod. 2017, 74, 1-7. D0I:10.1016/j.jmgm.2017.03.001
76.	A. Hosseinian, S. Soleimani, S. Arshadi, E. Vessally, Phys. Lett. A 2017, 381, 2010-2015. D0I:10.1016/j.physleta.2017.04.022
77.	T. H. Dunning, J. Phys. Chem. A 2000, 104, 9062-9065. D0I:10.1021/jp001507z
78.	V. G. Ruiz, W. Liu, E. Zojer, A. Tkatchenko, Phys. Rev. Lett. 2012, 108, 146103-146107.
D01:10.1103/PhysRevLett.108.146103
79.	Y. Zhao, D. G. Truhlar, Theor. Chem. Account2008, 120, 215218. D0I:10.1007/s00214-007-0310-x
80.	A. Mahmood, R. L. Longo, Phys. Chem. Chem. Phys. 2014, 87, 1-7.
81.	S. E. Wheeler, A. Moran, S. Pieniazek, K. Houk, J. Phys. Chem. A 2009, 113, 10376-10381. D0I:10.1021/jp9058565
82.	E. G. Hohenstein, S. T. Chill, C. D. Sherrill, J. Chem. Theory Comput. 2008, 4, 1996-22001. D0I:10.1021/ct800308k
Povzetek
S teoretičnimi raziskavami na podlagi teorije gostotnega potenciala (DFT) smo preučevali C38 in Si19Ge19 kot materiala, ki bi lahko bila primerena za anode v litij-ionskih, natrij-ionskih in kalij-ionskih baterijah. Dobljeni rezultati so pokazali, da ima Si19Ge19 kot anoda v baterijah za približno 0.18 V višji potencial kot C38. Rezultati kalulacij tudi kažejo, da ima kalij-ionska baterija višjo napetost celice kot litij-ionska baterija (približno 0,15 V) in kaliji-ionska baterija (približno 0,31 V). Dodatek halogena naj bi povečal napetost celice v primerih preučevanih baterij za 1,5 do 2,2 V. Izračunana napetost celice v preučevanih sistemih je za približno 0,46 V višja v vodnem mediju kot v plinski fazi. Glede na rezultate kalkulacij v tem sistemu lahko zaključimo, da dodatek fluora v nanokletke Si18Ge19 v kalij-ionskih baterijah najbolj izboljša lastnosti baterije in bi ga lahko predlagali kot nov material na tem področju.
DOI: I0.i7344/acsi.20i7.3953	Acta Chim. Slov. 2018, 65, 312-318	©commohs
Scientific paper
Effect of Copper Alloying on Electro-Catalytic Activity of Nickel for Ethanol Oxidation in Alkaline Media
Niloufar Bahrami Panah,1^ Iman Danaee,2 Mahmood Payehghadr1
and Afrooz Madahi1
1Department of Chemistry, Payame Noor University, P.O.BOX 19395-3697, Tehran, Iran
2Abadan Faculty of Petroleum Engineering, Petroleum University of Technology, Abadan, Iran
* Corresponding author: E-mail: bahramipanah@pnu.ac.ir Tel.: +982634209515 Fax: +982634209525
Received: 03-11-2017
Abstract
In this research, the electro-catalytic activity of nickel-copper (Ni-Cu) alloy towards oxidation of ethanol and its possible redox process were investigated in alkaline solution. For this purpose, cyclic voltammetry, chronoamperometry and electrochemical impedance spectroscopy techniques were employed. According to the cyclic voltammetry studies, Ni-Cu alloy compared to pure nickel can demonstrate a significantly higher response for ethanol oxidation. So, the enhancement of the anodic peak current corresponding to the oxidation of nickel hydroxide was accompanied with attenuated cathodic current in the presence of ethanol. The anodic peak currents have a linearly dependence on the square root of scan rate which is the characteristic of diffusion-controlled processes. Based on the chronoamperometry measurements, the reaction exhibited a Cottrellian behavior and the diffusion coefficient of ethanol was found to be 1.26 x 10-5 cm2 s-1. The impedance spectroscopy declared electro-catalytic behavior of Ni-Cu electrode for oxidation of ethanol and showed that the charge transfer resistance decreases by increasing the ethanol concentration.
Keywords: Electro-catalytic activity; nickel-copper alloy; ethanol; impedance
1. Introduction
Recently, direct ethanol fuel cells (DEFCs) have attracted much interest for different applications.1,2 The reason is that they can provide convenient operation, storage and distribution. However, DEFCs require further development compared to hydrogen based fuel cells.3 One of the unresolved problems of DEFCs is slow anodic rate of ethanol oxidation.4 In this respect, considerable researches have been devoted to study ethanol electro-oxidation at high pH values. Utilizing alkaline solution has many advantages in fuel cells. For example, it can enhance fuel cell efficiency, reduce corrosion, enable the application of many electrode materials, promote efficiency of the processes occured at both anode and cathode, eliminate sensitivity to the surface structure and decrease poisoning effects.5-8
In electrochemical oxidation of ethanol, selection of an appropriate material for the anode is very crucial for obtaining an electro-catalyst of high efficiency. Some studies have reported a significant increase in fuel utilization
and power density through optimizing different factors related to fuel cells.9,10 For the electrode, different materials have been employed to catalyze the electrochemical oxidation of ethanol.11,12 One of the well-established electrode materials is nickel which poses proper surface oxidation properties. Nickel and its complexes have been commonly applied in electro-catalysis to proceed both anodic and cathodic reactions in water electrolysis and organic synthesis.13-17 One of the remarkable applications of nickel is catalyzing the ethanol oxidation. Several studies regarding to electro-oxidation of alcohols on nickel electrode have
been reported.18-20
For obtaining a synergistic electro-catalytic system, the nickel alloys specifically nickel-copper can be used.21-23 In addition, alloy electrodes compared to other electro-catalysts can offer further advantages such as long-term stability and ease of preparation. The crystal structures of pure Ni and Cu metals are similar and they possess face-centered cubic structures with similar lattice parameters. Therefore, it is possible to make a wide range of Ni-Cu alloy ratios.24-27
The aim of present work is to study the electrochemical oxidation of ethanol on Ni-Cu alloy (70/30) electrode in alkaline solution and compare its catalytic activity with pure Ni electrode via electrochemical techniques of cyclic voltammetry, chronoamperometry and impedance spectroscopy.
2. Experimental
All chemicals used in this work [Sodium hydroxide and ethanol in analytical grade] were of Merck origin (Germany) and used without further purification. Double distilled water was employed to prepare the solutions. Nickel and nickel-copper alloy were prepared from Rooy-ingran Sanaat Company. The electrochemical measurements were carried out in a one-compartment three-electrode cell powered by a Metrohm-Autolab potentiostat/ galvanostat (model 12/30/302, The Netherlands). The disk of Ni-Cu alloy (70/30) of 1 cm2 area was employed as working electrode. Before each measurement, the electrode was polished with emery paper of 1000 grit and rinsed in double distilled water and acetone. Counter and reference electrodes were platinum and KCl-saturated Ag/ AgCl electrode (Metrohm, The Netherlands), respectively. All the electrochemical studies were done at 22 ± 1 °C.
The electrochemical impedance experiments were carried out in a frequency range of 100 kHz to 10 mHz and modulation amplitude of 10 mV with respect to open circuit potential. The experimental impedance spectrosco-py data were fitted to the proposed equivalent circuit using a home written least square software. This software was programmed according to the method of Marquardt for optimization of functions and Macdonald weighting for the real and imaginary parts of the experimental impedance data.28,29
3. Results and Discussion
Figure 1 displays consecutive cyclic voltammograms of the Ni-Cu electrode in 1 M NaOH solution recorded after 50 cycles at scan rate of 100 mV s-1. Upon the first scan, a pair of redox peak is observed at 463 and 295 mV which is attributed to the Ni2+/Ni3+ redox couple. In the subsequent cycles, the anodic and cathodic peaks shift to the negative direction and stabilize at 378 and 310 mV, respectively. This behavior is consistent with the data reported in previous electrochemical studies related to formation of the nickel oxide film on the surface and inter-conversion of a-Ni(OH)2 and 6-phases, conversion of Ni(OH)2 to NiOOH and enrichment of Ni3+ species around the surface of the electrode.30,31 During the next cycles, a negative shift of the anodic peak and its stabilization are evident, which refer to higher potential energies required for NiO-OH nucleation. In the first cycle, the baseline current is
higher which corresponds to the oxidation of Ni to Ni2+. An increase in peak currents with the number of cycles demonstrates a continuous enrichment of electrode's surface by accessible Ni2+ and Ni3+electro-active species. Figure 2 shows the cyclic voltammograms of the Ni, Cu and Ni-Cu electrode in 1 M NaOH solution recorded at scan rate of 10 mV s-1. As can be seen, the oxidation behavior of Ni and Ni-Cu electrode is the same and the Ni2+/Ni3+ redox couple is observed. No considerable anodic peak for Cu3+ is shown in cyclic voltammogram of Cu electrode, but the cathodic peak is clear in inset of Figure 2.
0000IS -
-00W15--.-,-1-,-i-
0	01	D_3	0 3	04	0 5	oe
EIV
Figure 1. Consecutive cyclic voltammogram of Ni-Cu electrode oxidation in 1 M NaOH (1) first and (2) fiftieth cycle at a scan rate of 100 mV s-1.
-D.0001 -,-,-,-r-
0	0.2	04	0.6	0 8
E/V
Figure 2. Cyclic voltammogram of (1) Ni, (2) Cu and (3) Ni-Cu electrode oxidation in 1 M NaOH at a scan rate of10 mV s-1. Unset: Cyclic voltammogram of Cu electrode in the potential range of 0.45 and 0.65 V.
Figure 3 a illustrates the typical cyclic voltammograms of a Ni-Cu electrode at various scan rates (2-2500 mV s-1) in 1 M NaOH solution. Figure 3b shows that the anodic peak currents increase proportional to the lower
scan rate values (2-200 mV s-1). This behavior is expected for the electrochemical activity of redox couples that their voltammetric responses are sensitive to the low concentration of surface-confined electro-active species.32 In this process, only the nickel oxide layer produced on electrode surface participates in the redox reaction.33 Surface coverage of the redox species, T*, can be calculated according to the slope of the lines shown in Figure 3b:33
(1)
where Ip, n, and v is peak current, electron transfer number and potential scan rate, respectively. The T* value is calculated to be about 8.15 x 10-8 mol cm-2 which is related to the presence of ca. 80 monolayers of surface species on Ni-Cu electrode. Figure 3c presents the proportionality of anodic peak current to square root values of higher scan rates (350-2500 mV s-1). It shows that the oxidation reaction is a diffusion-controlled process at higher scan rate33 and the reaction is limited by diffusion of hydroxide ion from bulk of solution to the electrode surface according to following equation:
Ni{OTT)2 + Oil <->NiOOH-H;Q-e
(2)
Figure 3. (a) Typical cyclic voltammograms of Ni-Cu electrode in 1 M NaOH at different scan rates of 2-2500 mV s-1, (b) The dependency of anodic peak currents to the scan rate at lower values (2-200 mV s-1), (c) The proportionality of anodic peak currents to the square roots of scan rate at higher values (350-2500 mV s-1).
Figure 4 depicts cyclic voltammograms of pure Ni, pure Cu and Ni-Cu electrodes in 1 M NaOH solution containing 0.5 M ethanol at scan rate of 10 mV s-1. As seen, Ni-Cu electrode provides a higher current density for ethanol electro-oxidation in alkaline solution. The reason can be related to higher atomic radius of Cu compared to Ni which can enhance ethanol adsorption on the electrode surface. Furthermore, electro-catalytic activity of Cu elec-
trode is high for ethanol oxidation, but it is at higher anodic over-potentials. As it can be seen, the measured anodic potentials of Ni-Cu and Ni electrodes are the same, but the anodic peak current of Ni-Cu is higher than that in Ni electrode. Consequently, the high electro-catalytic activity of Cu electrode is responsible for electro-catalytic activity of Ni-Cu electrode.
Figure 4. Cyclic voltammograms in the (1) absence and (2) presence of 0.5 M ethanol on Ni, (3) Ni-Cu (4) Cu electrode in 1 M NaOH solution. Scan rate: 10 mV s-1.
Figure 5a exhibits the cyclic voltammograms of Ni-Cu electrode in a solution of 1 M NaOH and different concentrations of ethanol at scan rate of 10 mV s-1. It is declared that the oxidation of ethanol on Ni-Cu electrode has a typical electro-catalytic response. The anodic current increases around the potential of 350 mV. The oxidation of ethanol and Ni2+ oxidation to Ni3+ starts simultaneously. The anodic to cathodic charge ratio in the presence of 0.5 M ethanol is obtained to be 92/8 while it is 55/45 in the absence of ethanol. The charge values are calculated through integrating the background corrected anodic and cathodic peaks.
In the positive sweep, the measured anodic current is proportional to the bulk concentration of ethanol. An increase in ethanol concentration up to 0.6 M caused a linear increase in the anodic current (Figure 5b). Based on these evidences, catalytic electro-oxidation of ethanol on Ni-Cu electrode is confirmed. Zhang et al. investigated the ethanol oxidation on Ni-B amorphous alloy nanoparticles modified nanoporous Cu in alkaline me-dium.34 They reported that ethanol oxidation at the Ni-B modified porous Cu electrode had a negative shift of 52 mV in the onset oxidation potential and the oxidation peak current increased in comparison with the bulk Ni. Kakaei and Marzang studied the electro-catalytic activity of nitrogen doped reduced graphene oxide with Ni-Co nanoparticles for ethanol oxidation in alkaline media.35 The fabricated alloy electro-catlyst exhibited a remark-
Figure 5. (a) Cyclic voltammograms of the Ni-Cu electrode in 1 M NaOH solution in the presence of (1) 0.1, (2) 0.2, (3) 0.3, (4) 0.4, (5) 0.5, (6) 0.6, (7) 0.7, (8) 0.8, (9) 0.9 and (10) 1 M of ethanol. Scan rate: 10 mV s-1. (b) Dependency of the anodic peak current on the concentration of ethanol.
able electro-catalytic activity and high stability for the ethanol oxidation reaction in comparison with fabricated Ni and Co.
The decrease in cathodic current that occurs in the negative potential scan verifies the involvement of ethanol in the rate determining step. It also indicates that the process is incapable of reducing all high-valence nickel species that have formed in the anodic half cycle. Along with the oxidation of Ni2+species to Ni3+, the adsorbed ethanol molecules oxidize on the surface at higher over-potentials. The products or intermediates of the reaction poison the electrode surface and reduces the number of available sites for ethanol adsorption. Consequently, the anodic current approaches a maximum in the positive potential scan and then the overall rate of ethanol oxidation decreases. Electro-catalytic oxidation of ethanol also continues in the early stages of the cathodic half cycle and the current tends to a maximum since some active sites for adsorption of ethanol regenerate due to removal of the adsorbed intermediates and products.
Figure 6 shows the cyclic voltammograms of Ni-Cu electrode in the presence of 0.5 M ethanol at various potential scan rates (2-350 mV s-1) and also the scan rate proportionality of the anodic peak current. The anodic peak potential appears at 0.5 V as a result of ethanol oxidation on the nickel active sites. The variation of anodic peak current vs. the square root of scan rate values shows a linear relationship which represents that the oxidation of ethanol on Ni-Cu electrode is controlled by diffusion of ethanol species from solution to the redox sites accessible on the electrode's surface (Figure 6b). Although, the cathodic peak of Ni3+ reduction is negligible at low scan rates, but it appears at higher scan rates. This observation implies that the electro-oxidation of nickel species is much faster than catalytic oxidation of ethanol at higher scan rates. Therefore, oxidation of ethanol on nickel surface is a slow process.
Figure 6. (a) Typical cyclic voltammograms of the Ni-Cu in 1 M NaOH in the presence of 0.5 M ethanol at various scan rates of 2, 5, 10, 20, 30, 40, 50, 75, 100, 200 and 350 mV s-1. (b) Dependence of anodic peak current at 530 mV on the square root of scan rate. (c) Dependence of anodic peak current at 370 mV on the scan rate.
At higher scan rates, the oxidation peak of Ni(OH)2 to NiOOH rises at potentials that are considerably more negative than the potential of ethanol oxidation (« 370 mV). This peak is insignificant at low scan rates but enhances at higher scan rate values. Figure 6c illustrates a linear dependency of the current peak on the scan rate which proposes the presence of surface-confined electro-active species. According to the high current density observed in the presence of ethanol and also the appearance of two oxidation peaks for Ni2+ and ethanol, it is appeared that one of the anodic current can be attributed to the oxidation of ethanol by NiOOH since the NiOOH reduction peak disappears during the negative scan. The other one can be assigned to the direct electro-oxidation of ethanol on the surface of the oxide layer.
The following redox reaction of the nickel species is expected:
Ni(II) ^ Ni(III) + e
(3)
while ethanol oxidizes on the alloy surface through the following reaction 23,36,37:
Ni3+ + ethanol ^ Ni2++ intermediate
Ni3+ + intermediate ^ Ni2++ product
(4)
(5)
In Eqs. (4) and (5), ethanol oxidation occurs through the reduction of NiOOH sites. The Ni3+ sites can be regenerated by the power source or via direct electro-oxidation on Ni3+ oxide surface as follows:
Ni3+ -ethanol ^ Ni3+-intermediate + e	(6)
Ni3+ -intermediate ^ Ni3+-product + e	(7)
In Eqs. (6) and (7), Ni3+ provides an active site for direct ethanol oxidation. Also, Eqs. (3), (6) and (7) refer to two anodic peaks of ethanol and Ni2+ oxidation.
Figure 7a displays the chronoamperograms recorded for Ni-Cu in 1 M NaOH solution containing (0.1-0.8 M) ethanol at the potential step of 500 mV. Figure 7b identifies a linear behavior of the net current changes (after elimination of the background current) vs. the inverse square root of time. So, a diffusion-controlled process is dominant in this electrochemical process. The diffusion coefficient of ethanol is calculated 1.26 x 10-5 cm2 s-1 by substitution of the line slope of Figure 7b into Cottrell equation33 (Eq. 8).
I = nFAD1/2Cn -1/2t-1/2
(8)
The catalytic rate constant of ethanol oxidation on Ni-Cu alloy is evaluated according to Eq. (9) which is introduced by Pariente et al.:38
(9)
Where Icatai and Id stand for Ni-Cu electrode currents in the presence and absence of ethanol, respectively. y = kCt is the related error function in which k is the catalytic rate constant, C is the bulk concentration of ethanol and t is the elapsed time. When y)1.5, erf (y1/2) equals to unity approximately and Eq. (9) simplifies to:
(10)
Based on the slope of Icatai /Id vs. t1/2 plot, the obtained mean catalytic rate constant was 865.5 cm3 mol-1 s-1 for ethanol concentration of 0.1-0.8 M (Figure 7c).
Figure 7. (a) Chronoamperograms of Ni-Cu electrode in 1 M NaOH solution with different concentration of ethanol: (1) blank, (2) 0.1, (3) 0.2, (4) 0.3, (5) 0.4, (6) 0.5, (7) 0.6, (8) 0.7 and (9) 0.8 M at potential step of 500 mV. (b) Dependency of transient current on t-1/2. (c) Dependence of Icatai /Id vs. t1/2 derived from the data of chronoamperograms.
Figure 8 represents the Nyquist diagrams of Ni-Cu electrode recorded at the anodic peak potential as the dc-offset in 1 M NaOH solution containing different concentration of ethanol. These diagrams contain two depressed semicircles that are overlapped. The high frequency depressed semicircle corresponds to a combination of a charge transfer resistance and the double layer capacitance and the low frequency semicircle can be due to the adsorption of reaction intermediate on the surface of Ni-Cu electrode.39,40
Figure 8. Nyquist diagrams of Ni-Cu electrode in 1 M NaOH solution containing different concentration of ethanol at an anodic potential of 500 mV. Inset: high frequency part of the Nyquist diagram.
Figure 9 shows the equivalent circuit in the presence of ethanol which is compatible with Nyquist diagram. The capacitor C should be replaced with a constant phase element (CPE), Q, in the equivalent circuit. The CPE behavior is due to the microscopic roughness of the electrode that causes an inhomogeneous distribution in the solution resistance and the double-layer capacitance.41,42 In Figure 9, Rs, Qdi and Rct are solution resistance, a constant phase
Figure 9. Equivalent circuit compatible with the experimental impedance data in Figures 8 for ethanol electro-oxidation on Ni-Cu electrode.
Table 1. Equivalent circuit parameters of electro-oxidation of ethanol on Ni-Cu electrode in 1 M NaOH solution.
Concentration / M	Rs / n	Rct / n	Qdl / F	ni	Rads / n	Qads / F	n2
0.1	11.9	105	0.0018	0.79	4224	0.008	0.9
0.2	11.5	78	0.0024	0.79	1671	0.018	0.75
0.3	11.7	45	0.0026	0.77	361	0.018	0.68
0.4	10.3	21	0.0025	0.67	274	0.02	0.56
0.5	10.5	19	0.003	0.66	196	0.025	0.58
0.6	10.9	18	0.003	0.67	181	0.03	0.57
element related to the double layer capacitance and charge transfer resistance, respectively. Also, Qads and Rads are the electrical elements corresponding to the adsorption of reaction intermediates.
The experimental data were fitted to the equivalent circuit to obtain the circuit elements. Table 1 represents the equivalent circuit parameters for the impedance spectra of ethanol electro-oxidation. The charge transfer resistance value decreases as the ethanol concentration increases. It approves the catalytic activity of Ni-Cu alloy for ethanol oxidation. n1 and n2 are the constant phase element exponent and show the extent of difference between capacitance and the constant phase element.
4. Conclusions
In this study, the electro-oxidation of ethanol was investigated on the nickel oxide film formed on the surface of Ni-Cu alloy electrode in an alkaline solution. The results confirmed that Ni-Cu alloy is electro-catalytically active for ethanol oxidation at a potential of ~ 500 mV. The catalytic response obtained for electro-oxidation of ethanol on Ni-Cu electrode is greater than the one observed for pure nickel. The anodic peak currents for ethanol oxidation are linearly proportional to square root of scan rates. The chronoamperograms revealed the dominance of a diffusion-controlled process in presence of ethanol species. The diffusion coefficient of ethanol was calculated 1.26 x 10-5 cm2 s-1. The charge transfer resistance for various concentrations of ethanol was evaluated and highlighted an effective catalytic activity of Ni-Cu alloy for oxidation of ethanol in alkaline solutions.
5. References
1.	Y. Li, Z. Wang, X. Li, T. Yin, K. Bian, F. Gao, D. Gao, J. Power Sources 2017, 341, 183-191. D01:10.1016/j.jpowsour.2016.12.006
2.	Q. Zhang, F. Zhang, X. Ma, Y. Zheng, S. Hou, J. Power Sources 2016, 336, 1-7. D0I:10.1016/j.jpowsour.2016.10.028
3.	Z. Xiong, B. Yan, K. Zhang, C. Wang, S. Li, H. Xu, Y. Du, C. Zhai, J. Taiwan Inst. Chem. E. 2017, 75, 12-17.
D01:10.1016/j.jtice.2017.03.008
4.	Y. Xie, H. Zhang, G. Yao, S. A. Khan, X. Cui, M. Gao, Y. Lin, J. Energy Chem. 2017, 26, 193-199. D0I:10.1016/j.jechem.2016.11.014
5.	J. L. Tan, A. M. De Jesus, S. L. Chua, J. Sanetuntikul, S. Shan-mugam, B. J. V. Tongol, H. Kim, Appl. Catal. A- Gen. 2017, 531, 29-35. D0I:10.1016/j.apcata.2016.11.034
6.	C. Peng, W. Yang, E. Wu, Y. Ma, Y. Zheng, Y. Nie, H. Zhang, J. Xu, J. Alloy Compd. 2017, 698, 250-258. D0I:10.1016/j.jallcom.2016.12.198
7.	Y. H. Qin, Z. Y. Xiong, J. Ma, L. Yang, Z. Wu, W. Feng, T. L. Wang, W. G. Wang, C. W. Wang, Int. J. Hydrogen Energ. 2017, 42, 1103-1112. D0I:10.1016/j.ijhydene.2016.09.060
8.	T. Li, G. Fu, J. Su, Y. Wang, Y. Lu, X. Zou, X. Zhu, L. Xu, D. Sun, Y. Tang, Electrochim. Acta 2017, 231, 13-19. D0I:10.1016/j.electacta.2017.02.044
9.	X. Hu, C. Lin, L. Wei, C. Hong, Y. Zhang, N. Zhuang, Electrochim. Acta 2016, 187, 560-566. D0I:10.1016/j.electacta.2015.11.100
10.	C. Du, X. Gao, Z. Zhuang, C. Cheng, F. Zheng, X. Li, W. Chen, Electrochim. Acta 2017, 238, 263-268. D0I:10.1016/j.electacta.2017.03.198
11.	P. Kanninen, N. D. Luong, L. H. Sinh, J. Florez-Montano, H. Jiang, E. Pastor, J. Seppälä, T. Kallio, Electrochim. Acta 2017, 242, 315-326. D0I:10.1016/j.electacta.2017.05.019
12.	K. Ding, P. Wang, J. Zhao, Y. Li, Y. Chen, Y. Zhang, B. Wei, Y. Sun, J. Pan, Int. J. Hydrogen Energ. 2017, 42, 9766-9774. D0I:10.1016/j.ijhydene.2017.01.210
13.	I. Danaee, M. Jafarian, F. Forouzandeh, F. Gobal, Int. J. Chem. Kinet. 2012, 44, 712-721. D0I:10.1002/kin.20721
14.	J. Guo, Y. Hou, B. Li, E. Duan, Mater. Lett. 2017, 200, 90-93. D01:10.1016/j.matlet.2017.04.111
15.	I. Danaee, M. Jafarian, M. Sharafi, F. Gobal, J. Electrochem. Sci. Technol. 2012, 3, 50-56. D0I:10.5229/JECST.2012.3.1.50
16.	W. Shi, Q. Wang, F. Qin, J. Yu, M. Jia, H. Gao, Y. Zhang, Y. Zhao, G. Li, Electrochim. Acta 2017, 232, 332-338. D0I:10.1016/j.electacta.2017.02.164
17.	W. Shi, H. Gao, J. Yu, M. Jia, T. Dai, Y. Zhao, J. Xu, G. Li, Elec-trochim. Acta 2016, 220, 486-492. D0I:10.1016/j.electacta.2016.10.051
18.	S. J. Zhang, Y. X. Zheng, L. S. Yuan, L. H. Zhao, J. Power Sources 2014, 247, 428-436. D0I:10.1016/j.jpowsour.2013.08.129
19.	N. A. M. Barakat, H. M. Moustafa, M. M. Nassar, M. A. Ab-
delkareem, M.S. Mahmoud, A. A. Almajid, K. A. Khalil, Elec-trochim. Acta 2015, 182, 143-155. DOI:10.1016/j.electacta.2015.09.079
20.	K. Kakaei, K. Marzang, J. Colloid Interf. Sci. 2016, 462, 148153. DOI:10.1016/j.jcis.2015.09.072
21.	I. Pötzelberger, A. I. Mardare, A. W. Hassel, Appl. Surf. Sci. 2017, 417, 48-53. DOI:10.1016/j.apsusc.2016.12.193
22.	I. Danaee, M. Jafarian, F. Forouzandeh, F. Gobal, M. G. Mah-jani, Int. J. Hydrogen Energy 2008, 33, 4367-4376. DOI:10.1016/j.ijhydene.2008.05.075
23.	I. Danaee, M. Jafarian, F. Forouzandeh, F. Gobal, M. G. Mah-jani, Int. J. Hydrogen Energy 2009, 34, 859-869. DOI:10.1016/j.ijhydene.2008.10.067
24.	M. Jafarian, T. Rostami, M. G. Mahjani, F. Gobal, J. Electro-anal. Chem. 2016, 763, 134-140. DOI:10.1016/j.jelechem.2015.12.031
25.	S. J. Zhang, Y. X. Zheng, L. S. Yuan, L. H. Zhao, J. Power Sources 2014, 247, 428-436. DOI:10.1016/j.jpowsour.2013.08.129
26.	L. Wang, X. Lu, Y. Ye, L. Sun, Y. Song, Electrochim.Acta 2013, 114, 484-493. DOI:10.1016/j.electacta.2013.10.125
27.	X. Tarrüs, M. Montiel, E. Valles, E. Gomez, Int. J. Hydrogen Energ. 2014, 39, 6705-6713. DOI:10.1016/j.ijhydene.2014.02.057
28.	J. R. Macdonald, Solid State Ionics 1984, 13, 147-149. DOI: 10.1016/0167-2738(84)90049-3
29.	I. Danaee, S. Noori, Int. J. Hydrogen Energ. 2011, 36, 1210212111. DOI:10.1016/j.ijhydene.2011.06.106
30.	F. Hahn, B. Beden, M. J. Croissant, C. Lamy, Electrochim. Acta 1986, 31, 335. DOI:10.1016/0013-4686(86)80087-1
31.	A. A. El-Shafei, J. Electroanal. Chem. 1999, 471, 89-95. DOI:10.1016/S0022-0728(99)00235-1
32.	R. Barnard, C. F. Randell, J. Appl. Electrochem. 1983, 13, 8995. DOI:10.1007/BF00615892
33.	A. J. Bard, L. R. Faulkner (Ed.): Electrochemical Methods: Fundamentals and Applications, Wiley, New York, 2001, pp. 591.
34.	S. J. Zhang, Y. X. Zheng, L. S. Yuan, L. H. Zhao, J. Power Sources 2014, 247, 428-436. DOI:10.1016/j.jpowsour.2013.08.129
35.	K. Kakaei, K. Marzang, J. Colloid Interf. Sci. 2016, 462, 148153. DOI:10.1016/j.jcis.2015.09.072
36.	I. Danaee, M. Jafarian, F. Forouzandeh, F. Gobal, M.G. Mahjani, Electrochim. Acta 2008, 53, 6602-6609. DOI:10.1016/j.electacta.2008.04.042
37.	I. Danaee, M. Jafarian, F. Forouzandeh, F. Gobal, M.G. Mahjani, J. Phys. Chem. B 2008, 112, 15933-15940. DOI:10.1021/jp8069173
38.	F. Pariente, E. Lorenzo, F. Tobalina, H. D. Abruna, Anal. Chem. 1995, 67, 3936-3944. DOI:10.1021/ac00117a019
39.	I. Danaee, M. Jafarian, F. Gobal, M. Sharafi, M. G. Mahjani, Chem. Res. Chinese U. 2012, 28, 19-25.
40.	M. Jafarian, A. Mirzapoor, I. Danaee, A. A. Shahnazi San-gachin, F. Gobal, Sci. China Chem. 2012, 55, 1819-1824. DOI:10.1007/s11426-012-4731-6
41.	H. Jafari, I. Danaee, H. Eskandari, M. Rashvand Avei, J. Mater. Sci. Technol. 2014, 30, 239-252. DOI:10.1016/j.jmst.2014.01.003
42.	A. R. Hosein Zadeh, I. Danaee, M. H. Maddahy, J. Mater. Sci. Technol. 2013, 29, 884-892. DOI:10.1016/j.jmst.2013.06.006
Povzetek
V tej raziskavi smo v alkalni raztopini raziskali elektrokatalitsko aktivnost elektrode iz zlitine nikelj-baker (Ni-Cu) za oksidacijo etanola in njegovega morebitnega procesa redukcije. V ta namen smo uporabili ciklično voltametrijo, krono-amperometrijo in tehniko elektrokemijske impedančne spektroskopije. Rezultati študije ciklične voltametrije kažejo na povečano oksidacijo etanola v primeru uporabe zlitine Ni-Cu v primerjavi z uporabo samo nikljeve elektrode. Povečanje anodnega vrha, ki ustreza oksidaciji nikljevega hidroksida, spremlja zmanjšan katodni vrh v prisotnosti etanola. Anodni vrhovi imajo linearno odvisnost od kvadratnega korena stopnje skeniranja, ki je značilna za difuzijsko nadzorovane procese. Na osnovi kronoamperometričnih meritev je reakcija pokazala Cottrellianovo vedenje, difuzijski koeficient etanola pa je bil 1,26 x 10-5 cm2 s-1. S pomočjo impedančne spektroskopije smo prikazali elektrokatalitsko aktivnost elektrode Ni-Cu v primeru oksidacije etanola in pokazali, da se upornost napram prenosu naboja zmanjša s povečanjem koncentracije etanola.
DOI: 10.17344/acsi.2017.3988
Acta Chim. Slov. 2018, 65, 319-327
Scientific paper
Solvothermal Synthesis of ZnO-Nitrogen Doped Graphene Composite and its Application as Catalyst for Photodegradation of Organic Dye Methylene Blue
Rajinder Singh, Manesh Kumar, Heena Khajuria, Jigmet Ladol, and Haq Nawaz Sheikh*
Department of Chemistry, University of Jammu, Jammu Tawi, 180 006 India. * Corresponding author: E-mail: hnsheikh@rediffmail.com Received: 10-11-2017
Abstract
A facile one step solvothermal method is designed for the synthesis of visible light-sensitive ZnO-nitrogen doped graphene (ZNG) nano photocatalysts using ethylene glycol as a solvent as well as an agent to prevent aggregation of graphene layers. The deposition of ZnO nanoparticles onto the NG layers was confirmed by high resolution transmission electron microscope (HR-TEM), scanning electron microscope (SEM), powder X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FTIR). UV-Vis spectroscopy (UV-Vis) was used to study the enhanced photocatalytic activity, which shows the red-shift of the band-edge as compared to ZnO nano particles. The enhancement in photocatalytic activity is possibly due to the synergistic effect of improved adsorptivity of dyes, enhanced visible light absorption and effective charge separation.
Keywords: ZnO; photocatalysis; methylene blue; nitrogen doped graphene
1. Introduction
The visible light degradation of organic pollutants have attracted the attention of the scientific community worldwide due to the various reasons such as better efficiency, easy to operate and non toxic byproducts.1-6 The process of photocatalysis takes place by the absorption of light by the photocatalysts such as ZnO and TiO2 and thereby promoting the electrons from valence band to the conduction band and forming the electron and hole pairs in the structure.7-9 The produced electron-hole pairs can move and start the various redox reactions involving water and oxygen and thus cause the degradation of organic molecules. However, the recombination of electrons and holes can lower the performance of photocatalyst ZnO.10 In order to make the catalyst more effective, the recombination of electron and hole must be hindered. Various experiments have been conducted to prevent the recombination of electron and hole by combining the photocatalyst with the other materials such as non reactive metals11,14 and semiconductors.15,16 In addition, it has been found that deposition of semiconductor photocatalysts on a co-adsorbent surface such as mesoporous materials, zeolites, alumina, silica or carbon based materials may en-
hance the photocatalytic activity of photocatalysts.17-21 Among the various materials, carbon based materials are of great importance due to their excellent electronic properties, adsorption capacity and unique structure. The carbon based materials include activated carbon, graphene and carbon nanotubes.21-27 Graphene is a two-dimensional monolayer network of conjugated carbon atoms having sp2-hybridization between the atoms.28-32 Graphene has many advantages as compared to the carbon nanotubes (CNTs) such as high surface area and excellent adsorption on the surface of adsorbent. Graphene possesses the excellent electrical, thermal and mechanical properties by virtue of which it is used in the diverse areas and also as electrode materials for electrochemical capacitor.31-34 However, despite all these facts graphene has to undergo some structural transformation to be used for many other applications.35 The doping of graphene with the heteroatom (i.e, N-atom) can enhance the electron mobility and causes the larger capacitance. All these properties are attributed to the atomic size and strong valence bonds of nitrogen atoms.36 In the recent years, nitrogen doped graphene (NG) has received much importance37,38 Thus, it is favored to synthesize the N-doped graphene based nano
materials using simple techniques with enhanced physical and chemical properties that can have applications in diverse fields. Various analysis techniques have been focused on the application of graphene based composites in capacitors,39 biosensors,40 solar cells41 and liquid crystalline displays.42 It has been thought that composite of ZnO with graphene is a perfect candidate to have the excellent pho-tocatalytic performance due to the conjugated structure of graphene which help in the separation of charge in the photocatalysis process. ZnO-graphene nanohybrids have been synthesized having regularly arranged ZnO nanorods on the graphene sheets possessing the high electrical property and excellent optical transmittance.43 Lv and co-workers have proposed ZnO-RGO hybrid composites by using a microwave synthesis system, resulting in improved degradation of methylene blue dye.44 Zheng et al. have employed chemical vapour deposition technique to synthesize the ZnO-graphene composite with exceptional field emission properties.45 ZnO-graphene thin films have the good capactive properties which are prepared by ultrasonic spray pyrolysis.46 However, the conditions that are used in all these processes are complex and can be carried out at high temperature only. The solution based processes are proved better as compared to the physical methods as they are cost effective for the fabrication of ZnO nanoparticles and its graphene based composites.20,47 Here in this study, a simple one step synthetic approach is explored for the synthesis of ZnO-NG nano composites with the varying amounts of NG using ethylene glycol as a solvent. The eth-ylene glycol inhibits the aggregation of reduced nitrogen doped graphene sheets. In the further study, the photocat-alytic activity of the ZnO-NG for degradation of organic dye methylene blue was investigated and the obtained results were compared with naked ZnO nano particles. The effect of concentration of NG on the photocatalytic property of ZnO-NG composites for degradation of methylene blue dye was investigated in detail.
2. Experimental 2. 1. Synthesis of Graphene Oxide (GO)
Graphene oxide (GO) was synthesized from 99.99% pure natural graphite powder flakes, by modified Hummer's method.48 In this method, 3 g graphite powder flakes were added into 40 mL mixture of concentrated H2SO4 and H3PO4 (9:1) maintained at 0 °C. To this mixture, 18g KMnO4 was added in small installments under vigorous stirring. The reaction mixture was stirred for 2 h below 10 °C and then for another 1 h at 35 °C. After that the mixture was diluted with 100 mL of deionised water (DI) and stirred for 1 h in an ice bath to prevent overheating of reaction mixture. Then the residual KMnO4 present in the reaction mixture was reduced by adding 20 mL of 30% H2O2. The brilliant yellow colored solution was obtained. The reaction mixture was washed with 5% HCl
aqueous solution to remove the metal ions followed by washing with deionised water to counteract the acidic nature of the solution until its pH value reaches 6. The reaction mixture was centrifuged and obtained product was further purified by sonicating its dispersion in deionised water for 1 h. Finally, the product was centrifuged and dried at 60 °C for 24 h.
2. 2. Synthesis of Nitrogen Doped Graphene (NG)
Nitrogen doped graphene (NG) was synthesized by the pyrolysis of prepared graphene oxide (GO). 0.5 g GO and 0.6 g urea were dissolved in 30 mL ethanol and sonicated for 30 min to form the homogenous solution. Then the solution was heated at 60 °C to evaporate the solvent. The as obtained black mixture was grounded finely and heated at 350 °C in the muffle furnace at a heating rate of 5 °C/min for 12 h. The obtained black powder was washed with ethanol and dried in oven at 60 °C for 24 h.
2. 3. Synthesis of Zinc Oxide/Nitrogen Doped Graphene Composites (ZnO-NG)
ZnO-NG composites were prepared via hydrothermal method by varying the content of NG as 10, 20, 30, 40 and 50 mg. Briefly, purified NG with different weight contents as mentioned were dispersed in 15 mL of ethylene glycol (EG) by ultrasonication treatment for 2 h, labelled as solution A. Two separate solutions of zinc acetate [Zn(CH3COO)2] and sodium hydroxide (NaOH) were prepared by dissolving 20 mg Zn(CH3COO)2 and 10 mg NaOH in 10 mL of EG, labelled as solution B and C respectively. Solution B and C are added to solution A and stirred for 1 h to obtain a homogenous suspension. The suspension was transferred to a 50 mL Teflon-lined stainless steel autoclave and maintained at 160 °C for 24 h for the deposition of ZnO simultaneously. Finally, the resultant composite was centrifuged and washed with DI water followed by ethanol and dried at 70 °C for 24 h. Pure ZnO was also prepared by the same method under similar conditions. The as-prepared ZnO-NG composites with 20, 30, 40, 50 mg of NG were labelled as ZNG-1, ZNG-2, ZNG-3 and ZNG-4 respectively.
2. 4. Spectroscopic and Microscopic Measurements
The phase and size of the as prepared samples were determined from powder X-ray diffraction (PXRD) using D8 X-ray diffractometer (Bruker) at a scanning rate of 12° min-1 in the 20 range from 10° to 80°, with Cu Ka radiation (X = 0.15405 nm). Scanning electron microscopy (SEM) micrographs of the samples were recorded on FEI Nova Nano SEM 450. High Resolution Transmission Electron Microscopy (HRTEM) was recorded on Tecnai G2 20
S-TWIN Transmission Electron Microscope with a field emission gun operating at 200 kV. The samples for TEM measurements were prepared by evaporating a drop of the colloid onto a carbon coated copper grid. The infrared spectra were recorded on Shimadzu Fourier Transform Infrared Spectrometer (FT-IR) over the range of wave number 4000-400 cm-1 and the standard KBr pellet technique was employed. All the measurements were performed at room temperature.
2. 5. Photocatalytic Measurements
The catalytic activity of the as synthesized sample was performed by degradation of organic dye methylene Blue (MB) under the irradiation of visible light. For the Photo irradiation 500 W xenon lamp was used fitted with UV cut-off filters (JB450) in order to completely remove any radiation below 420 nm ensuring the exposure to only visible light. The whole procedure was performed at 25 °C. A 100 mL of MB dye solution was prepared (20 mg/L concentration) and 0.025 g of photocatalyst was mixed with dye solution. The resulting mixture was stirred for 1 h before illumination in order to establish the adsorption and desorption equilibrium between MB and catalyst surface. At the same time instant of time 5 mL of dye-catalyst mixture was taken out and concentration of the residual dye was determined with the help of UV-vis spectroscopy by measuring the absorption at 664 nm. The absorbance of dye in presence of different catalysts (ZNG-1, ZNG-2, ZNG-3 and ZNG-4) at 664 nm was monitored after fixed intervals of time. The absorbance of dye in presence of pure ZnO at same time intervals was also recorded for reference.
3. Results and Discussion 3. 1. PXRD Measurements
The structural characterization of the nanoparticles has been carried out by Powder X-ray diffraction technique using CuKa radiation. The PXRD spectrum of GO, NG, ZnO, ZNG-1, ZNG-2, ZNG-3 and ZNG-4 composite materials are shown in the Figure. 1 and Figure. 2. Figure. 1a, b show the differences of phase composition between GO and NG. The doping of nitrogen in GO can be shown easily by PXRD spectrum. The X-ray diffraction pattern of GO (Figure. 1a) shows one characteristic peak (20°) at 10.3°. The PXRD pattern of NG shown in Figure. 1b has three characteristic peaks (20°) at 26.3° (002), 31.92° (002) and 42.63° (004). The results obtained for NG are in well agreement with literature (JCPDS Card No. 75-1621)44. The characteristic absorption peak of GO at 10.3° was not found in PXRD spectrum of the NG which shows nitrogen doping of graphene oxide framework. The PXRD patterns of ZnO, ZnO/NG composites (Figure 2) there are following main peaks at 20 = 31.7°, 34.4°, 36.2°,
47.5°, 56.6°, 62.9°, 66.3°, 67.9°, 69.2°, 77.0° which corresponds to the (1 0 0), (0 0 2), (1 0 1), (1 0 2), (1 1 0), (1 0 3), (2 0 0), (1 1 2), (2 0 1) and (2 0 2) planes of ZnO nano crystals respectively (JCPDS No. 36-1451).49 The reduction of nitrogen doped graphene takes place by the alcohol in the hydrothermal conditions so no peak corresponding to (002) plane is visible in the composite. It can also be attributed to efficient exfoliation of the NG sheets in the resultant composites so this reason can be given disappearance of the NG patterns in the XRD spectrum of ZnO/NG composites.
2 Tbeta (Degree)
Figure 1. PXRD patterns of (a) GO (b) NG
NG 1» M (d) WÏ |	101 101 '¡° m 1» 1 i 1	
« . 1		
<"> , 1	1 m 11	
(a, |	1 ill	.k
10 20 30 40 50 60 70
2Thfta (degree)
Figure 2. PXRD patterns of (a) ZnO (b) ZG-1 (c) ZG-2 (c) ZG-3 (d) ZG-4
The average crystallite size of these nanoparticles was calculated according to the Scherrer's equation.
(1)
where, L (nm) is the crystallite size, À (nm) is the wavelength of the Cu Ka radiant, À = 0.15405 nm, P(°) is the full-width at half-maximum (FWHM) of the diffraction peak, 0 is the diffraction angle and K is the Scherrer constant equal to 0.89. All the major peaks were used to calculate the average crystallite size of the ZnO and ZnO/NG nanoparticles. The estimated average crystallite sizes of nanoparticles are in the range of 80-120 nm.
3. 2. FT-IR Characterization
FTIR spectra of GO, NG was shown in Figure. 3a, b. There are many O-containing groups that exist on GO sheets, such as hydroxyl, epoxy, and carboxyl groups. Majority of the O-containing groups will disappear after reduction. FTIR bands at 1050, 1220, 1405 and 1730 cm-1 were observed for GO. These bands correspond to C-O stretching, C-O-C stretching, O-H deformation vibra-
	111/		
S		—--"✓A «H1« 1	tWirti
-1001)
3500
3000 2500 2000 Wave number (cm1)
1500
1000
500
Figure 3. FTIR spectra of (a) GO (b) NG
		— ZNG-4
		— ZnO
		
\		
	(b)	
		
V(0-!D		
		V(ÍD-OII| \
		VflMt
tion and C=O carbonyl stretching.50 FTIR bands at 1400 cm-1 due to C=C stretching is observed in NG and the v(c=o) band at 1730 cm-1 completely disappeared due to reduction. The bands located at 1180 and 1565 cm-1 in Figure. 3b are assigned to the V(C-N) and V(C=C) respectively. The FTIR spectra suggest nitrogen doping of GO. Figure. 4a, b shows the FT-IR bands of ZnO and ZnO-NG. The absorption band at 450 cm-1 is attributed to the stretching modes of Zn-O. Furthermore, it is observed that almost all the characteristic bands of oxygen containing functional groups (C=O, O-H, C-OH and C-O-C) disappeared in the FT-IR spectrum of ZnO-NG suggesting the nitrogen doping of graphene oxide and uniform anchoring of ZnO onto the surface of NG51. The results above show the heteroatom N was entered in the graphene structure and the ZnO-NG composites were prepared favourably.
3. 3. Raman Analysis
The Raman spectrum of the as synthesized NG and ZNG-4 are shown in Figure 5a and 5b respectively. In the Figure. 5 two noticeable peaks at 1340 and 1600 cm-1 indicating the D and G band respectively. The ratio of the intensity of D and G band indicates disorder, as revealed by the sp2/sp3 carbon proportion. The G band indicates in (plane bond(stretching motion of pairs of sp2 C atoms. The D band ("disordered" band) is the breathing mode of the sp2 rings of the graphene layer which corresponds to a range of defects: bond angle disorder, bond length disor-
Wave number (cm ') Figure 4. FTIR of (c) ZnO (d) ZNG-4.
Raiuan shift (cm*1)
Figure 5. Raman spectrum of (a) NG (b) ZNG-4.
der and hybridization caused by heteroatom (nitrogen/ oxygen) doping and structure defects. Therefore, the relatively increased intensity of the D band for NG indicates that the content of disordered carbon increases, particularly by nitrogen doping.
3. 4. SEM and TEM Analysis
Figure. 6a and 7a depicts scanning electron microscopy and transmission electron microscopy images of as prepared GO respectively. The scanning electron microscopy, suggested layered structure and crumpled surface
morphology of as synthesized graphene oxide. Furthermore, by analysing the TEM image (Figure. 7a) it was revealed that GO has stacked layer by layer structure and has morphology like the wrinkled paper. The morphological changes can be attributed to excessive carboxylic, phenolic
Figure 7. TEM micrographs of (a) GO (b) NG (c) ZnO (d) ZNG-4
and epoxy functional groups on the basal plane of GO. The curled and overlapped nanosheets of GO can be clearly observed. Figure. 6b and Figure. 7b represent nitrogen-doped graphene nano-sheets which shows a highly wrinkled topology, by virtue of stable thermodynamic bending.45,46 SEM image of the ZnO is shown in Figure. 6c which suggested rectangular rods like morphology of the prepared sample. Figure. 6d is SEM image of ZNG-4 sample which clearly shows a uniform distribution of ZnO on the surface of NG. Furthermore the SEM results are supported by TEM analysis of ZnO and ZNG-4 as shown in Figure. 7c and d respectively. The morphological features of prepared nanostructures are in close agreement with reported literature.52 The particle size data obtained from TEM data by using Image J software are in very close agreement to the size calculated from the Debye-Scherrer method.
3. 5. Photocatalytic Measurements
The photocatalytic decomposition of organic dye MB under the visible light was helpful to show the photocatalytic performance at 25 °C of the prepared ZnO, ZNG-1, ZNG-2, ZNG-3, ZNG-4. The photocatalytic degradation profile of MB solution (concentration of MB, C = 0.075 M and path length, l = 1cm) in the presence of different composites was shown in the Figure. 7. It has been found that the MB dye (blank solution) was not decomposed even after 90 min exposure to the visible light. The ZnO-NG composites shows better photocatalytic activity than ZnO. The decomposition rate of MB for ZnO was found 58% but on the introduction of nitrogen doped graphene the decomposition rate was increased to 76%, 88%, and 93% corresponding to ZNG-1, ZNG-2, ZNG-3 respectively. And for the ZNG-4 it reaches a maximum value of 99.5%. These results shows that the
	Adsorption	I Ptl<iH>rmhili H—* •
		
	» Blank	
	-•—ZnO	
	—•— 2NG-1	1 ^----
	—ZNG-2	! ^
	-T- ZNG-3	
	—4— ZNG-4	Methvlt» Bluer
		f
0 10 20 30 40 50 60 70 EG 90 Time (mlri)
Figure 8. The kinetics of photodegradation of MB.
presence of nitrogen doped graphene has vital importance in the photocatalytic process and can be shown by the plot of Ct/C0 versus time (min). The degradation process for the various photocatalysts was shown in the Figure. 7.
3. 6 Mechanism of Photocatalysis
A possible mechanism of photocatalytic degradation of MB over the ZnO-NG nanocomposite has been suggested based on the photocatalytic studies as shown in Figure. 9. Upon the visible light irradiation, the electrons are excited in the valence band (VB) to the conduction band (CB) of ZnO nanoparticles, thus generating holes (h+) in the VB. The electron produced transferred to the CB of carbon layers of nitrogen doped graphene and which discharge the photogenerated electrons which get reacted with the oxygen (O2) to produce super oxide anion radicals (O2). The huge separation rate of h+ easily reacts with water molecules (H2O) to generate the hydroxyl radicals (OH). The presence of the above radicals results into the degradation of the adsorbed MB dye onto the surface of ZnO-NG nanocomposite. The effective electron transfer process with nitrogen doped graphene layers as electron receiver and transporter leads to the enhanced photocata-lytic activity of the ZnO-NG nanocomposite under the visible light irradiation. Nitrogen doped graphene prevents electron-hole pairs recombination onto the surface of ZnO nanoparticles (NPs).53-55 So, the enhancement of photocatalytic activity was given to the synergistic effect between ZnO NPs and nitrogen doped graphene layers. Furthermore the role of NG in in photodegradation of MB might be double fold;
1.	Nitrogen doped graphene (NG) increases adsorption of tested dyes (MB) on the surface of ZNG photocatalyst(s), as result of n-n conjugation between aromatic region of the dye and nanosheets of nitrogen doped graphene.56, 57
2.	It is also helpful in suppression of recombination of charges in ZnO, as NG acts as photoelectron ac-
Figure 9. Proposed mechanism of photodegradation process MB dye.
ceptor and there by facilitate a higher photocata-lytic activity of prepared nanocomposites. 58, 59
3. 7. Recyclability and Reusability
of As-Synthesised Photocatalyst (ZNG-4)
For a greener-ecofriendly approach and practical applications, reuse and recyclability of a phocatalyst is prime requirement. This makes the process cost effective and free of waste. The reusability and recycling efficiency of as-synthesized photocatalyst (ZNG-4) was tested against photodegradation of methylene blue (MB). It can be noted that photocatalyst (ZNG-4) shows appreciable activity even after the five cycles. The results are shown in Figure. 10.
Figure 10. Recyclability of ZNG-4 in Photodegradation of MB dye (upto 5 cycles).
4. Conclusions
In conclusion, we have reported the structural, pho-tocatalytic properties of ZnO, ZnO-NG nanocomposites prepared by hydrothermal method. PXRD patterns are in well agreement with the ZnO and nitrogen doped graphene structure. SEM and TEM images reveal the morphological and topological features of nitrogen doped graphene, ZnO, ZnO-NG respectively. The crystallite size of synthesized nanocomposites as calculated from PXRD and TEM analysis was found to be in the range of 80-120 nm. The photo-catalytic results show that photodegradation of MB in presence of nanocomposites was enhanced compared to bare ZnO.
5. Acknowledgement
We would like to acknowledge SAIF, Panjab University for their technical support. We thank Indian Institute
of Technology Mandi for powder X-ray diffraction study. One of the authors (R. S.) is thankful to UGC-Delhi for the financial support.
6. References
1.	Z. Liu, W. Xu, J. Fang, X Xu, S. Wu, X. Zhu, Z. Chen, Appl. Surf. Sci. 2012, 259, 441-447. DOI:10.1016/j.apsusc.2012.07.063
2.	W. Xu, G. Zhou, J. Fang, Z. Liu, Y. Chen, C. Cen. Int. J. Pho-toenergy. 2013, 2013, Aug 7. DOI:10.1155/2013/234806
3.	W. Xu, Z. Liu, J. Fang, G. Zhou, X. Hong, S. Wu, X. Zhu, Y. Chen, C. Cen Int. J. Photoenergy. 2013, 2013, jul 29.
DOI: 10.1155/2013/394079
4.	Y. Liao, W. Que, Z. Tang, W. Wang, W. Zhao, J Alloys Compd.
2011,	509, 1054-1059. DOI:10.1016/jjallcom.2010.09.175
5.	N. R. Khalid, E. Ahmed, Z. Hong, M. Ahmad, Appl. Surf. Sci.
2012,	263, 254-259. DOI:10.1016/j.apsusc.2012.09.039
6.	J. Wang, D. N. Tafen, J. P. Lewis, Z. L. Hong, A. Manivannan, M. J. Zhi, M. Li, N. Q. Wu, J. Am. Chem. Soc. 2009, 131, 12290-12297. DOI:10.1021/ja903781h
7.	C. Wang, J. Yan, X. Wu, Y. Song, G. Cai, H. Xu, J. Zhu, H. Li, Appl. Surf. Sci. 2013, 273,159-166. DOI:10.1016/j.apsusc.2013.02.004
8.	M. Li, Z. L. Hong, Y. N. Fang, F. Q. Huang, Mater. Res. Bull. 2008, 43, 2179-2186. DOI:10.1016/j.materresbull.2007.08.030
9.	M. Li, P. S.Tang, Z. L. Hong, M. Q. Wang, Colloids Surf., A.
2008,	318, 285-290. DOI:10.1016/j.colsurfa.2008.01.001
10.	R. M. Asmussen, M. Tian, A. Chen, Environ. Sci. Technol.
2009,	43, 5100-5105. DOI:10.1021/es900582m
11.	T. Hirakawa, P. V. Kamat, J. Am. Chem. Soc. 2005, 127, 39283934. DOI:10.1021/ja042925a
12.	P. V. Kamat, M. Flumiani, A. Dawson Colloids and surf. A. 2002, 202, 269-279. DOI:10.1016/S0927-7757(01)01071-8
13.	K. Vinodgopal, P. V. Kamat, Environ. Sci. Technol.1995, 29(3), 841-485. DOI:10.1021/es00003a037
14.	V. Subramanian, E. E. Wolf, P. V. J. Kamat, J. Am. Chem. Soc. 2004, 126, 4943-4950. DOI:10.1021/ja0315199
15.	S. H. Elder, F. M. Cot, Y. Su, S. M. Heald, A. M. Tyryshkin, M. K. Bowman, Y. Gao, A. G. Joly, M. L. Balmer, A. C. Kol-waite, K. A. Magrini, D. M. Blake, J. Am. Chem. Soc. 2000, 122, 5138-5146. DOI:10.1021/ja992768t
16.	T. Tatsuma, S. Saitoh, P. Ngaotrakanwiwat, Y. Ohko, A. Fu-jishima, Langmuir 2002, 18, 7777-7779. DOI:10.1021/la026011i
17.	J. Aguado, R. V. Grieken, M. J. Lopez-Munos, J. Marugan, Appl. Catal. 2006, 312, 202-212. DOI:10.1016/j.apcata.2006.07.003
18.	B. Li, H. Cao, J. Mater. Chem. 2011, 21, 3346-3349. DOI:10.1039/C0JM03253K
19.	J. Matos, A. Garcia, T. Cordero, J. M. Chovelon, C. Ferronato, Catal. Lett. 2009, 130, 568-574. DOI:10.1007/s10562-009-9989-8
20.	K. Woan, G. Pyrigiotakis, W. Sigmund, Adv. Mater. 2009, 21, 2233-2239. D01:10.1002/adma.200802738
21.	M. Li, S. F. Zhou, Y. W. Zhang, G. Q. Chen, Z. L. Hong, Appl. Surf. Sci. 2008, 254, 3762-3766.
DOI: 10.1016/j.apsusc.2007.11.047
22.	Y. Yang, Liu, Appl. Surf. Sci. 2011, 257, 8950-8954.https://doi. org/10.1016/j.apsusc.2011.05.070
23.	H. Zhang, X. Lv, Y. Li, Y. Wang, J. Li, ACS Nano, 2010, 4, 380-386. D0I:10.1021/nn901221k
24.	X. Zhou, T. Shi, H. Zhou, Appl. Surf. Sci. 2012, 258, 62046211. D0I:10.1016/j.apsusc.2012.02.131
25.	N. R. Khalid, Z. L. Hong, E. Ahmed, Y. W. Zhang, H. Chan, M. Ahmad, Appl. Surf. Sci. 2012, 258, 5827-5834. D0I:10.1016/j.apsusc.2012.02.110
26.	A. A. Casaos, I. Tacchini, A. Unzue, M. T. Martinez, Appl. Surf. Sci. 2013, 270, 675-684. D0I:10.1016/j.apsusc.2013.01.120
27.	N. R. Khalid, E. Ahmed, Z. L. Hong, Y. W. Zhang, M. Ahmad, Curr. Appl. Phys. 2012, 12, 1485-1492. D0I:10.1016/j.cap.2012.04.019
28.	K. S. Novoselov, A. K. Geim, S. V. Morozov, D. Jiang, M. I. Katsnelson, I. V. Grigorieva, S. V. Dubonos, A. A. Firsov, Nature, 2005, 438, 197-200. D0I:10.1038/nature04233
29.	A. K. Geim, K. S. Novoselov, Nat. Mater. 2007, 6(3), 183-191. D0I:10.1038/nmat1849
30.	A. C. Neto, F. Guinea, N. M. Peres, K. S. Novoselov, A. K. Geim, Rev. Mod. Phys. 2009, 81(1), 109-155. D0I:10.1103/RevModPhys.81.109
31.	Y. P. Zhang, C. Z. Luo, W. P. Li; C. X. Pan, Nanoscale, 2013, 5, 2616-2619. D0I:10.1039/C3NR34141K
32.	Y. P. Zhang, D. L. Li, X. J. Tan, B. Zhang, X. F. Ruan, H. J. Liu, C. X. Pan, L. Liao, T. Zhai, Y. Bando, S. S. Chen, W. W. Cai, R. S. Ruo, Carbon, 2013, 54, 143-148. D0I:10.1016/j.carbon.2012.11.012
33.	D. F. Sun, X. B. Yan, J. W. Lang, Q. J. Xue, J. Power Sources, 2013, 222 52-58. D0I:10.1016/j.jpowsour.2012.08.059
34.	Y. Huang, J. J. Liang, Y. S. Chen, Small, 2012, 8, 1805-1834. D01:10.1002/smll.201102635
35.	X. S. Du, C. F. Zhou, H. Y. Liu, Y. W. Mai, G. X. Wang, J. Power Sources, 2013, 241, 460-466. D0I:10.1016/j.jpowsour.2013.04.138
36.	W. Fan, Y. Y. Xia, W. W. Tjiu, P. K. Pallathadka, C. B. He, T. X. Liu, J. Power Sources 2013, 243, 973-981. D0I:10.1016/j.jpowsour.2013.05.184
37.	H. M. Jeong, J. W. Lee, W. H. Shin, Y. J. Choi, H. J. Shin, J. K. Kang, J. W. Choi, Nano Lett. 2011, 11, 2472-2477. D0I:10.1021/nl2009058
38.	G. X. Luo, L. Z. Liu, J. F. Zhang, G. B. Li, B. L.Wang, J. J. Zhao, ACS Appl. Mater. Interfaces, 2013, 5, 11184-11193. D0I:10.1021/am403427h
39.	X. Chen, C. Fu, W. Yang, Analyst, 2009, 134, 2135-2140. D01:10.1039/B910754A
40.	N. L.Yang, J. Zhai, D. Wang, Y.S. Chen, L. Jiang, ACS Nano
2010,	4, 887-894. D01:10.1021/nn901660v
41.	P. Blake, P. D. Brimicombe, R. R. Nair, T. J. Booth, D. Jiang, F. Schedin, L. A. Ponomarenko, S. V. Morozov, H. F. Gleeson, E. W. Hill, A. K. Geim, K. S. Novoselov, Nano Lett. 2008, 8, 1704-1708. D0I:10.1021/nl080649i
42.	X. Y. Zhang, H. P. Li, X. L. Cui, Y. Lin, J. Mater. Chem. 2010, 20, 2801-2806. D0I:10.1039/B917240H
43.	J. M. Lee, Y. B. Pyun, J. Yi, J. W. Choung, W. I. Park, J. Phys. Chem. C 2009, 113, 19134-19138. D0I:10.1021/jp9078713
44.	T. Lv, L. Pan, X. Liu, T. Lu, G. Zhu, Z. Sun, J Alloys Compd.
2011,	509, 10086. D0I:10.1016/j.jallcom.2011.08.045
45.	W. T. Zheng, Y. M. Ho, H. W. Tian, M. Wen, J. L. Qi, Y. A. Li, J. Phys. Chem. C 2009, 113, 9164-9168. D0I:10.1021/jp900881q
46.	Y. Zhang, H. Li, L. Pan, T. Lu, Z. Sun, J. Electroanal. Chem. 2009, 634, 68-71. D0I:10.1016/j.jelechem.2009.07.010
47.	B. Li, T. Liu, Y. Wang, Z. Wang, J. Colloid Interface Sci. 2012, 377, 114-121. D0I:10.1016/j.jcis.2012.03.060
48.	W. S. Hummers, R. E. Offeman, J. Am. Chem.Soc. 1958, 80, 1339-1339.
49.	M. Ahmad, E. Ahmed, Z. L. Honga, J. F. Xua, N. R. Khalida, A. Elhissi, W. Ahmed Appl. Surf. Sci. 2013, 274 273-281. D0I:10.1016/j.apsusc.2013.03.035
50.	M. Acik, C. Mattevi, C. Gong, G. Lee, K. Cho, M. Chhowalla, ACS Nano 2010, 10, 5861-5868. D0I:10.1021/nn101844t
51.	A. K. Mageed, AB DR, A. Salmiaton, S. Izhar, M. A. Razak, H. M. Yusoff, F. M. Yasin, S. Kamarudin International Journal of Applied Chemistry, 2016, 12(1), 104-8.
52.	W. Zou, J. Zhu, Y. Sun, X. Wang, Mater. Chem. Phys. 2011, 125, 617-620. D0I:10.1016/j.matchemphys.2010.10.008
53.	B. Li, T. Liu, Y. Wang, Z. Wang, J. Colloid Interface Sci. 2012, 377, 114-121. D0I:10.1016/j.jcis.2012.03.060
54.	R. Atchudan, T.N.J.I. Edison, S. Perumal, M. Shanmigam, Y. R. Lee, J. Photochem. Photobiol. A, 2017, 337, 100-111. D01:10.1016/j.jphotochem.2017.01.021
55.	R. Cai, J. Wu, L. Sun, Y. Liu, T. Fang, S. Zhu, S. Li, Y. Wang, L. Guo, C. Zhao, A. Wei, Mater. Des. 2016, 90, 90839-844. http://10.1016/j.matdes.2015.11.020
56.	P. Chen, T. Y. Xiao, H. H Li, J. J Yang, Z. Wang, H. B. Yao, S. H. Yu, ACS Nano, 2011 6, 712-719. D0I:10.1021/nn20 4191x
57.	M. Kumar, R. Singh, H. Khajuria, H. N. Sheikh, J. Mater. Sci. Mater. Electron., 2017, 28, 9423-9434. D0I:10.1007/s10854-017-6684-1
58.	K. Gopalakrishnan, H. M. Joshi, P. Kumar, L. S. Panchakarla, C. N. R. Rao, Chem. Phys. Lett., 2011, 511, 304-308. D0I:10.1016/j.cplett.2011 .06.033
59.	R. Singh, M. Kumar, H. Khajuria, J. Ladol, H. N. Sheikh, Chemical Papers, 2018, 1-12. D0I:10.1007/s11696-018-0385-y
Povzetek
S preprostim enostopenjskim solvotermalnim sinteznim postopkom smo pripravili nano fotokatalizator na osnovi ZnO na grafenu, dopiranem z dušikom (ZNG). V sinteznem postopku smo uporabili etilen glikol kot topilo, ki hkrati preprečuje agregacijo plasti grafena. Depozicijo nanodelcev ZnO na plasti grafena dopiranega z dušikom smo potrdili s presevno elektronsko mikroskopijo visoke ločljivosti (HR-TEM), vrstično elektronsko mikroskopijo (SEM), rentgensko praškovno difrakcijo (XRD) in infrardečo spektroskopijo (FTIR). UV-Vis spektroskopijo smo uporabili za preučevanje fotokatalitične aktivnosti, ki je višja v primerjavi s samimi nanodelci ZnO. Višjo fotokatalitično aktivnost lahko pripišemo sinergističnim učinkom povečane absorbcije barvila, povišane absorbcije vidne svetlobe in efektivne ločitve naboja.
DOI: I0.i7344/acsi.20i7.400i	Acta Chim. Slov. 2018, 65, -	©commohs
Scientific paper
DFT Study of the Reaction Mechanism of N-(Carbomylcarbamothioyl) Benzamide
Felix Odame
Department of Chemistry, Nelson Mandela University, P.O. Box 77000, Port Elizabeth 6031, South Africa
* Corresponding author: E-mail: felixessah15@gmail.com(FO) Tel.: +27836660784, Fax: +2741 504 4236.
Received: 13-11-2017
Abstract
The reaction mechanism for the formation of N-(carbomylcarbamothioyl)benzamide has been successfully computed with the B3LYP/6-31g(d) functional and basis set and compared with 'H NMR monitoring of the progress of the reaction with time. The reaction is proposed to proceed through two transition states: Ts1 (the rate-determining step) with highly unstable species (with a requisite orientation for the reaction to proceed), and Ts2 with a lower energy leading to the product. Computation ofthe reaction pathway was also carried out using the B3PW91/6-31G(d), M06/6-31G(d) and Wb97XD/6- 31G(d) functionals and basis set. These results do not present a clear reaction pathway compared to that given by the B3LYP/6-31G(d).
Keywords: Transition state; imaginary frequency; urea, reaction mechanism; benzoyl isothiocyanate.
1. Introduction
The use of Density functional theory (DFT) in computation in most branches of chemistry over the years has been extensive,1-3 and various methods have been used in that regard,4-8 the methods used include local density approximation (LDA), generalized gradient approximation (GGA), meta GGA, hybrid GGA, hybrid-meta GGA, and double-hybrid GGA, various empirical corrections such as dispersion, have been successfully implemented in many popular computational codes. By the use of standard functional approximation and standard basis set, the theoretical calculation of the electronic structure and energetics of chemical interest are easily computed. B3LYP, which is a global hybrid GGA and has been used extensively in most areas of chemistry. It is a hybrid of exact Hartree-Fock exchange with local and semi-local exchange and correlation terms on the basis of the adiabatic connection,9-14 In this work, the use of different DFT methods to compute the reaction mechanism for the synthesis of AT-(carbomylcar-bamothioyl) benzamide has been explored.
The mechanisms for the oxidation of thiophene by OH radicals under inert conditions (Ar) have been studied using density functional theory in conjunction with various exchange-correlation functionals.15 A density functional theory (DFT) study has been performed to explore
the mechanisms of the acid catalyzed decarboxylation reaction of salicylic acids using the B3LYP method with 6-31++G(d,p) basis set in both gas phase and aqueous environment.16 Density functional theory (DFT) has been used to study the cobalt(I)-catalyzed enantioselective intramolecular hydroacylation of ketones and alkenes. Hydrogen migration was both the rate determining and chirali-ty-limiting step, and this step was endothermic. Reductive elimination was the rate-determining step, but the chirali-ty-limiting step was hydrogen migration, which occurred easily. The results also indicated that the alkene hydroacylation leading to (S)indanone formation was more energetically favourable than the ketone hydroacylation that gave (R)-phthalide, both thermodynamically and kinetically.17
The reaction mechanisms of H2 with OCS have been investigated theoretically by using density function theory method. Three possible pathways leading to major products CO and H2S, as well as two possible pathways leading to by-product CH4 have been proposed and discussed. The structure parameters, vibrational frequencies and energies for each stationary point were calculated, and the corresponding reaction mechanism given by the potential energy surface determined from the relative energies.18 Though a lot of computational effort has been expended on different reaction systems much has not been done on the reaction mechanisms of thiones with amines.
In this work we present the computed reaction mechanism and the DFT transition state studies of the formation of N-(carbomylcarbamothioyl) benzamide, the transition states that contribute to the formation of products as well as the intermediates in the reaction pathway have been computed and discussed.
2. Computational Details
The reactants, transition states, intermediates and products structures were fully optimized at the B3LY-P/6-31G(d). When compared with other levels of theory, the B3LYP method was sufficiently accurate for predicting reliable geometries and frequencies of the stationary points.19-22 Computation of vibrational frequency based on the optimized geometry of each reactant, transition structure, intermediate and product was carried out. All reactants, intermediates and products had no imaginary frequencies, whereas each transition state had one and only one imaginary frequency. The intrinsic reaction coordinate (IRC)23-25 calculations, were performed at the same level of theory to ensure that the transition states lead to the expected reactants and products. The computations were carried out using the GAUSSIAN 09 program package,26 with Gausview 4.1 as the software for preparing the files whilst the HOMO-LUMO diagrams were generated using Avogadro.
3. Results and Discussion
The species used for the computations are defined as follows.
I1 = initial starting material
Ts1= first transition state and highest energy specie
P1 = Intermediate
TS1 = Second transition state
P2 = final product.
The predicted reaction pathway proceeds by the coming together of urea and benzoyl isothiocyanate (I1), it was obtained by optimising the starting material to a minimum and also tracing the reverse intrinsic reaction coordinate (IRC) path of the transition state TS1. The starting materials were initially minimized using the B3LYP functional and the 6-31g (d) basis set. The two species (I1) together have no charge and a dipole moment of 2.1286 Debye. At the onset of the attack of the thiocyanate carbon by an amine group of urea, the distance between the carbon of the thione and the amine was 3.70191 A. In the determination of energy profile, I1 was used as the point of reference. A transition state Ts1 was computed using both the B3LYP functional at the 6-31g(d) basis set, this gave a dipole moment of 10.2126 Debye and a relative free energy of +40.23 kcal/mol. TS1 is singlet species of no charge, It is a saddle point with a single imaginary frequency, obtained according to the Berny algorithm and subsequent vibrational analysis. The high energy barrier of Ts1 is consistent with the fact that it is the rate determining step. This is the step that involves attaining the right orientation for attack of the thione carbon by the lone pair of electrons on the nitrogen of the urea. A forward IRC computation and optimization of the species obtained gave P1 which is a singlet species of no charge with a dipole moment of 3.7226 Debye. The relative free energy of P1 is -0.66 kcal/mol. The formation of the C-N bond in P1 using the thione carbon leads to the formation of TS2 which is also a singlet species with a charge of 2 and a dipole moment of 9.3700 Debye. TS2 is a saddle point with a single imaginary frequency. The relative free energy of TS2 is 13.62 kcal/mol. A forward IRC pathway from TS2 gives P2 which is a singlet species of no charge, and an imaginary
Figure 1. The potential energy surface of the formation of N-(carbomylcarbamothioyl) benzamide computed using the B3LYP/6-31g(d) level of theory.
frequency of zero. The dipole moment of P2 is 7.7072 De-bye. P2 is the product of the reaction and this consistent with experimentally obtained product. The relative free energy of P2 was 10.04 kcal/mol. Figure 1 gives the potential energy surface of the formation of N-(carbomylcarba-mothioyl)benzamide computed using the B3LYP functional and 6-31g(d) basis set and the corresponding optimized conformation of the intermediates and transition states in gas phase for the formation of N-(carbomylcarba-mothioyl)benzamide. All the other functionals used for this computation (B3PW91, M06 and wB97XD) gave inconsistent results hence a good potential energy surface could not be obtained.
The bond length has been computed for all the species. Table 1 gives the bond angles of starting species, intermediates, transition states and the products for the re-
action. The bond distances of the atoms in the aromatic range are approximately equal whilst the bond lengths of the groups that are at the site of activity or directly attached to the site of activity undergo significant changes in most cases. Whilst table 2 gives the compiled results of the computed reaction pathway using the B3PW91/6-31G(d), M06/6-31G(d) and Wb97XD/6-31G(d) functionals and basis set. These results do not present a clear reaction path way as given by the B3LYP/6-31G(d).
Figure 2 gives the structure of I1 with enlarged numbering for clarity.
Table 1. Comparison of the bond lengths of the starting species, intermediates, transition states and products.
Figure 2. Structure of I1 with enlarged numbering for clarity.
Bond length/Â	I1	Ts1	P1	Ts2	P2
02-C9	1.23	1.20	1.23	1.21	1.21
C8-S	1.58	1.67	1.57	1.64	1.634
N3-C9	1.39	1.36	1.39	1.40	1.39
C4-C3	1.39	1.39	1.39	1.40	1.40
C4-C5	1.40	1.40	1.40	1.40	1.40
C3-C2	1.40	1.40	1.40	1.40	1.40
C8-N1	1.20	1.27	1.21	1.40	1.40
C5-C6	1.40	1.40	1.40	1.40	1.40
N1-C7	1.43	1.41	1.44	1.41	1.41
C2-C7	1.48	1.49	1.48	1.50	1.50
C2-C1	1.41	1.40	1.41	1.40	1.41
C7-01	1.21	1.22	1.21	1.21	1.21
C6-C1	1.39	1.39	1.39	1.39	1.39
C9-N2	1.38	1.51	1.39	1.42	1.42
N2-C8	3.70	1.66	3.66	1.401	1.39
Table 2. Compiled results from the computation of the reaction mechanism using the B3PW91/6-31G(d), M06/6-31G(d) and Wb97XD/6-31G(d) functionals and basis set.
Species Dipole moment
Imaginery frequency
Free Energies
Change in entropy (hartrees)
Change in entropy (kcal/mol)
B3PW91/6-31G(d)
I1
TS1 P1 TS2 P2
4.89 10.39 5.16 9.24 12.29
-1060.862 -1060.798 -1060.819 -1060.844 -1060.877
0
0.063 0.043 0.017 -0.015
0
39.69 27.07 10.82 -9.28
M06/6-31G(d)
I1	2.83	0	-1060.734	0	0
Ts1	3.52	1	-1060.717	0.017	10.42
P1	5.37	0	-1060.676	0.057	35.88
Ts2	9.25	1	-1060.701	0.033	20.67
P2	12.05	0	-1060.734	-0.0003	-0.19
Wb97XD/6-31G(d)					
I1	3.74	0	-1060.940	0	0
Ts1	10.73	1	-1060.865	0.075	46.97
P1	2.11	0	-1060.941	0.001	-0.684
Ts2	6.19	1	-1060.933	0.007	4.18
P2	9.33	0	-1060.932	0.008	5.09
4. HOMO-LUMO Analysis
Table 3 gives the frontier orbitals for all the species in the reaction pathway computed using the B3PLYP functional at the 6-31g(d) basis set. The HOMO-LUMO gaps showed that there is consistency in the information obtained from the HOMO-LUMO gaps of the different species. For I1 the gap was 0.17727 eV this is consistent with high energy barrier hence heat or any other source of energy to help to form the Ts1 with a HOMO-LUMO gap of 0.17424 eV, the HOMO-LUMO gap obtained for P1 was 0.17881 eV this narrows to 0.13336 eV in Ts1 with the final product P2 giving a HOMO-LUMO gap of 0.14175 eV.
Figure 3 gives the :H NMR monitoring of the reaction over a 3 hour period at 30 minute intervals. The amino group gets attached after 30 minutes with the amino group changing environment upon attachment hence the disappearance of the signal at 4.50 ppm with time, whilst the signal at 12.00 ppm increases in intensity with time.
5. Conclusion
The reaction mechanism of N-(carbomylcarba-mothioyl)benzamide has been successfully computed with B3LYP/6-31g(d). The reaction is proposed to proceed through two transition states Ts1 (the rate determining
Table 3. Frontier orbitals of reacting species, transition states, intermediates and product computed using B3LYP/6-3
	I1/eV	Ts1/eV	P1/eV	Ts2/eV	P2/eV
LUMO+4	-0.044	0.010	0.043	0.035	0.040
LUMO+3	-0.005	0.005	-0.004	0.022	0.027
LUMO+2	-0.013	-0.006	-0.013	-0.022	-0.021
LUMO+1	-0.041	-0.033	-0.047	-0.031	-0.034
LUMO	-0.081	-0.034	-0.080	-0.064	-0.069
HOMO	-0.258	-0.208	-0.259	-0.198	-0.210
HOMO-1	-0.261	-0.213	-0.261	-0.240	-0.237
HOMO-2	-0.264	-0.240	-0.262	-0.266	-0.265
HOMO-3	-0.269	-0.241	-0.270	-0.274	-0.271
HOMO-4	-0.276	-0.242	-0.277	-0.277	-0.274
HOMO-LUMO GAP (eV)	0.177	0.174	0.179	0.133	0.142
&.S	G JO	7.5	7.0	6.S	6.0	S.S	5.0	4.5	4.0	15
Figure 3. 1H NMR monitoring of the progress of the reaction with time at 30 minute intervals
step) which is a high energy species. Ts2 which is the second transition state has a lower energy hence it easily leads to the product. The HOMO-LUMO gaps showed the transition states have narrower HOMO-LUMO gaps compared to the starting materials, intermediate and products. The narrower HOMO-LUMO gaps confirms the ease of their transitions and hence their high reactivity.
6. Acknowledgements
I would like to thank the National Research Foundation (South Africa) for awarding me a postdoctoral fellowship.
7. References
1.	L. Lu, H. Hu, H. Hou, B. Wang, Comput & Theo Chem. 2013, 1015, 64-71. DOI:10.1016/j.comptc.2013.04.009
2.	W. Kohn, A. D. Becke, R. G. Parr, J. Phys. Chem. 1996, 100, 12974-12980. DOI:10.1021/jp960669l
3.	K. Burke, J. Chem. Phys. 2012, 136, 150901. DOI: 10.1063/1.4704546
4.	S. F. Sousa, P. A. Fernandes, M. J. Ramos, J. Phys. Chem. A 2007, 111, 10439-10452. DOI:10.1021/jp0734474
5.	M. Korth, S. Grimme, J. Chem. Theory. Comput. 2009, 5, 993-1003. DOI:10.1021/ct800511q
6.	K. E. Riley, B. T. Holt, K. M. Merz, J. Chem. Theory. Comput. 2007, 3, 407-433. DOI:10.1021/ct600185a
7.	C. J. Cramer, D. G. Truhlar, Phys. Chem. Chem. Phys. 2009, 11, 10757-10816. DOI:10.1039/b907148b
8.	L. Goerigk, S. Grimme, Phys. Chem. Chem. Phys. 2011, 13, 6670-6688. DOI:10.1039/c0cp02984j
9.	J. Harris, Phys. Rev. A 1984, 29, 1648-1659. DOI: 10.1103/PhysRevA.29.1648
10. E. K. U. Gross, C. R. Proetto, J. Chem. Theory Comput. 2009, 5, 844-849. DOI:10.1021/ct9000334
11.	A. D. Becke, J. Chem. Phys. 1993, 98, 1372-1377. DOI: 10.1063/1.464304
12.	A. D. Becke, J. Chem. Phys. 1993, 98, 5648-5652. DOI: 10.1063/1.464913
13.	R. H. Hertwig, W. Koch, Chem. Phys. Lett. 1997, 268, 345351. DOI:10.1016/S0009-2614(97)00207-8
14.	G. E. Scuseria, V. N. Staroverov, Progress in the development of exchange-correlation functionals, in: C. E. Dykstra, G. Frenking, K .S. Kim, G. E. Scuseria (Eds.), Theory and Applications of Computational Chemistry: The First 40years, Amsterdam, Elsevier, 2005, pp. 669-724. DOI:10.1016/B978-044451719-7/50067-6
15.	A. Shiroudi, M. S. Deleuze, J. Mol. Model 2015, 21, 301. DOI: 10.1007/s00894-015-2839-2
16.	Y. Hu, L. Gao, Z. Dai, G. Sun, T. Zhang, S. Jia, Y. Dai, X. Zhang, J. Mol. Model 2016, 22, 56.
DOI: 10.1007/s00894-016-2923-2
17.	Q. Meng, F. Wang, J. Mol. Model 2016, 22, 60. DOI: 10.1007/s00894-016-2930-3
18.	R. Zhang, L. Ling, B. Wang, J. Mol. Model 2010, 16, 19111917. DOI:10.1007/s00894-010-0686-8
19.	A. D. Becke, J. Chem. Phys. 1993, 98, 5648-5652. DOI: 10.1063/1.464913
20.	C. Lee, W. Yang, R. G. Parr, Phys. Rev. B 1988, 37, 785-789. DOI: 10.1103/PhysRevB.37.785
21.	P. J. Stephens, F. J. Devlin C. F. Chabalowski, M. J. Frisch, J. Phys. Chem. 1994, 98, 11623-11627.
DOI: 10.1021/j100096a001
22.	W. J. Zhang, Y. Y. Zhu, D. H. Wei, M. S. Tang, J. Comput. Chem. 2012, 33, 715-722. DOI:10.1002/jcc.22906
23.	Y. Zhu, Z. F. Chen, Z. J. Guo, Y. Wang, G. J Chen. J. Mol. Model. 2009, 15, 469-479. DOI:10.1007/s00894-008-0432-7
24.	K. Fukui, Acc. Chem. Res. 1981, 14, 363-368. DOI:10.1021/ar00072a001
25.	C. Gonzalez, H. B. Schlegel, J. Chem. Phys. 1989, 90, 21542161. DOI:10.1063/1.456010
26.	C. Gonzalez, H. B. Schlegel, J. Phys. Chem. 1990, 94, 55235527. DOI:10.1021/j100377a021
Povzetek
S teorijo gostotnega funkcionala smo z uporabo B3LYP / 6-31g (d) funkcionalnega in baznega seta preučevali mehanizem tvorbe N- (karbomilkarbamotiioil) benzamida in rezultate primerjali s podatki, dobljenimi iz časovnega spremljanja poteka reakcije z 'H NMR spektroskopijo. Ugotovili smo, da za potek reakcije lahko predlagamo dve prehodni stanji: Ts1 (stopnja, ki določa hitrost reakcije) z izredno nestabilnimi delci, ki za nadaljevanje reakcije zahtevajo določeno orientacij in Ts2 z nižjo energijo, ki vodi do produkta. Računanje reakcijska pot je bila izvedena tudi z uporabo B3PW91 / 6-31G (d), M06 / 6-31G (d) in Wb97XD / 6- 31G (d) funkcionalnih in baznih setov, a dobljeni rezultati ne dopuščajo zanesljive napovedi reakcijske poti.
DOI: 10.17344/acsi.2017.4018
Acta Chim. Slav. 2018, 65, 333-343
Scientific paper
Biological Significance of Hetero-Scaffolds Based Gold(III) Complexes
Darshana N. Kanthecha,1 Dilip B. Raval,2 Vasudev R. Thakkar2 and Mohan N. Patel1*
1 Department of Chemistry, Sardar Patel University, Vallabh Vidyanagar-388 120, Gujarat, India, Phone number: (+912692) 226856*218
2 B. R. Doshi School of Bioscience, Sardar Patel University, Vallabh Vidyanagar-388 120, Gujarat, India
* Corresponding author: E-mail: jeenen@gmail.com
Received: 18-11-2017
Abstract
Synthesized ligands and complexes, [Au(Ln)Cl2]Cl, have been characterized by various techniques such as elemental analysis, LC-MS, FT-IR, UV-Vis, 'H and 13C NMR spectroscopy, conductance measurement and magnetic moments measurement. The experimental results show that complexes exhibit higher antibacterial activity against Gram(+ve) and Gram(-ve) microorganisms than free ligands. The in vitro cytotoxicity and cellular level cytotoxicity suggest that Au(I-II) complexes show better activity than corresponding ligands. The DNA interaction study has been evaluated using absorption titration. The experimental evidence indicates (Kb = 1.08 - 3.44 • 105 M-1) that all the complexes have been bind to HS-DNA by intercalation mode. To further verify the nature of interaction viscosity measurement and molecular modeling have been carried out which suggest the intercalation binding between complex and DNA. The Schizosaccharo-myces pombe cell DNA cleavage has been performed using agarose gel and their photographic images of complexes show smearing of DNA due to DNA cleavage from the nucleus.
Keywords: Gold(III) complexes; DNA interaction; molecular modeling; antibacterial activity; Schizosaccharomyces pombe cell
1. Introduction
A recent discovery is focused on metal based chemo-therapeutics targeting the double-helix DNA, due to the interesting structural diversity of metal complexes caused by different coordination numbers and types of ligands. DNA binding study with metal complexes expand knowledge in molecular biology, which show the possibilities of specifically targeting therapeutically related proteins or enzymes.1-3 It is a challenging task to design a metal-based drug, which may be applicable to various medical treatments. The successful use of cisplatin as drug in medicine raises the interest in the study of metal complexes and their various biomedical applications.4 Complexes with square planar geometry (d8 system), isoelectronic and isostructural to platinum(II) complexes have been designed as potential alternatives for binding with DNA.5 DNA binding has gained main attention on biological activities because DNA contains exact genetic data for maintaining the function of cell growth. DNA replication is essential for the life cycle of
biological organisms. The alteration of the DNA replication occurs when the drugs bind to the site of the DNA, which leads to the inhibition of the DNA replication. The drugs that exhibit such types of alteration in DNA are known as anticancer agents. Also, metal complexes can interact with biomolecules irreversibly and enhanced the effectiveness and lower the dosages for in vivo application. Cytotoxicity of drugs is habitually associated with their DNA-binding properties.6,7 Therefore, DNA interaction study has a great importance for the design of new transition-metal drugs and their biological applications.8 Application of gold(III) complexes are interesting and developing topics in the area of nanomaterial, nanotechnology, and catalyst.9 In the last decade, new studies of gold(III) complexes have been focused on the treatment of cancer,10 rheumatoid arthritis,11 HIV,12 malaria13 and antiproliferative action.14 Comparatively, metals, including nickel, cadmium, chromium, and arsenic, can prompt carcinogenesis and hence are less favorable to the body. These limitations have triggered a search for platinum/gold-based compounds that show low-
er toxicity, higher selectivity and a broader spectrum of activity.15 By following the interactions between gold complexes and various biological targets, much progress can be made in understanding the mode of action of gold complexes. The low doses on a daily basis for capacity oral administration are the main challenge for a new gold-based drug, in addition to improved cytotoxicity and pharmacological profile.16 While developing new gold-based anti-cancer drugs, it is essential to design a drug that would target a specific biological site, resulting in minimizing or no unwanted side effects.17 Gold(III) complexes are promising anticancer agents with enhanced stability, having a superior chemotherapeutic index in terms of increased bio-availability, higher cytotoxicity, and promising selectivity associated with lower toxicity towards healthy tissues. Therefore, in vitro screening should be mandatory and should be followed by relevant in vivo studies, which remain the most important evaluation of drug effectiveness in preclinical sites.18 In comparison to cisplatin, gold(I) and gold(III) complexes represent a class of compounds that have shown to possess both in vitro and in vivo cytotoxicity, antimicrobial activity and different mode of action, and have received great attention among medicinal inorganic chemists.19,20 Anticipated in vivo reduction of gold(III) complexes in the mammalian environment, selection of N-coordinating bidentate and polydentate chelating ligands can satisfactorily stabilize complexes under physiologically relevant conditions. Some complexes possess equal or higher cytotoxicity than cisplatin.21-24
The N-coordinating hydrazone and their metal complexes have been investigated earlier demonstrating potential biological application.25-27 Various derivatives of Schiff bases based on pyridine, pyrimidine, coumarin, quinoline, ben-zoxazole, indole, purine, pyrrole, furan, benzofuran and tri-azoles moieties have been reported earlier for their biological activities, such as antibacterial, antitubercular, anti-inflammatory, anthelmintic, antiviral and antioxidant activities.28,29 Gold(III) complexes are the great promise as new pharmacological agents. Therefore, to examine the biological activity of gold(III) complexes, synthesis and characterization of gold(III) complexes have been carried out. The interaction of gold(III) complexes with HS-DNA has been investigated using UV-Vis spectroscopy, viscosity measurement and molecular modeling. The in vitro cytotoxicity and in vivo cytotoxicity of gold(III) complexes examined with a brine shrimp bioassay and S. pombe cell, respectively. The antibacterial activity of the synthesized complexes was determined by determining their MIC (minimum inhibitory concentration) values against five different microorganisms.
2. Materials and Method 2. 1. Materials and Reagents
All analytical grade chemicals and solvent were purchased commercially and used as received without further
purification. HAuCl4 • 3H2O was purchased from S.D. Fine-Chem Ltd. (India.). 2,2-Dipyridylketone, 2-pyridine-carboxaldehyde, 2-acetylpyridine, phenylhydrazine, ben-zhydrazide, HS-DNA and EDTA were purchased from Sigma Aldrich Chemical Co. (India). Agarose, Luria Broth (LB), ethidium bromide (EtBr), Tris-acetyl-ESTA (TAE) and bromophenol blue were purchased from Himedia (India). Culture for antibacterial activity Bacillus subtilis (B. subtilis-7193), Staphylococcus aureus (S. aureus-3160), Pseudomonas aeruginosa (P. aeruginosa-1688), Escherichia coli (E. coli-433) and Serratia marcescens (S. marc-escens-7103) were purchased from the Institute of Micro-bial Technology (Chandigarh, India).
2. 2. Physical Measurement
The 1H and 13C NMR spectra were recorded with a Bruker Avance (400 MHz) spectrometer using deuterated dimethyl sulfoxide and deuterated chloroform solvent. FT-IR Shimadzu spectrophotometer was used for IR spectra in the range 4000-300 cm-1. C, H, and N elemental analysis were performed with a model Perkin-Elmer 240 elemental analyser. Melting points were determined in open capillaries on hermoCal10 melting point apparatus (Analab Scientific Pvt. Ltd, India). The LC-MS spectra were recorded using Thermo scientific mass spectrometer (USA). The electronic spectra of metal complexes were recorded on a UV-160A UV-Vis spectrophotometer, Shimadzu, Kyoto (Japan). The Gouy's method used for magnetic measurement of metal complexes taking mercury tetrathiocy-anatocobaltate(II) as the calibrant (xg = 16.44 • 10-6 cgs units at 20 °C), citizen balance. Antibacterial study was carried out by means of laminar air flow cabinet Toshiba, Delhi (India). AlphaDigiDoc™ RT. Version V.4.0.0 PC-Image software, CA (USA) used for the Photo quantization of the DNA cleavage activity.
2. 3. Synthesis and Spectral Characterization of Ligands
Generally, Schiff base was prepared by condensation of ketone/aldehyde with an amine as per earlier reported literature method.25 The reaction mixture of substituted pyridyl ketone (0.05 mol), substituted hydrazine (0.05 mol) and 4-5 drops of conc. HCl (as a catalyst) in methanol (15 mL) were refluxed with stirring for 6 h. After completion of the reaction, the reaction mixture was cooled to room temperature and the resulting yellow solids were collected by filtration, washed with ethanol and dried in vac-cuo. General reaction scheme for the synthesis of ligand and complexes is shown in Scheme 1.
2,2'-((2-Phenylhydrazono)methylene)dipyridine (L1) It has been synthesized according to the above procedure using 2,2'-dipyridyl ketone and phenylhydrazine. Yield: 72%, m.p. 186 °C, mol. wt. 274.33 g mol-1; Anal. Calc. for
Scheme 1. Synthesis of ligands (L'-L4) and their gold(III) complexes (I-IV).
C17H14N4: calc. (found) (%): C, 74.43 (74.23); H, 5.14 (5.17) ; N, 20.42 (20.45). 'H NMR (400 MHz, CDCl3-d') 5/ ppm: 6.93-6.98 (1H, m, Hn), 7.25-7.36 (6H, m, H5,5',9,10,12,13), 7.74-7.83 (3H, m, H3,4,4>), 8.02 (1H, d, J = 8.0 Hz, H3>), 8.59 (1H, d, J = 4.8, Hz, H6), 8.75 (1H, d, J = 4.8 Hz, H6>), 13.83 (1H, s, NH). 13C NMR (100 MHz, CD-Cl3-d1) 5/ppm: 113.7 (CH C9,13), 122.3 (CH Cn), 123.5 (CH C33>), 125.4 (CH C55>), 129.2 (CH C1012), 136.6 (CH C4,4'), 144.4 (Cquaternary C), 147.9 (CH C6,6>)', 153.2 (Canary C2,2>), 157.8 (Cquaternary C). FT-IR (KBr, 4000-400 cm-1): 3270 v(N-H)stretching; 3047 v(C-H)stretching; 1589 v(C=N); 1427 v(C=C); 1149 v(C-N); 794 v(C-H)bending. LC-MS (m/z, %): 275 (100) [M+].
2-((2-Phenylhydrazono)methyl)pyridine (L2) It has been synthesized according to the above procedure using 2-pyr-idinecarboxaldehyde and Phenylhydrazine. Yield: 68%, m.p. 195 °C, mol. wt. 197.24 g mol-1. Anal. Calc. for C12HnN3: calc. (found) (%): C, 73.07 (73.21); H, 5.62 (5.40); N, 21.30 (21.15). 1H NMR (400 MHz, CDCl3-d1) 5/ ppm: 6.91-6.95 (1H, m, Hn), 7.15-7.20 (3H, m, H5,913), 7.29-7.34 (2H, m, H10,12), 7.70 (1H, dd, J = 1.6, 6.0 Hz,' H4), 7.82 (1H, s, H3), 8.02 '(1H, d, J = 8.0 Hz, H6), 8.18 (1H, s, H7), 8.55 (1H, s, NH). 13C NMR (100 MHz, CDCl3-d1) 5/ ppm: 113.0 (CH C9,13), 119.6 (CH C3), 120.7 (Cn), 122.5 (CH C5), 129.3 (CH C1012), 136.2 (CH C4), 137.2 (CH C7), 144.1 (Cquaternary Oj), 149.0 (CH C6), 154.5 (Cquaternary Q). FT-IR (KBr, 4000-400 cm-1): 3271 v(N-H)stretching; 3086
v(C-H)stretching; 1527 v(C=N); 1465 v(C=C); 1149 v(C-N); 750 v(C-H)bending. LC-MS (m/z, %): 197 (100) [M+].
2-(1-(2-Phenylhydrazono)ethyl)pyridine (L3) It has been synthesized according to the above procedure using 2-ace-tyl pyridine and phenyl hydrazine. Yield: 75%, m.p. 166 °C, mol. wt. 211.27 g mol-1. Anal. Calc. for C13H13N3: calc. (found) (%): C, 73.91 (73.85); H, 6.20 (6.30); N, 19.89 (19.93). 1H NMR (400 MHz, CDCl3-d1) 5/ppm: 2.47 (3H, s, H14) 7.23 (1H, t, J = 6.0 Hz, H11), 7.39 (1H, d. J = 7.2 Hz, H9), 7.48 (1H, d, J = 6.8, H13), 7.66 (1H, t, J = 8.0 H5), 7.92 (2H, dd, J = 7.2, 10.4 Hz, H10,12), 8.08 (1H, t, J = 3.6, Hz, H4), 8.48 (2H, d, J = 10.4 Hz, H3,6), 10.92 (1H, s, N-H). 13C NMR (100 MHz, CDCl3-d1) 5/ppm: 12.7 (CH3 C14), 121.3 (CH C9,13), 124.3 (CH C3), 127.6 (CH C11), 128.6 (CH C5),
132.1 (CH C10,12), 132.7 (Cquaternary C8), 136.7 (CH QX 148.3 (Cquaternary C7), 149.1 (CH C6), 152.9 (Cquaternary C2).
FT-IR (KBr, 4000-400 cm-1): 3255 v(N-H)stretching; 3024 v(C-H)stretching; 2823 v(CH3)stretching; 1604 v(C=N); 1450 v(C=C); 1373 v(C-C); 1172 v(C-N); 779 v(C-H)bending. LC-MS (m/z, %): 211 (100) [M+].
2-((2-Phenylhydrazono)methyl)pyridine (L4) It has been synthesized according to the above procedure using 2-pyr-idinecarboxaldehyde and benzhydrazide. Yield: 75%, m.p. 142 °C, mol. wt. 225.25 g mol-1. Anal. Calc. for C13H11ON3: calc. (found) (%): C, 69.32 (69.22); H, 4.92 (4.97); N, 18.66 (18.69); O, 7.10 (7.20). 1H NMR (400 MHz, CDCl3-d1) 5/
ppm: 7.21 (1H, t, J = 6.0 Hz, H12), 7.34 (2H, t, J = 6.0 Hz, H11>13), 7.44 (1H, t, J = 8.0 Hz, H5) 7.64 (lH, t, J = 6.0 Hz, H4) 7.72-8.05 (2H, m, H3,6), 8.12 (1H, s, H7) 8.53 (2H, d, J = 4.4 Hz, H10,14), 11.21 (1H, s, N-H). 13C NMR (100 MHz, CDCl3-d1) 5/ppm: 121.3 (CH C3), 124.3 (CH C4), 127.2 (CH C1014), 128.5 (CH Cn,12), 132.1 (CH CB), 132.7 (Cqua-ternary C9), 136.7 (CH C4), 148.3 (CH C7), 149.0 (CH C6), 152.9 (Cquaternary C2), 167.1 (C=O C8). FT-IR (KBr, 4000400 cm-1): 3271 v(N-H)stretching; 3032 v(C-H)stretching; 1689 v(C=O); 1604 v(C=N); 1450 v(C=C); 1165 v(C-N); 794 v(C-H)bending. LC-MS (m/z, %): 226 (100) [M+].
2. 4. Synthesis and Spectral Characterization of Gold Complexes
The prepared methanolic solution of a ligand (L1-L4) (0.25 mmol) was added dropwise into HAuCl4-3H2O (0.25 mmol) in methanol (5 mL) with stirring at room temperature for 10 min and the reaction mixture was refluxed for further 2 h. After complete complexation orange precipitate has appeared and filtered, washed with diethyl ether and dried in vaccuo.
[Au(L1)Cl2]Cl (I) It has been synthesized using 2,2'-((2-phenylhydrazono)methylene)dipyridine (L1). Yield: 59%, m.p. >250 °C, mol. wt.: 577.64 g mol-1; Anal. Calc. for C17H14AuCl3N4: calc. (found) (%): C, 35.35 (36.76); H, 2.44 (2.24); N, 9.70 (10.11). 1H NMR (400 MHz, DMSO-d6) S/ppm: 7.69 (1H, t, J = 6.0 Hz, H11), 7.89 (3H, d, J = 5.6 Hz, H3'10,12), 8.01 (2H, d, J = 7.6 Hz, H913), 8.05 (1H, d, J = 7.2 Hz, ' H3), 8.12-8.16 (1H, m, H50, 8.38 (2H, dd, J = 8.0, 9.2 Hz, H5,6'), 8.93 (1H, d, J = 4.8 Hz, H4'), 9.30 (1H, d, J = 8.8 Hz, H^), 9.35 (1H, d, J = 7.2 Hz, H6), 12.60 (1H, s, N-H). 13C NMR (100 MHz, DMSO-d6) 5/ ppm: 122.1(CH C9,13), 123.0(CH C11), 124.3(CH C3'), 125.5(CH C5'), 126.0(CH C5), 127.8(CH C1012), 131.2(CH
C3), 133.3(CH C4'), 133.6(Cquaternary C8), 134.5(Cquaternary
C2'), 135.9(CH C6'), 138.8(CH C4), 140.2(Cquaternary C7), 147.8(Cquaternary C2), 150.7(CH C6). FT-IR (KBr, 4000-400 cm-1): 3271 v(N-H)stretehing; 3062 v(C-H)stretching; 1581 v(C=N); 1481 v(C=C); 1126 v(C-N); 825 v(C-H)bending; 416 v(Au-N); 347 v(Au-Cl). LC-MS (m/z, %): 541 (100) [M+].
C2). FT-IR (KBr, 4000-400 cm-1): 3290 v(N-H)stretching; 3055 v(C-H)stretching; 1597 v(C=N); 1427 v(C=C); 1134 v(C-N); 748 v(C-H)bending; 509 v(Au-N); 354 v(Au-Cl). LC-MS (m/z, %): 430 (100) [M+].
[Au(L3)Cl2]Cl (III) It has been synthesized using W-(di(pyridin-2-yl)methylene)benzohydrazide (L3). Yield: 57%, m.p. >250 °C, mol. wt. 479.13g mol-1; Anal. Calc. for C13H13AuCl2N3: calc. (found) (%): C, 32.59 (32.43); H, 2.73 (2.81); N, 8.77 (8.85). 1H NMR (400 MHz, DMSO-d6) 5/ppm: 2.38 (3H, s, H14), 6.92 (1H, t, J = 7.2 Hz, H11), 7.05 (1H, d, J = 8.0 Hz, H5), 7.18 (1H, s, H3), 7.31 (2H, t, J = 6.8 Hz, H1012), 7.51 (2H, d, J = 7.6 Hz, H913), 8.24(1H, t, J = 4.0 Hz, ' H4), 8.67 (1H, d, J = 5.6 Hz, H6), 10.18 (1H, s, N-H). 13C NMR (100 MHz, DMSO-d6) 5/ppm: 12.9 (CH3 C14), 114.4 (CH C9,13), 123.6 (CH C11), 124.2 (CH C5), 127.36 (CH C10,12), '132.0 (CH C3), 133.6 (Cquaternary C7), 137.3 (CH C6), 147.4 (Cquaternary Q), 148.2 (CH C4), 156.1 (Cquaternary C2). FT-IR (KBr, 4000-400 cm-1): 3286 v(N-H)
stretching
; 3001 v(C-H)stretching; 2893 v(CH3)stretching; 1604
v(C=N); 1494 v(C=C); 1435 v(C-C); 1157 v(C-N); 825 v(C-H)bendin; 510 v(Au-N); 339 v(Au-Cl). LC-MS (m/z, %): 443 (100) [M+].
[Au(L4)Cl2]Cl (IV) It has been synthesized using 2-((2-phenylhydrazono)methyl)pyridine (L4). Yield: 55%, m.p. >250 °C, mol. wt. 493.12g mol-1; Anal. Calc. for C13H11AuCl2N3O: calc. (found) (%): C, 31.66 (31.50); H, 2.25 (2.18); N, 8.52 (8.90). 1H NMR (400 MHz, DMSO-d6) 5/ppm: 7.07 (1H, d, J = 2.4 Hz, H12), 7.20 (1H, d, J = 2.0 Hz, H3), 7.33 (1H, s, H7), 7.52 (2H, t, J = 7.6 Hz, H1113), 7.60 (1H, t, J = 4.4 Hz, H5), 7.66 (1H, t, J = 2.8 Hz H4), 7.93 (2H, d, J = 11.6 Hz, H10,14), 8.13 (1H, dd, J = 7.6, 12 Hz, H6), 11.50 (1H, s, N-H). 13C NMR (100 MHz, DMSO-d6) 5/ ppm: 122.8 (CH C10,14), 127.9 (CH C5), 128.2 (CH C11,13), 128.9(CH C3), 129.7(CH C12), 130.0(CH C6), 132.3 (CH
C4), 133.0(Cquaternary C9^ 138.4 (CH C7), 149.1 (Cquaternary
C2), 165.9 (C=O C8). FT-IR (KBr, 4000-400 cm-1): 3270 v(N-H)stretching; 3093 v(C-H)stretching; 1720 v(C=O); 1597 v(C=N); 1481 v(C=C); 1157 v(C-N); 748 v(C-H)bending; 417 v(Au-N); 347 v(Au-Cl). LC-MS (m/z, %): 458 (100) [M+].
[Au(L2)Cl2]Cl (II) It has been synthesized using 2-(1-(2-phenylhydrazono)ethyl)pyridine (L2). Yield: 62%, m.p. >250 °C, mol. wt. 465.11g mol-1; Anal. Calc. for C12H11AuCl2N3: calc. (found) (%): C, 30.99 (30.95); H, 2.38 (2.42); N, 9.03 (8.89). 1H NMR (400 MHz, DMSO-d6) 5/ppm: 7.15 (1H, d, J = 4.8 Hz, H11), 7.27 (1H, d, J = 5.6 Hz, H3), 7.40 (1H, d, J = 5.2 Hz, H4), 7.50-7.67 (3H, m, H7,9,13), 7.92-8.22 (3H, m, H6,10,12), 8.62-8.72 (1H, m, H5), 10.63 (1H, s, NH). 13C NMR (100 MHz, DMSO-d6) 5/ppm: 122.8 (CH C913), 127.9 (CH C11), 128.9 (CH C3), 129.7 (CH C10,12), 131.3 (CH C5), 132.6 (CH C6), 133.3 (Cquaternary Cg), 138.3 (CH C7), 146.0 (CH C4), 149.1 (Cquaternary
3. Biological Screening of Synthesized Compounds 3. 1. UV-Vis Absorbance Titration
Binding mode and interaction strength of DNA with metal complexes have been examined effectively by electronic absorption spectra (UV-Vis absorbance titration) using Herring Sperm DNA (hS-DNA) with e = 12858 dm3 mol-1 cm-1 in phosphate buffer solution (pH 7.2). The stock solutions of the complexes were prepared in DMSO. The absorption titration has been performed by the con-
centration of complex keeping constant (20 ^M) and continuous adding the volume of DNA (100 ^L), and incubated for 10 min at room temperature. By using absorption spectral titration data .Kb value have been determined from the ratio of the slope to intercept from the plot of [DNA]/ (ea-ef) versus [DNA].30
3. 2. Viscosity Measurement
An Ubbelohde viscometer maintained at a constant temperature of 27 ± 0.1 °C in a thermostatic jacket. It was used to measure the flow time of HS-DNA in phosphate buffer (pH 7.2) with a digital stopwatch. Flow time measurements of each compound were carried out three times to calculate average flow time. Data were presented as relative specific viscosity ((n/^o)1/3) versus binding ratio ([Drug]/[DNA],31 where q and n0 is the viscosity of DNA in the presence of complex and viscosity of DNA alone, respectively. Viscosity values have been calculated from the observed flow time of DNA containing solutions (t > 100 s), corrected for the flow time of buffer alone (t0), q x (t-t0).32
3. 3. Molecular Docking Study
The interaction between DNA and complexes at the molecular level were studied by advanced computational technique. The rigid molecular docking study has been executed using HEX 8.0 software to conclude the orientation of the Au(III) complexes binding to DNA. The most stable configuration was selected as the input for investigation. Mole file of coordinates of metal complexes was prepared for optimized structure and was rehabilitated to .pdb format using CHIMERA 1.5.1 software. HS-DNA used in the experimental, the structure of the DNA of sequence (5'-d(CGCGAATTCGCG)-3')2 (PDB id: 1BNA, a familiar sequence used in oligodeoxynucleotide study) obtained from the Protein Data Bank (http://www.rcsb.org/pdb). All calculations were carried out on an Intel CORE i5, 2.20 GHz based machine running MS Windows 8.1 64 bit as the operating system. The default parameters were used for the docking calculation with correlation type shape only, FFT mode at the 3D level, grid dimension of 6 with receptor range 180 and ligand range 180 with twist range 360 and distance range 40.33
3. 4. In vitro Cytotoxicity
The toxicity of bioactive compounds were carried out using brine shrimp (Artemia cysts) lethality bioassay.34 Brine shrimp (Artemia cysts) eggs were hatched in a shallow rectangular plastic dish (22 x 32 cm), filled with artificial seawater, which was prepared by dissolving sea salt in double distilled water. An unequal partition was made in the plastic dish with the help of a perforated device. Approximately 50 mg of eggs were sprinkled into the large compartment and was opened to ordinary light. After two
days, nauplii were collected by a pipette from the lighted side. A sample of the test compound was prepared by dissolving 10 mg of each compound in 10 mL of DMSO. From these stock solutions, solutions were transfer to 18 vials to make final concentration 2, 4, 8, 12, 16, and 20 mg mL-1 (three sets for each dilutions were used for each test sample and mean of three sets was used for LC50 calculation), and three vials were kept as control having same amount of DMSO only. When the nauplii were ready, 1 mL of seawater and 10 shrimps were added to each vial, and the volume was adjusted with seawater to 2.5 mL per vial. After 24 h, the number of survivors was counted. Data were analyzed by simple logit method to determine the LC50 values, in which log of concentration of samples were plotted against percentage of mortality of nauplii.
3. 5. Cellular Level Cytotoxicity Assay
Eukaryotic Schizosaccharomyces pombe was an important organism for the study of effects of the metal complexes at cellular level (cytotoxicity) to the DNA damage (genotoxicity). S. pombe were grown in liquid yeast extract media in 150 mL Erlenmeyer flask containing 50 mL of yeast extract media. To acquire the enough growth of S. pombe, flask was incubated at 30 °C on shaker at 150 rpm (24 to 30 h). Then the cell culture was treated with synthesized ligands, complexes and DMSO (as control) at different concentrations (2, 4, 6, 8, 10 mg mL-1), further allowed to growth for 16-18 h. Next day, the treated and control cells were centrifuged at 10,000 rpm for 10 min to remove the media and wash the cells with phosphate buffer saline (PBS) three times. Cells were resuspend in 500 ^L of PBS. Take the 10 ^L of cells suspension and 10 ^L 0.4% trypan blue dye in vial and incubate for 5 min. at room temperature, then 10 ^L from the above mixture were put on glass slide and observed in a microscope (40X). The treated cells were observed as colourless or blue in colour, dead cells permitting the entry of trypan blue dye in the cells and appear as blue, whereas the live cells resisted the entry of dye and appear as colourless. Percentage viability was counted in triplicate where number of dead cells and number of live cells were counted in three microscopic fields and calculated average percentage of live cells.35
3. 6. Antibacterial Activity
All of the newly synthesized gold(III) complexes (I-IV) were screened for their antibacterial activity using Staphylococcus aureus, Bacillus subtilis, Serratia marcescens, Pseudomonas aeruginosa and Escherichia coli micro-organisms. The broth dilution technique has been used to determine the bactericidal effect by minimum inhibitory concentration (MIC) in terms of ^M. MIC is the lowest concentration that prevents the microbial growth incubated at 37 ± 1 °C for 24 h. MIC was determined in liquid media containing 0.2-3500 ^M of the tested compound. A precul-
ture of bacteria was grown in Luria broth overnight at 37 °C. First culture was used as a control to examine normal growth and second culture 20 pL of the bacteria and compound at the desired concentration were added to monitor bacterial growth by measuring turbidity of the culture after 18 h. If a certain concentration of a compound inhibit bacterial growth, half of the concentration of the compound was tested. This procedure was carried out up to the concentration that inhibited the growth of bacteria. All equipment and culture media were sterilized.
3.	7. DNA Cleavage Study
Effect of compounds on the integrity of S. pombe cell's DNA were studied by agarose gel electrophoresis. The S. pombe cells were grown and treated as in cellular level cytotoxicity assay. After treatment, cells were harvested by centrifugation 10,000 rpm for 10 min than washed with PBS three times. Cells were resuspended in 0.5 pL of distilled water after removing supernatant, then transferred to screw-cap microfuge tube containing 0.2 mL of lysis buffer (2% Triton X-100, 1% sodium dodecyl sulphate, 100 mM NaCl, 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA (pH 8.0)), 0.2 mL mixture of phenol/chloroform/isoamyl alcohol (25:24:1) and glass beads. Vortex the screw-cap having cells to break the cells for 1 min to 3-4 times with alternating cooling. It was centrifuged for 5 min and transferred the upper aqueous layer to other tube followed by the addition of 3 M sodium acetate (1/10 volume) and 100% ethanol (2.5 volume) and centrifuged again for 5 min. Pellet were collected and wash with 70% ethanol. Then 20-30 pL Tris-EDTA buffer was added in the vail contain pellet. Agarose gel electrophoresis were carried out using 0.8% agarose, Tris-acetate-EDTA buffer and staining with ethidium bromide (0.5 mg mL-1) at 100 V. Image was captured by a CCD camera and Alpha Digi Doc system was used for analysing gel.36
4. Result and Discussion
4.	1. NMR and IR Spectra of Synthesized
Compound
The NMR and IR spectra of the synthesized ligands and gold(III) complexes are represented in supplementary material and data are shown in the experimental section. The 1H NMR spectra of compounds show a downfield shift of the C-6 proton next to the coordinating nitrogen from 0.19 to 0.76 ppm, this indicates that the ligand coordinate to the gold ion. The 5 ppm values for the NH hydrogen in complexes I and III show upfield shift by 1.23 and 0.76 ppm, whereas complexes II and IV show downfield shift from 2.08 to 0.3 ppm, respectively, due to different environment near to N-H hydrogen. The 5 values of phenyl ring protons in the ligands (L1-L4) are observed at
6.92-7.35 ppm and after the coordination with gold metal ion they are shifted to 6.94-8.61 ppm. Infrared spectra of the ligands show intense band for v(C=N)ar, v(C-N)ar, v(C-H)ar, v(C=C)ar, v(N-H) at 1527-1604 cm-1, 11491172 cm-1, 3024-3086 cm-1, 1427-1465 cm-1 and 32553271 cm-1, respectively. In gold(III) complexes band are slightly shifted for v(C=N)ar, v(C-N)ar, v(C-H)ar, v(C=C) ar, v(N-H) at 1581-1604 cm-1, 1126-1157 cm-1, 30013093 cm-1, 1427-1481 cm-1, 3270-3290 cm-1, respectively and intense band for v(Au-N) appear in the region 416510 cm-1 and v(Au-Cl) in the region 339-354 cm-1.37 According to these data we can conclude that ligands coordinate to the gold ion.
4. 2. Magnetic Moments, Electronic Spectra and Conductance Measurements
Magnetic moments measurement of gold(III) complexes has been carried out at room temperature. The value of gold(III) complexes are zero B.M, which corresponds to all paired electron in low-spin 5d8 configuration and confirms that gold complexes have +3 oxidation states with low-spin t2g6 eg2 configuration. The electronic spectra (Fig. 1) of all the complexes in DMSO exhibit intra-ligand charge transfer band (n-n*) and MLCT band (n-n*) at 254-274 nm and 290-327 nm, respectively. The molar conductivity value of the gold(III) complexes are in the range of 83-102 cm2 O-1 mol-1 at room temperature, which suggests the electrolytic nature of metal complexes having one counter ion outside the coordination sphere. So, we conclude that all synthesized gold(III) complexes having chlorine as counter ion and square-planar geometry. The single-crystal structure of similar square-planer gold(III) with bidentate N, N/N, C ligation have also been reported.38-40
i -
9.9 '
US '
*■' 1 / \
LU
11 '
9 -.-
1»	JMI	*H
IVlTflfDBlh [U|
Figure 1. UV absorption spectra of representative complex I in DMSO
4. 3. Binding Behaviour of Complex with HS DNA
Electronic absorption titration is one of the technique to investigate the binding mode of metal complexes
with DNA and provides intrinsic DNA binding constants (Kb) using Herring Sperm DNA (HS-DNA) with e = 12858 dm3 mol-1 cm-1 in phosphate buffer solution (pH 7.2). Strong stacking interaction among chromophore of complex and DNA base pair result in hypochromic shift and red shift (bathochromic shift) in absorption spectra which generally indicate that intercalation binding.41,42 The increase in DNA volume leads to hypochromic shift with bathochromic shift (Fig. 2), and concludes the intercalation mode of binding between compounds and DNA base pair. The plot of [DNA] /(ea-ef) versus [DNA] were analyzed to evaluate Kb determined from the spectroscopic titration data from the following equation:
[da/a] [DNA]
1
[sa - ef] [sb - sf] Kb(eb - ef)
(1)
Figure 3. Effect on relative viscosity of HS DNA under the influence of increasing amount of complexes at 37 ± 0.1 °C in phosphate buffer (pH 7.2) with standard deviation.
Kh values for gold(III) complexes I-IV (Fig. 2) are 3.05 • 105 M-1, 3.44 • 105 M-1, 1.08 • 105 M-1 and 2.75 • 105 M-1, respectively. Complex II shows higher binding affinity towards HS-DNA in comparison to other complex.
Figure 2. Absorption spectra of complex I with increasing concentration of HS-DNA after incubation for 10 min for each addition at 37 °C in phosphate buffer (pH 7.2). Inset: Plots of [DNA]/(£a-£f) versus [DNA] for the titration of DNA with gold(III) complexes.
4. 4. Hydrodynamic Volume Measurement
Viscosity measurement is the most useful study of DNA interaction in the absence of X-ray crystallographic data.31 Interaction of complex moiety with DNA alters the length of DNA duplex and directly influences on the intrinsic viscosity. The intrinsic viscosity depends on the mode of interaction with concentration of complexes. This phenomenon may be explained by insertion of the complex between base pairs, leading to an increase in the separation of base pairs at the intercalation sites and thus an increase in overall DNA length.43 The increase in viscosity confirms that the Au(III) complexes are bound to HS-DNA by intercalation. Plot of relative specific viscosity (n/ n0)1/3 versus [complex]/[DNA] in Fig. 3 shows increase in viscosity of the DNA with the addition of complexes.
4. 5. Orientation of Docked Structure
Docking study was implemented to determine the orientation and to calculate binding energy of the gold(III) complexes with DNA using HEX 8.0 software. Molecular docking study of the complexes with the B-DNA (PDB ID: 1BNA) duplex of sequence (5'-d(CGCGAATTCGCG)-3')2 was performed to investigate binding site along with the preferred orientation of complex inside the DNA helix. The study show that the complexes under investigation interact with DNA via an intercalation mode involving outside edge stacking interaction with oxygen atom of the phosphate back bone. From the ensuing docked structures, it is clear that the complexes fit well into the interca-lative mode of the targeted DNA and A-T rich region stabilized by van der Waal's interaction and hydrophobic contacts.44 The theoretically found binding energies of

Figure 4. Docked structure of complex I with the HS-DNA duplex of sequence (5'-d(CGCGAATTCGCG)-3')
docked complexes I-IV are -264.01, -229.63, -261.34 and -261.19 kJ mol-1, respectively. The more negative values of the binding energy, more effective binding between DNA and target molecules.45 The docking study is shown preferential intercalation binding when complexes interact with DNA. Results obtained by molecular docking suggest similar binding as determined by viscosity measurements and absorption titrations.
4. 6. Brine Shrimp Lethality Bioassay
For the discovery and isolation of bioactive compounds with significant cytotoxic potential, the simple and inexpensive methodology employed was Brine shrimp (Artemia cysts) lethality bioassay.34 By this activity, we can discover commercially important bioactive compounds. Data were analyzed by the log concentration of sample vs % mortality of nauplii that gives LC50 values. LC50 values of synthesized ligands and gold(III) complexes in the range of 12.0-26.2 ^g/mL and 7.1-12.5 ^g/mL, respectively. The obtained results were compared with the standard drug cisplatin (LC50 = 3.13 ^g/mL).46 Cytotoxicity of synthesized ligand and complexes are shown in Fig. 5, which suggest that tested compounds exhibit strong ability to interact with the biological model system and the effectiveness of the compound is ordered as follows: cisplatin > I > IV > II > III > L1 > L4 > L3 > L2. Most of the drugs exert their pharmacological effects by interaction with the biological system through receptors, subcellular components and enzyme. The brine shrimp assay had served the purpose of exploration of numerous pharmacological properties of natural products as well as synthesized compound to serve as a potential candidate for the preparation of effective medicines against various diseases.47
Figure 5. Cytotoxicity of synthesized ligand and complexes by brine shrimp assay.
Figure 6. S. pombe cell viability represents as the percentage with standard deviation for three independent experiments of synthesized compounds.
of compounds is cisplatin > I > IV > II > III > L1 > L4 > L3 > L2 > HAuCl4. A general reflection of the result is that toxicity varies with the N-donor moiety and as the concentration of compounds increased the cytotoxicity was also increased.
4. 8. Antibacterial Activity
Bioactivation potentials were evaluated using minimum inhibition concentration (MIC). MIC value is a minimum concentration of compounds that induced a complete growth inhibition. All the synthesized gold(III) complexes (I-IV) have been screened for their antibacterial activity against two Gram(+ve) (Bacillus subtilis (B. subti-lis-7193) and Staphylococcus aureus (S. aureus-3160)) and three Gram(-ve) (Pseudomonas aeruginosa (P. aerugino-sa-1688), Escherichia coli (E. coli-433) and Serratia marc-escens (S. marcescens-7103)) bacteria. A comparative study of in vitro antibacterial activity of the ligands and their complexes indicates that the metal complexes increase activity against five different bacteria. Reason for this enhancing of antibacterial activity of complexes may be considered in the light of an Overtone's concept44 and chelation theory.48 As summarized in Figure 7, MIC values of li-
4. 7. In vivo Cytotoxicity
Cytotoxic study of synthesized compounds at a cellular level has been carried out through eukaryotic Schizo-saccharomyces pombe (S. pombe) cell.44 A comparative cy-totoxicity of free ligand and their complexes was carried out by trypan blue assay. After 17 hours of the treatment, many of the S. pombe cells were killed due to toxic nature of the compound. The observed cytotoxicity data of ligands and complexes are in the range of 76-95% and 6088%. From the data recorded, complex I is the most potent amongst all the compounds. From Fig. 6, it is concluded that the synthesized complexes are the good cytotoxic agent than that of respective ligands. The order of potency
crm	L) 11 u u I n m IV
V/i t ; ;	Sflifll	mStrinJ	' V ' : : W.'	lUii
Figure 7. Minimum inhibition concentration (MIC) values of synthesized compounds given in |iM.
gands and complexes are in the range of 250-340 ^M and 68-112 ^M, respectively. The results show that the complexes are more effective compared to the ligands but less effective compared to the standard drugs gatifloxacin (GFLH) and norfloxacin (NFLH). The complex I and IV are comparatively potent than complex II and III against all bacteria. Antimicrobial activity of cisplatin drug has been reported earlier against S. aureus, P. aeruginosa and E. coli, and comparable results suggest that synthesized gold(III) complexes are more effective on bacteria.49
4. 9. Effect of the Compound on the Integrity of S. pombe Cell's DNA
DNA extraction has been carried out from S. pombe cells for the study of DNA cleavage by agarose gel electrophoresis.36 The effects of the compound on the integrity of DNA are shown in Figure 8.
Figure 8. Photogenic view of cleavage of S. pombe DNA (1 pgL-1) with series of compounds using 1% agarose gel containing 0.5 (pgL-1) EtBr. All reactions were incubated in TE buffer (pH 8) at a final volume of 10 pgL-1 for 24 h at 37 °C.
The smearing of DNA in agarose gel suggests that the damage occurs due to the toxic nature of the compound, whereas control cell DNA appeared in the intact band. The complexes exhibit good genotoxicity compare to metal salt and ligands. So, the complexes are toxic at the cellular level and break the DNA from the nucleus to express their toxic effect. The general observation from the Fig. 8 is that the smearing of DNA is increases with the increase in the amount of complexes, which suggests the cytotoxic nature of the complexes.
5. Conclusion
In this study, pyridyl moiety based hydrazone N-co-ordinating ligand and gold(III) based complexes have been synthesized and characterized by JH NMR, 13C NMR and IR spectroscopy and LC-MS. The observed values
from conductivity measurement and magnetic moment suggest the square planar geometry of gold(III) complexes having one chloride as the counter ion. Electronic absorption titration and viscosity studies suggest intercalation mode of binding between the compound and HS-DNA duplex. Further binding mode verifying by the data generated from docking study promote that intercalating orientation with HS-DNA duplex of sequence (5'-d(CGC-GAATTCGCG)-3')2. All complexes show strong in vitro and in vivo cytotoxicity and antibacterial activity. Result of DNA cleavage by gel electrophoresis shows DNA smearing due to the toxicity of compounds. The all biological experiments illustrate that the gold(III) complexes as potential biologically active agent. So, this study hypothesize that further detailed investigation of these compounds can explore the potential useful pharmacological effects.
6. Conflict of Interest
The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
7. Acknowledgments
The authors thankful to the Head, Department of Chemistry, Sardar Patel University, Vallabh Vidyanagar, Gujarat, India, for providing the laboratory facilities, SAIF Panjab university for C, H, N and ESI-MS analysis, DST-PURSE Sardar Patel University, Vallabh Vidyanagar for LC-MS analysis. U.G.C. New Delhi for providing financial assistance of UGC-BSR grant No. C/2013/BSR/Chemis-try/1573.
8. References
1.	K. C. Nicolaou, D. Rhoades, Y. Wang, R. Bai, E. Hamel, M. Aujay, J. Sandoval, J. Gavrilyuk, J. Am. Chem. Soc. 2017, 139, 7318-7334. DOI:10.1021/jacs.7b02655
2.	H.-J. Zhong, L. Lu, K.-H. Leung, C. C. L. Wong, C. Peng, S.-C. Yan, D.-L. Ma, Z. Cai, H.-M. David Wang, C.-H. Leung, Chem. Sci. 2015, 6, 5400-5408. DOI:10.1039/c5sc02321a
3.	C. Yang, W. Wang, J.-X. Liang, G. Li, K. Vellaisamy, C.-Y. Wong, D.-L. Ma C.-H. Leung, J. Med. Chem. 2017, 60, 25972603. DOI:10.1021/acs.jmedchem.7b00133
4.	T. Yang, C. Tu, J. Zhang, L. Lin, X. Zhang, Q. Liu, J. Ding, Q. Xu, Z. Guo, Dalton Trans. 2003, 3419-3424. DOI:10.1039/B305109A
5.	N. Pantelic, B. B. Zmejkovski, J. Trifunovic-Macedoljan, A. Savic, D. Stankovic, A. Damjanovic, Z. Juranic, G. N. Kaluder-ovic, T. J. Sabo, J. Inorg. Biochem. 2013, 128, 146-153. DQI:10.1016/j.jinorgbio.2013.08.002
6.	M. N. Patel, B. S. Bhatt, P. A. Dosi, Spectrochim. Acta, Part A 2013, 110, 20-27. D01:10.1016/j.saa.2013.03.037
7.	S. Tabassum, S. Yadav, Inorg. Chim. Acta 2014, 423, 204-214. D0I:10.1016/j.ica.2014.07.056
8.	R. Vafazadeh, A. C. Willis, M. M. Heidari, N. Hasanzade, Acta Chim. Slov. 2014, 62, 122-129. DOI: 10.17344/acsi.2014.797
9.	V. Amani, A. Abedi, S. Ghabeshi, H. R. Khavasi, S. M. Hos-seini, N. Safari, Polyhedron 2014, 79, 104-115.
DOI: 10.1016/j.poly.2014.04.064
10.	C. D. Sanghvi, P. M. Olsen, C. Elix, S. Peng, D. Wang, Z. Chen, D. M. Shin, K. I. Hardcastle, C. E. MacBeth, J. F. Eichler, J. Inorg. Biochem. 2013, 128, 68-76. D0I:10.1016/j.jinorgbio.2013.07.014
11.	A. E. Finkelstein, D. T. Walz, V. Batista, M. Mizraji, F. Rois-man, A. Misher, Ann. Rheum. Dis. 1976, 35, 251-257.
12.	P. N. Fonteh, F. K. Keter, D. Meyer, J. Inorg. Biochem. 2011, 105, 1173-1180. DOI: 10.1016/j.jinorgbio.2011.05.011
13.	K. Fourmy, M. Gouygou, O. Dechy-Cabaret, F. Benoit-Vical, C. R. Chim. 2017, 20, 333-338. D0I:10.1016/j.crci.2016.06.008
14.	T. V. Serebryanskaya, A. S. Lyakhov, L. S. Ivashkevich, J. Schur, C. Frias, A. Prokop, I. Ott, Dalton Trans. 2015, 44, 1161-1169. D0I:10.1039/C4DT03105A
15.	U. Ndagi, N. Mhlongo, M. E. Soliman, Drug. Des. Devel. Ther. 2017, 11, 599-616. D0I:10.2147/DDDT.S119488
16.	V. Milacic, Q. P. Dou, Coord. Chem. Rev. 2009, 253, 16491660. D0I:10.1016/j.ccr.2009.01.032
17.	C. Marzano, L. Ronconi, F. Chiara, M. C. Giron, I. Faustinelli, P. Cristofori, A. Trevisan, D. Fregona, Int. J. Cancer 2011, 129, 487-496. D0I:10.1002/ijc.25684
18.	C. Nardon, G. Boscutti, D. Fregona, Anticancer Res. 2014, 34, 487-492.
19.	C. Martín-Santos, E. Michelucci, T. Marzo, L. Messori, P. Szumlas, P. J. Bednarski, R. Mas-Ballesté, C. Navarro-Ran-ninger, S. Cabrera, J. Alemán, J. Inorg. Biochem. 2015, 153, 339-345. D0I:10.1016/j.jinorgbio.2015.09.012
20.	B. D. Glisic, M. I. Djuran, Dalton Trans. 2014, 43, 5950-5969. D01:10.1039/C4DT00022F
21.	S. Iwashita, Y. Saito, H. Ohtsu, K. Tsuge, Dalton Trans. 2014, 43, 15719-15722. D0I:10.1039/C4DT02279C
22.	S. J. Sabounchei, P. Shahriary, S. Salehzadeh, Y. Gholiee, D. Nematollahi, A. Chehregani, A. Amani, New J. Chem. 2014, 38, 1199-1210. D0I:10.1039/C3NJ01042B
23.	K. N. Kouroulis, S. K. Hadjikakou, N. Kourkoumelis, M. Ku-bicki, L. Male, M. Hursthouse, S. Skoulika, A. K. Metsios, V. Y. Tyurin, A. V. Dolganov, E. R. Milaeva, N. Hadjiliadis, Dalton Trans. 2009, 10446-10456. D0I:10.1039/B909587J
24.	S. Wang, W. Shao, H. Li, C. Liu, K. Wang, J. Zhang, Eur. J. Med. Chem. 2011, 46, 1914-1918.
DOI: 10.1016/j.ejmech.2011.02.031
25.	M. Bakir, O. Green, M. Wilmot-Singh, J. Mole. Struct. 2010, 967, 174-182. D0I:10.1016/j.molstruc.2010.01.005
26.	G. Tamasi, L. Chiasserini, L. Savini, A. Sega, R. Cini, J. Inorg. Biochem. 2005, 99, 1347-1359. D0I:10.1016/j.jinorgbio.2005.03.009
27.	A. A. R. Despaigne, J. G. d. Silva, A. C. M. d. Carmo, F. Sives,
O. E. Piro, E. E. Castellano, H. Beraldo, Polyhedron 2009, 28, 3797-3803. DOI:10.1016/j.poly.2009.07.059 2S. V. T. Angelova, V. Valcheva, N. G. Vassilev, R. Buyukliev, G. Momekov, I. Dimitrov, L. Saso, M. Djukic, B. Shivachev, Bi-oorg. Med. Chem. Lett. 2017, 27, 223-227. DOI:10.1016/j.bmcl.2016.11.071
29.	K. El-mahdy, A. El-Kazak, M. Abdel-Megid, M. Seada, O. Fa-rouk, Acta Chim. Slov. 2016, 63, 18-25.
DOI: 10.17344/acsi.2015.1555
30.	P. A. Dosi, M. N. Patel, B. S. Bhatt, Acta Chim. Slov. 2012, 59, 622-631.
31.	G. Cohen, H. Eisenberg, Biopolymers 1969, 8, 45-55. DOI:10.1002/bip.1969.360080105
32.	S. Mondal, B. Pakhira, A. J. Blake, M. G. B. Drew, S. K. Chat-topadhyay, Polyhedron 2016, 117, 327-337. DOI:10.1016/j.poly.2016.05.052
33.	M.-L. Liu, M. Jiang, K. Zheng, Y.-T. Li, Z.-Y. Wu, C.-W. Yan, J. Coord. Chem. 2014, 67, 630-648.
DOI: 10.1080/00958972.2014.884218
34.	B. N. Meyer, N. R. Ferrigni, J. E. Putnam, L. B. Jacobsen, D. E. Nichols, J. L. McLaughlin, Planta Med. 1982, 45, 31-34. DOI:10.1055/S-2007-971236
35.	J. V. Mehta, S. B. Gajera, M. N. Patel, J. Biomole. Struct. Dyn. 2016, 1-9. DOI: 10.1080/07391102.2016.1189360
36.	P. B. Patel, V. Thakkar, Asian J. Cell Biol. 2013, 8, 22-32. DOI:10.3923/ajcb.2013.22.32
37.	R. Krikavová, J. Hošek, P. Suchy, J. Vančo, Z. Trávnícek, J. Inorg. Biochem. 2014, 134, 92-99.
DOI: 10.1016/j.jinorgbio.2014.02.002
38.	R. W.-Y. Sun, C.-M. Che, Coord. Chem. Rev. 2009, 253, 16821691. DOI:10.1016/j.ccr.2009.02.017
39.	M. Frik, J. Fernández-Gallardo, O. Gonzalo, V. Mangas-San-juan, M. González-Alvarez, A. Serrano del Valle, C. Hu, I. González-Alvarez, M. Bermejo, I. Marzo, M. Contel, J. Med. Chem. 2015, 58, 5825-5841.
DOI: 10.1021/acs.jmedchem.5b00427
40.	A. N. Wein, A. T. Stockhausen, K. I. Hardcastle, M. R. Saa-dein, S. Peng, D. Wang, D. M. Shin, Z. Chen, J. F. Eichler, J. Inorg. Biochem. 2011, 1Q5, 663-668. DOI:10.1016/j.jinorgbio.2011.01.006
41.	S. Mistri, H. Puschmann, S. C. Manna, Polyhedron 2016, 115, 155-163. DOI:10.1016/j.poly.2016.05.003
42.	M. Gaber, H. A. El-Ghamry, S. K. Fathalla, Spectrochim. Acta, Part A 2015, 139, 396-404. DOI:10.1016/j.saa.2014.12.057
43.	M. N. Patel, M. R. Chhasatia, D. S. Gandhi, Bioorg. Med. Chem. Lett. 2009, 19, 2870-2873. DOI:10.1016/j.bmcl.2009.03.078
44.	J. V. Mehta, S. B. Gajera, P. Thakor, V. R. Thakkar, M. N. Patel, RSC Adv. 2015, 5, 85350-85362. DOI:10.1039/C5RA17185G
45.	N. Deepika, C. S. Devi, Y. P. Kumar, K. L. Reddy, P. V. Reddy, D. A. Kumar, S. S. Surya, S. Satyanarayana, J. Photochem. Pho-tobiol., B 2016, 16Q, 142-153.
DOI: 10.1016/j.jphotobiol.2016.03.061
46.	M. V. Lunagariya, K. P. Thakor, D. N. Kanthecha, M. N. Patel, J. Organomet. Chem. 2018, 854, 49-63. DOI:10.1016/j.jorganchem.2017.11.012
47. M. N. Ahmed, K. A. Yasin, K. Ayub, T. Mahmood, M. N. Tahir, B. A. Khan, M. Hafeez, M. Ahmed, I. ul-Haq, J. Mol. Struct. 2016, 1106, 430-439. DOI: 10.1016/j.molstrac.2015.11.010
48.	B. Tweedy, Phytopathology 1964, 55, 910-914.
49.	N. Chowdhury, T. L. Wood, M. Martínez-Vázquez, R. García-Contreras, T. K. Wood, Biotechnol. Bioeng. 2016, 113, 1984-1992. D01:10.1002/bit.25963
Povzetek
Sintetizirane ligande in komplekse, [Au(Ln)Cl2]Cl, smo okarakterizirali z različnimi tehnikami, kot so elementna analiza, LC-MS, FT-IR, UV-Vis, 'H in 13C NMR spktroskopija, merjenje prevodnosti in magnetnega momenta. Eksperimentalni rezultati kažejo, da imajo kompleksi višjo antibakterijsko aktivnost proti Gram(+) in Gram(-) mikroorganizmom kakor prosti ligandi. In vitro citotoksičnost in citotoksičnost na celičnem nivoju kažeta, da imajo Au(III) kompleksi boljše aktivnosti kakor ligandi. Študija interakcij z DNA je bila izvedena z absorpcijsko titracijo. Na podlagi eksperimentalnih podatkov (Kb = 1.08 - 3.44 • 105 M-1) sklepamo, da se vsi kompleksi interkalirajo na HS-DNA. Za dodatno potrditev narave interakcij smo izvedli meritve viskoznosti in tudi molekulsko modeliranje. Spremljali smo tudi cepitev DNA pri Schizosaccharomycespombe na agarose gelu, pri čemer posnetki kažejo cepitev DNA.
DOI: 10.17344/acsi.2017.4026	Acta Chim. Slov. 2018, 65, 344-353	©commohs
Scientific paper
Polypropylene Blends with m-EPR Copolymers: Mechanical and Rheological Properties
Iztok Švab,1'* Andela Pustak,2'* Matjaž Denac,3 Andrijana Sever Škapin,4 Mirela Leskovac,5 Vojko Musil3,6 and Ivan Šmit2
1 ISOKON, Production and Processing of Thermoplastics, Ltd, Mestni trg 5a, 3210 Slovenske Konjice, Slovenia
2 Ruder Boškovic Institute, Division of Materials Chemistry, Bijenička 54, 10002 Zagreb, Croatia
3 University of Maribor, FEB Maribor, Institute of Technology, Razlagova 14, 2000 Maribor, Slovenia
4 Slovenian National Building and Civil Engineering Institute, Department of Materials, Laboratory for polymers,
Dimičeva 12, 1000 Ljubljana, Slovenia
5 University of Zagreb, Faculty of Chemical Engineering and Technology, Savska 16, 10 000 Zagreb, Croatia
6 Faculty of polymer technology, Ozare 19, 2380 Slovenj Gradec, Slovenia
* Corresponding author: E-mail: Iztok.Svab@isokon.si phone: ++386 (0)3 75711 37; fax: ++386 (0)3 757 10 63 apustak@irb.hr phone: ++ 385 1 4571255
Received: 22-11-2017
Abstract
The effects of two metallocene ethylene-propylene-based elastomers (m-EPR1 and m-EPR2) differing in molecular mass and viscosity on mechanical, rheological and interfacial properties were compared. The m-EPR elastomers were added to iPP in 2.5, 5, 10, 15, and 20 vol.%. Torque values, elongation at break and impact strength measured of the iPP/m-EPRl blends were higher than the iPP/m-EPR2 blends due to higher molten viscosity of m-EPRl than m-EPR2 copolymer. Slight differences in Young moduli as well as in tensile strength at yield and at break might indicate that tensile properties of iPP/m-EPR blends were not significantly affected by difference in viscosity or molecular mass, miscibility and spherulite size. Optimization diagrams indicated the metallocene m-EPR copolymers are efficient impact modifiers for polypropylene and showed good balancing of mechanical properties in iPP/m-EPR blends.
Keywords: Isotactic polypropylene; metallocene ethylene-propylene-based elastomers; blends; mechanical properties; adhesion parameters
1. Introduction
The addition of different types of specially designed elastomers to isotactic polypropylene is the common way to increase the toughness and to improve impact properties of the polypropylene. The blending of the semi-crystalline isotactic polypropylene by melt mixing with different elasto-meric rubbers have been studied for three decades now.1-12 The most frequent used elastomers in modification of isto-tactic polyproylene are ethylene propylene diene monomer (EPDM),2-3 ethylene-propylene rubber (EPR),4,5,6,7 sty-rene-butadiene-styrene triblock copolymer (SBS),8,9 or
styrene-ethylene/butylene-styrene triblock copolymer (SEBS)9,10 and elastomer PEOC, copolymer of ethylene and octene (PEOC).11 The prior role of this elastomers is to modify/improve the impact properties of polyolefins and to achieve certain level of compatibility (e.g. partial miscibilli-ty or co-crystabillity if possible) with polymeric matrix to additionally improve other properties as well.
The investigation of polypropylene-based copoly-mers or ethylene-propylene elastomers with polyolefins, was mostly oriented on achieving better optimization of mechanical properties and consequently other properties as well.
Zhang and coworkers studied the influence of copo-lymerization on structure and mechanical properties of iPP/EPR random copolymer in situ blends. The investigation showed that the mechanical properties of the blends, including the impact strength and flexural modulus, depended on copolymerization conditions. The impact strength was influenced also by the amount of random copolymer.12
Nitta et al. investigated the mechanical properties for the binary blends of isotactic polypropylene (iPP) and random copolymers of ethylene-propylene (EP).13 The iPP/ EP blends were partly miscible in the melt. The addition of the novel EP copolymers played an important role in the modification of mechanical properties of iPP and final morphology.13 Grain et al. studied the influence of the molecular weight of dispersed phase in ethylene-propylene rubber in modified isotactic polypropylene (iPP/EPR) blend.14 The ductile-brittle transitions did not correlate linearly with Mw, suggesting the macroscopic behavior of the blend is controlled by the morphology of the EPR particles. Dynamical mechanical analysis (DMA) showed relationship between molecule relaxation processes and mechanical properties. Similar investigation was done by Oracio and coworkes 15 who studied the rubber molecular relaxations with DMA and obtained information about mechanical characteristics and the deformation me-chamisms for the investigated iPP/EPR materials.15 Oracio and coworkes showed that the iPP phase is more effective in stiffening the matrix and provide better tensile elastic behaviour than EPR based materials.15
An iPP/EPR blend in-situ synthesized by spherical Ziegler-Natta catalyst has also been investigated by the same investigation group.16 The synergistic effect between random copolymer and copolymer has been found to be the key factor for high impact strength at low temperature. The thermal study clearly shows that, polyethylene PE segments of different lengths in the segmented copolymer fractions can form crystalline lamellae of different thickness.16
The influence of the nucleation (agents) of ethylene-propylene rubber modified isotactic polypropylene on ductile-brittle transition of iPP/EPR blends was studies by Grein and coworker and have found positive effects on mechanical properties.17
Trongtorsak and coworkers also reported improvement of mechanical properties of iPP/m-EPR blends with
the addition of calcium stearate as ^-nucleation agent, especially the improvement of notched Izod and strength.18 Thereby, metallocene EPR copolymers (m-EPR) with propylene being the major component (> 80 wt% according to producer) were applied as impact modifiers for polypropylene in our investigation. Two chosen Vista-maxx™ thermoplastic elastomers, signed as m-EPR1 and m-EPR2, are actually specialty co/terpolymers of propylene balanced with ethylene and other a-olefins with different viscosity (e.g. different molecular mass) and compatible with various polyolefins in different extent.19,20
The goal was to study the mechanical properties of iPP/m-EPR blends and to compare the experimental and calculated results using some custom models for mechanical properties. Comprehensive study of interaction in iP-P/m-EPR blends with different content of elastomer was also preformed to estimate the influence of interactivity and possible miscibility of m-EPR elastomers with isotac-tic polypropylene primarly on mechanical properties.
2. Experimental Part 2. 1. Materials
Isotactic polypropylene (trade name Moplen) used as polymer matrix was supplied by LyondellBasell, Netherlands. Two metallocene propylene-ethylene copolymers with different viscosity are used from Exxon Mobil producer. 19,20 The properties of used polymers and fillers are listed in Table 1.
2. 2. Sample Preparation
Binary iPP/m-EPR blends were prepared in a Bra-bender Plasti-Corder kneading chamber. The content of m-EPR copolymers in blends was 2.5, 5, 10, 15 and 20 vol.%. The components were kneaded for 7 min, in a chamber preheated to 200 °C, with a rotor speed of 50 min-1. After kneading, the melt was rapidly transferred to a preheated laboratory press and compression moulded into 1- and 4-mm thick plates. The pressing temperature was 220 °C, the pressure 100 bar and the pressing time 14 min for 1-mm, and 11.5 min for 4-mm thick plates. The plates were used for specimen preparation for morphology observation and mechanical testing.
Table 1. The properties of used materials
Polymer	Commercial	Density	MFI	Mn	Mw/Mn
	name	(g cm-3)	(g 10-1min-1)	(g mol-1)	
iPP	Moplen HP501L	0.90	6.0a	120.000c	5.40
m-EPR1	Vistamaxx-VM-1100	0.863	4.5b	92.900c	3.40
m-EPR2	Vistamaxx-VM-1120	0.863	20	48.100 c	2.66
a) according to ISO 1133 (230 °C/2.16 kg) b) according to ISO 1133 (200 °C/5 kg) c) measured with exclusion chromatography with PS standard
2. 3. Testing Methods
2. 3. 1. Steady State Torque (tm)
The torque value (tm) of iPP/m-EPR blends was determined from the diagram of kneading in the Brabender kneading chamber. The average tm value was calculated on the basis of 5 measurements carried out for each sample with the same filling volume.
2. 3. 2. Tensile Tests
Tensile properties of iPP/m-EPR blends (Young's modulus, yield stress and strain, tensile strength at break, elongation at break) were measured according to ISO 527 standard using Zwick 147,670 Z100/SN5A apparatus at 23 °C and strain rate of 2 mm/min. For each sample, 5 measurements were carried out.
Table 2. Surface free energy (y), dispersion (yd) and polar components (yp) of surface free energy of test liquids used for contact angle measurements
Test liquids	y(mJm"2)	yd(mJm 2)	/(mJm-2)
Water	72.8	2i.8	51.0
Formamide	58.0	39.0	19.0
Diiodomethane	50.8	50.8	0.0
of adhesion, WAB, and spreading coefficient, SAB, of all polymer/elastomer blend pairs were calculated from obtained y values using equations (2-4) and presented in Table 5:
Y AB = YA + YB~
4yJtrÉ ,
YÎ+YÈ vl + YÏ
(2)
2. 3. 3. Notched Impact Strength
Notched impact strength of iPP/m-EPR blends was measured by Zwick apparatus at 25 °C according to Charpy test (DIN 53453). For each sample, 12 measurements were carried out.
2. 3. 4. Contact Angle Measurement
Surface free energies of used polymers, as well as their corresponding dispersive and polar components, were determined by measuring contact angle. Contact angles of the isotactic polypropylene and propylene-eth-ylene copolymers were measured on a contact angle goniometer DataPhysics OCA 20 Instrument at temperature of 23 °C. Sessile drops (2^L) of test liquids: water (distilled twice X = 1.33 ^Lcm-1), formamide (p.a. 99.5%, Fluka) and diiodomethane (p.a. 99%, Aldrich) were used for the advancing contact angle measurements at 23 °C. The surface tensions of the test liquids used for contact angle measurements are presented in Table 2. The average values of at least five drops at different places of the same sample were taken and the standard deviation was always less than 2%.
Surface free energies of the iPP and elastomers (yi) were calculated using harmonic mean equation according to Wu's model presented with equation (1):21
-t-cos0) -
m?YÎ , 4 YÏYÏ
Ys + Y?
+
p i p Ys + Y;
(i)
where yp was the dispersive and yd the polar component of the surface free energy (surface tension), yi and ys were the surface tension of liquid and surface free energy of solid, respectively.
Surface free energies of the iPP and elastomers were presented in Table 4. The interfacial free energy, yAB, work
(3)
(4)
where subscripts A and B correspond to the phases in blends (A-matrix, B- elastomer) and superscripts d and p mean dispersed and polar components of interfacial free energy y. The results from Table 4 and Table 5 are presented in Adhesion parameters of iPP/m-EPR blends section.
3. Results and Discussion
3. 1. The Mixing Torque Values of the iPP/m-EPR Blends
The mixing torque values (tm) provide information how toughening elastomeric m-EPR modifier affect pro-cessabillity of the iPP/m-EPR blends. The torque values can be considered as a measure of the viscosity under the same mixing conditions, including the same filling volume. The torque tm increases by adding components in batch mixer and decreases after the polypropylene melting and reaches constant value around sixth minute of mixing (tm values in Figure 1 are measured at 7th min) due to process of homogenization and equalized viscosity of blends.22 The tm values of two blend systems begun to diverge already at minimal addition of m-EPR's (2.5 vol.% showed in Figure 1): the blends with m-EPR1 exhibit the trends of somewhat higher tm values then with m-EPR2 (especially at 20 vol.% of added m-EPR's) due to significantly higher viscosity of m-EPR1 than m- EPR2 copolymer (see MFI values in Table 1). Moreover, the tm values of blends with m-EPR1 (MFI = 4.5 g 10-1min-1) were somewhat higher than plain polypropylene (MFI = 6.0 g 10-1min-1) due to somewhat higher viscosity of m-EPR1 than plain iPP.
Figure 1. Steady state torque of the iPP/m-EPR blends in dépendance on volume content of added elastomers
tion dependence of two-phase polymeric materials. The elastic moduli of stiffness of a material is affected by the elastic moduli of all components, fraction of components, the morphology and the interactions between the components. The E models usually presume the idealization about perfect adhesion between the phases, spherical particles and perfectly distributed minor phase through the matrix.25,26 The most simple of all models for predicting the moduli of a composite or a blend is known as the parallel model and has been considered as the upper limit of elastic modulus:
EltZ = £\<Pi + E2<p2
(5)
where the E12 is the elastic modulus of compound, Ej and E2 are the elastic modulus of components. The series model represents the lower limit of elastic modulus:
3. 2. Tensile Test
3. 2. 1. Young's Modulus
The addition of both m-EPR elastomers to iPP matrix decreases Young's modulus steadily and almost linearly due to toughening effect of elastomers (Figure 2). 7-9,23
An almost linear decrease of close E values is in accordance with the parallel model with linear combination of plastic and elastomeric components.24 Although m-EPR2 elastomer has significantly lower viscosity than m-EPR1 (MFI = 20 g 10-1min-1 in comparison to 4.5 g 10-1min-1 for m-EPR1) due to lower molecular mass (Mn = 48.100 in comparison to 92.900 g mol-1 for m-EPR1) the blends with m-EPR2 exhibit just minor decline of the E values than blends with m-EPR1 elastomer.
For a further analysis of the E data, the experimental values were compared with the values calculated by the different theoretical models based on the modulus-concentra-
Figure 2. Young's modulus of the iPP/m-EPR blends as a function of the m-EPR content compared to the theoretical predictions: (a) experimental values, (b) parallel model, (c) series model, (d) Takayanagi parallel model, (e) Takayanagi series model
1 =<Pi ] fx El,2 El
(6)
Takayanagi developed a combined series-parallel model for the tensile property E, by introducing a degree of parallelinity into the series model.27,28 It was assumed that the two-phase material can be treated as a combination of series and parallel elements. The equation for Takayanagi parallel model is given as:
(7)
and for series model:
(8)
where the E1 is the property of the matrix phase; E2 is the property of the dispersed phase. Quantities X and f are geometry factors representing phase morphology in the Takayanagi model, whereas the product is the volume fraction of the dispersed phase, and is related to the degree of series parallel coupling. Parameters X and f vary with composition and with the change in the state of dispersion. For spherical particles independently and homogeneously dispersed in a matrix, it can be assumed that X is equal to f.27,28 The Figure 2 showed that calculated models have higher values than measured experimental values for iPP/ m-EPR blends. Both Takayanagi's models showed almost the same behavior as classic series and parallel model in this case. The divergence can be related with partial misci-bility of phases in blends (not only with interfacial adhesion), geometry and dispersion of added phase in polymer matrix and other factors.25-28
3. 2. 2. Yield stress and Strain (Tensile
Strength and Elongation at Yield)
Yield stress gives additional information on polymer matrix-elastomer interactions in binary blends besides how the elastomers affect yield stress as impact modifiers.2,3 Steady, monotonous decrease of ay values with addition of both, m-EPR1 and m-EPR2 elastomers (Figure 3) indicates gradually increase of toughening similarly to gradually reduced stiffness (Figure 2) with increased elastomer content. Slightly higher ay values of the iPP/m-EPR2 than iPP/m-EPRl blends at higher elastomer contents might be ascribed to different factors and will be discussed at Tensile strength and elongation at break section.
Figure 3. Tensile strength at yield of the iPP/m-EPR blends in dependence on volume content of added elastomers and Nico-lais-Narkis model for yield strength
Nicolais and Narkis developed a model for yield strength of polymeric materials containing spherical particles for class of polymer systems based on the interphase properties.29 According to Nicolais-Narkis model, when interfacial adhesion does not exist between polymer and elastomer, the particles in matrix cannot bear the stress and it could be carried only through the matrix. Nevertheless, when a good interfacial adhesion is provided between matrix and dispersed phase the interfacial layer can transfer a fraction of stress from matrix to dispersed phase. So in this case the yield strength includes both matrix and dispersed phase contributions so the simplified equation can be expressed:
06 = M1 - 1.21^/3)
(9)
where ab and am are yield strength of blend and matrix and 0f is the volume fraction of particles, assuming that dispersed particles in polymer matrix are spherical and there is a good adhesion. This model corresponds well to iPP/m-
EPR blends containing spherical particles of m-EPR with proved good adhesion, and exhibits somewhat lower values comparing to experimental values (Figure 3).30
The extent of yield strain, £y of neat semicrystalline iPP primarily depends on the strengthening of tie molecules in amorphous interlayer (intercrystalline links) and interspherulitic links. Whereas the addition of m-EPR1 affects the elongation at yield negligibly, the addition of m-EPR2 increases yield strain steadily (Figure 4). Stronger strengthening effect of m-EPR2 than m-EPR1 elastomer has been also observed at ternary iPP/silica/m-EPR and composites.31 It could be ascribed to better stress transfer from softer m-EPR2 particles as bumpers and better mis-cibility of m-EPR2 than m-EPR1 with iPP matrix, and might also lead to higher elongations with regard to stiffer m-EPR1 particles. However, more significant divergence in strain behavior in present case could be reasonable due to more effective stretching in simpler binary blend system (without filler).
Figure 4. Elongation at yield of the iPP/m-EPR blends in dependence on volume content of added elastomers
3. 2. 3. Tensile Strength and Elongation at Break
Although the incorporation of elastomeric modifiers into iPP matrix might have complex influence to the tensile strength at break, ob values of the iPP/m-EPR blends monotonously decrease with increased elastomer content (Figure 5) similarly to steady decrease of E (Figure 2) and oy (Figure 3) values. Somewhat higher oy and ob values of the iPP/m-EPR2 than for iPP/m-EPR1 blends at higher m-EPR2 contents, has been primarily conducted (driven) by the difference in molecular weights of elastomers analogous to similar yield stress behavior.
Higher values of iPP/m-EPR2 might also be ascribed to higher crystallinity and spherulite size, compatibility or miscibility of the iPP/m-EPR2 than iPP/m-EPR1 blends and to stronger interfacial effect (interfacial free energy ) at iPP-m-EPR2 interface. However, the effects of mentioned
factors could not be resolved and ascribed to any of mentioned influencing factors due to slight difference in ay and Ob values between these two m-EPR elastomers.
Higher viscosity iPP/m-EPR2 ratio than iPP/m-EPR1 (Figure 1) leads to smaller size of dispersed m-EPR2 than m-EPR1 particles.31 Moreover, prolonged crystallization of iPP matrix with additions of both m-EPR's was affected by migration of iPP chains from the remained melt islands of both elastomers, i.e. by solidification effect.31 However, higher partial miscibility of the iPP with m-EPR2 than m-EPR1 (proved exactly by DMA31) as well as m-EPR2 with lower molecular mass and higher mobility of macromolecules than m-EPR1 macromolecules may more easily diffuse into the iPP interlamellar amorphous layer where they may form domains more or less interconnected with the amorphous iPP phase, thus increasing its thickness.16
This statement was proved by higher spherulite size of blends with m-EPR2 than m-EPR1 elastomer.31 Intra-spherulitically accommodated smaller m-EPR's dispersed particles beside their interspherulitically accommodation may indicate better stress transfer from softer m-EPR2 particles as bumpers and might also lead to higher elongations additionally.
Figure 5. Tensile strength at break of the iPP/m-EPR blends in dependence on volume content of added elastomers
The elongation at break, £b, usually behaves inversely to the tensile strength at break, ob Indeed, the £b values increases with increased m-EPR1 and m-EPR2 content almost linearly after 2.5 vol.% of elastomer (Figure 6). However, in distinct to ob values behavior, £b values of both blend systems are very close in whole concentration range. The elongation at break, £b after 5 vol.% increases exceptionally fast with respect to pure isotactic polypropylene. The reason for such profound increase is probably the plasticization effect caused by addition of the m-EPR elastomer that has great impact on elongation properties of blends acting like plasticizers dissolved in the matrix phase
Figure 6. Elongation at break of the iPP/m-EPR blends in dependence on volume content of added elastomer
in large concentration range. The slopes of £b iPP/m-EPR for both added elastomers are very similar because of very similar structure of both elastomers.
3. 3. Impact Properties
The incorporation of the m-EPR elastomers toughness plastomeric iPP matrix and increases impact strength, aK, values almost exponentially (Figure 7). The both m-EPR's considerably improve aK at additions higher than 10 vol.% of m-EPR's analogously to similar behavior with addition of poly(styrene-fo-ethylene-co-propylene) in iPP.28
These results proved that both m-EPR's have efficient rubber-toughening characteristics for polypropylene. It is known that the phase separation is essential for producing impact-resistant blends for many polymeric systems. The m-EPR elastomer dissolved in the matrix phase can act as a plasticizer, reducing the glass-transition temperature and stiffness of the matrix without increasing its toughness.32
However, other important facts influencing the impact strength of the iPP must be considered in addition to the afore mentioned facts: (non)existence of ^-phase iPP, stiffness reduction, particle-matrix adhesion (or miscibility), etc. The iPP/m-EPR's blends exhibited mainly mono-clinic a-form of the iPP in iPP/m-EPR blends,33 in distinct to the appearing of ^-phase in iPP/SEP blends with poly(-styrene-fo-ethylene-co-propylene),28 with superior impact resistance to a-phase iPP in present iPP/m-EPR blends.34 However, the toughness of the iPP/m-EPR blends is commensurable with the iPP/SEP blends.28 This fact indicates that new metallocene m-EPR copolymers exhibit higher toughening effect in comparison to SEP elastomer as custom SBC copolymer toughening agents.28 Altough the iP-P/m-EPR2 blend exhibited doubtless higher degree of miscibility than iPP/m-EPR1 blends,33 higher aK values of the iPP/m-EPR1 than for iPP/m-EPR2 blend could be observed in whole concentration range (Figure 7). This fact
could be explained by almost twice higher molecular weight of m-EPR1 than m-EPR2, e.g. by MFI value of m-EPR1 commensurable with the iPP (Table 1) that might affect impact strength in two ways. First, dispersed particles of copolymer with longer macromolecules exhibit higher toughness. Secondly, longer macromolecules or longer olefins segments similar to this one of the iPP chains may provide stronger mutual entanglements improving thus the notched impact strength (Figure 7). Similar difference in toughening effects of these two m-EPR's copolymers has been observed in composites of the iPP/ wollastonite and iPP/silica.31,35
Obviously, the effect of macromolecular length prevails the effect of miscibility in toughening of iPP/m-EPR blends.
Figure 7. Notched impact strength of the iPP/m-EPR blends in dependence on volume content of added elastomers
3. 4. iPP Matrix-elastomer Interactions
3. 4. 1. Parameter Interactivity B of iPP/m-EPR Blends
The strength of polymer-elastomer interactions can be quantitatively described using Pukanszky's model for particle-based composites, as described in equation (10).36 More specifically, equation (10) allows to investigate a linear relationship existing between the natural logarithm:
In
/ ayi: 1 + 2,5 <pd\ _ \<jyp 1 ~<Pa )
= In <Jyret = Btpd
(10)
where ayc is the yield stress of elastomer and ayp is the yield stresses of matrix, respectively; B is a term corresponding to the load carrying capability of the elastomer and depends on elastomer-matrix interactions; q>d is the elastomer volumetric fraction within polymer matrix. If ln[cyc(1 + 2.5i>f)/(ayp(1 - if)] of fraction value is plotted against of elastomer, parameter B can be calculated as a line slope, with intercept in cross section of coordinate parameter
^(of elastomer}
Figure 8. Presentation of calculated ln arel values in dependence on elastomer content
Table 3. Interaction parameter B for iPP/m-EPR blends
Blend iPP/m-EPR	Interaction parameter B
iPP/mEPR-1	0.82
iPP/mEPR-2	1.13
axes. This assumes a tensile yield stress of matrix (ayp) to be constant.
Calculated lnarel values were presented in Figure 8 in dependence on elastomer content and proportional to values of Pukanszky's36 interaction parameter showed in Table 3. Higher interaction parameter B value for iPP/m-EPR2 (1.13) than for iPP/m-EPR1 blend (0.82) corresponds to higher ay values for iPP/m-EPR2 blend. This fact corresponds well with proved higher miscibility of iPP/m-EPR2 than iPP/m-EPR1 blends.33
3. 4. 1. Adhesion Parameters of iPP/m-EPR Blends
Interfacial properties may also affect the strength of polymer-elastomer interactions. The results of the studies on the effective adhesion for a given system indicate some conditions as optimal: thermodynamic work of adhesion as a maximal, spreading coefficient as a positive value and interfacial free energy as a minimal (tends to null) (Table 3).21,37,38 The surface free energy of the polypropylene and elastomers are showed in Table 4.
Table 4. The surface free energy (y) of the iPP and elastomers and their dispersive (yd) and polar component values (yp) evaluated by using the Wu's model21
Polymer
The surface free energies (mJ/m2)
iPP
mEPR-1 mEPR-2
31.5 26.7 25.3
1.3 4.7
1.4
32.8 31.4 26.7
Table 5. Adhesion parameters yAB, WAB, SAB of the iPP/m-EPR blends
Possible		Adhesion parameters (mJ/m2)	
adhesion pairs	Interfacialfree	Work of adhesion	Spreading
	energy y ab	Wab*	coefficient SAB*
iPP/m-EPRl	2.32	62.9	-2.7
iPP/m-EPR2	0.78	59.2	-6.4
*Ymf for calculation according to Wu's equation
Higher interfacial free energy for EPR-1 than for EPR-2 were calculated with Wu's equation (1) (Table 4). The surface free energy for m-EPR1 elastomer is close to value for iPP. The ethylene-propylene copolymers m-EPR1 and m-EPR2 differed in polar component of surface free energy and the m-EPR1 is more polar than m-EPR2 and iPP with almost similar polarity.
Interfacial free energy, yAB, work of adhesion, WAB, and spreading coefficient, SAB, of all polymer/elastomer pairs for the iPP/m-EPR blends were calculated according to equations (2-4) (Table 5).
However, higher interfacial free energy for iPP-m-EPR1 (y = 2.32 mJ/m2) than for iPP-m-EPR2 (y = 0.78 mJ/ m2) indicates contrary - stronger interfacial effect of the iPP-m-EPR2 than for iPP-m-EPR1 interface. In this case the interfacial free energy, as the inversely proportioned to the strength of intermolecular interactions in polymer blends, would be more relevant for such ambiguous sys-tems.39,40,41 Higher interaction parameter B value for the iPP/m-EPR2 than for iPP/m-EPR1 blend seemed to confirm this ambiguous fact.
3. 5. Miscibility/Compatibility and Interactivity
Better miscibility of the iPP/m-EPR2 than iPP/m-EPR1 blend was confirmed with Dinamic Mechanical Analysis, DMA (one mutual intermediary maximum in E'/T curve of the iPP/m-EPR2 blend comparison to two overlapped ^-relaxation maxima of the iPP/m-EPR1 blend) in our previous paper.33 The DMA results as well as bipha-sic morphology observed by all microscopy techniques suggests that m-EPR2 molecules are not completely dissolved into the iPP amorphous region, i.e. partial miscibil-ity and compatibility between m-EPR2 particles and iPP matrix is better than with m-EPR1.33 The higher crystallin-ity due to crystallization across phase boundary at dispersed m-EPR2 particles and increased spherulite size in the iPP/m-EPR2 may affect the yield stress of semicrystal-line polymers besides higher miscibility/ compatibility.42,43
The effect of spherulite size on yield stress depends on its position on summary curve tensile strength as a function of spherulite size related to the intraspherulite yield.31 Intraspherulitical location of both dispersed m-EPR particles in the iPP matrix had been observed by polarized optical micrographs31 interspherulitical accom-
modation. Homogeneous distribution of dispersed m-EPR1 particles (some in radial directions) in TEM micrograph of iPP/m-EPRl 80/20 blend in Figure 9 also indicates intraspherulitical location of m-EPR1 particles.33
Figure 9. TEM picture of iPP/m-EPR1 80/20 with marked spheru-lites boundaries indicating intraspherulitical besides interspherulit-ical accommodation of m-EPR particles
The difference is only in somewhat thinner dispersed m-EPR2 (up to 1,2 ^m) than m-EPR1 particles (up to 2.5 ^m) due to Jordhamo law.44 It is well known that dispersed particle size and distribution may affect yield properties. It was proved that the particle size of the elastomer significantly affects the deformation and failure processes in polypropylene toughened with olefinic elastomer being small particle favouring shear yielding while coarser dispersion promotes crazing due to difference in an average surface-to-surface interparticle distance.45,46,47
3. 6. Optimization Diagrams of Mechanical Properties of iPP/m-EPR Blends
Mechanical properties are one of the most respected criteria for choosing right materials for some end-use pur-
pose. Schematic diagrams show the change in some important materials' mechanical properties by introducing one or two components in polymer matrix. The optimization diagrams of such designed materials were used for comparing their mechanical parameters with the pure iso-tactic polypropylene.
The addition of propylene-ethylene elastomers in isotactic polypropylene decreased the Young's modulus as expected due to toughening effect of elastomers. The yield strength and strength at break also decrease by addition of elastomers and the values are higher for the blends with m-EPR2 elastomer with smaller molecular mass. The few times bigger increase in impact strength in comparison to iPP is the result of addition of soft elastomers in large concentration so the role of impact modifier is completely fulfilled. Higher aK values of the iPP/m-EPRl than for iPP/ m-EPR2 blend could be explained by almost twice higher molecular weight (longer macromolecules) of m-EPR1 than m-EPR2. Optimization diagram (Figure 10) indicate good balancing of mechanical properties besides efficient effect of metallocene m-EPR copolymers as impact modifiers for polypropylene.
Figure 10. Optimization diagram of mechanical properties of iPP/ m-EPR blends with 20 vol.% of added elastomers
4. Conclusions
The effects of two metallocene ethylene-propyl-ene-based elastomers with varied contents (2,5-20 vol.% of m-EPR1 and m-EPR2) differing in molecular mass (viscosity) on mechanical, rheological and interfacial properties of the iPP/m-EPR blends were investigated. While Young's modulus, tensile strength and yield and break of the iPP/m-EPR's blends decreased, impact strength and elongation at break increased with increased elastomer content. Such behavior of presented iPP/m-EPR blends resulted primarily by prevailed toughening or plastification effect caused by spherically shaped dispersed m-EPR particles. Thereby, elongation at break and impact strength as
well as torque values of the iPP/m-EPR1 blends were higher of the iPP/m-EPR2 blends due to higher molecular mass, e.g. higher molten viscosity of m-EPR1 than m-EPR2 copolymer. However, slight divergence of almost linearly decreased E, oy and ob values of the iPP/m-EPR's blends could be ascribed to different factors (difference in crystal-linity and spherulite size, compatibility or miscibility of the iPP with m-EPR's, and interfacial effect at iPP-m-EPR interface) which could not be resolved. So the behavior of these values could not be ascribed to any of mentioned influencing factors particularly; it could be only concluded that the difference in viscosity or molecular length between two m-EPR's does not affect E, oy and ob values. Somewhat divergence of yield strain values resembles to similar divergence of torque values but in inverse mode. Whereas this divergence in torque values was governed by difference in molten viscosity of copolymers, the divergence of ey values was governed by difference in miscibility of m-EPR's with iPP matrix and by difference in stress transfer from m-EPR particles differently soft. Moreover, optimization diagrams indicated beside efficient effect of metallocene m-EPR copolymers as impact modifiers for polypropylene also its balancing effect of mechanical properties.
5. Acknowledgements
Financial support of the Ministry of Science, Education and Sports of the Republic of Croatia and the Ministry of Higher Education, Science and Technology of the Republic of Slovenia is acknowledged.
6. References
1.	H. G. Karian, in: H. G. Karian (Ed.): Handbook of polypropylene and polypropylene composites, Marcel Dekker, New York, USA, 2003. DOI:0.1201/9780203911808
2.	G. Wypych, in: G. Wypych (Ed.): Handbook of fillers, ChemTec Publishing, Toronto, Canada, 2000.
3.	R. N. Rothon, in: R. N. Rothon (Ed.): Particulate-Filled Polymer Composites, Smithers Rapra Press, Shawbury, UK, 2006.
4.	J. Karger-Kocsis, S. Fakirov, in: J. Karger-Kocsis, S. Fakirov (Eds.): Nano- and micromechanics of polymer blends and composites, Carl Hanser Verlag, Munich, Germany, 2010.
5.	R. N. Rothon, in: M. Xanthos (Ed.): Functional Fillers for Plastics, Wiley-VCH Verlag, Weinheim, Germany, 2010.
6.	X. Chen, G. Ma, J. Li, S. Jiang, X. Yuan, J. Sheng, Polym. 2009, 50, 3347-3360. DOI:10.1016/j.polymer.2009.04.069
7.	D. N. Bikiaris, G. Z. Papageorgiou, E. Pavlidou, N. Vour-outzis, P. Palatzoglou, G.P. Karayannidis, J. Appl. Polym. Sci. 2006, 100, 2684-2696. DOI:10.1002/app.22849
8.	M. Z. Rong, M. Q. Zhang, Y. X. Zheng, H. M. Zeng, R. Walter, K. Friedrich, Polym. 2001, 42, 167-183. DOI:10.1016/S0032-3861(00)00325-6
9. C. L. Wu, M. Q. Zhang, M. Z. Rong, K . Friedrich, Compos. Sci. Technol. 2002, 62, 1327-1340. DOI:10.1016/S0266-3538(02)00079-9
10.	T. H. Zhou, W. H. Ruan, Y. L. Mai, M. Z. Rong, M. Q. Zhang, Compos. Sci. Technol. 2008, 68, 2858-3066. DOI:10.1016/j.compscitech.2007.10.002
11.	A. Vassiliou, D. N. Bikiaris, E. Pavlidou, Macromol. React. Eng. 2007, 1, 488-501. DOI:10.1002/mren.200700006
12.	Y.-Q. Zhang, Z.-Q. Fan, L.-X. Feng, J. Appl. Polym. Sci. 2002, 84, 445-453. DOI:10.1002/app.10415
13.	K. Nitta, A. Tanaka, Polym. 2001, 42, 1219-1226. DOI:10.1016/S0032-3861(00)00418-3
14.	C. Grein, K. Bernreitner, M. Gahleitner, J. Appl.Polym. Sci.
2003,	87, 1702-1712. DOI:10.1002/app.11696
15.	L. D'Orazio, G. Cecchin, Polym. 2001, 42, 2675-2684. DOI:10.1016/S0032-3861(00)00631-5
16.	L. D'Orazio, C. Mancarella, E. Martuscelli, G. Sticotti, G. Cecchin, J. Appl.Polym. Sci. 1999, 72, 701-719. DOI:10.1002/(SICI)1097-4628(19990502)72:5<701: :AID-APP11>3.0.C0;2-U
17.	C. Grein, M. Gahleitner, Express. Polym. Lett. 2008, 2, 392397. DOI:10.3144/expresspolymlett.2008.47
18.	K. Trongtorsak, P. Supaphol, S. Tantayanon, Polym.Test.
2004,	23, 533-539.
DOI:10.1016/j.polymertesting.2003.11.006
19.	The use of Vistamaxx™ specialty elastomers in Thermoplastic Compounds & Blends, http://www.baixii.com/upload/ files/2015/3/2621142284.pdf (accesed March 30, 2017).
20.	S. Datta, S. Srinivas, G. Racine, in: Novel Propylene-Based Specialty Elastomers- Structure and Properties, ANTEC 62nd annual technical conference, Chicago, USA, 2004, p. 422.
21.	S. Wu, J. Adhes. 1973, 5, 39-55.
22.	H. N. Hemmati, H. Nazokdast, H. S. J. Panahi, J Appl .Polym. Sci. 2001, 82, 1129-1137. DOI:10.1002/app.1947
23.	A. Pustak, M. Leskovac, M. Denac, I. Svab, J. Pohleven, M. Makarovic, V. Musil, I. Smit, J. Reinf. Plast. Compos. 2014, 33, 851-861. DOI:10.1177/0731684413518827
24.	U. W. Gedde, in: Polymer Physics, Springer Science+Business Media, Dordrecht, Netherlands, 1995.
25.	M. Haghighat, A. Zadhoush, S. Nouri Khorasani, J. Appl. Polym. Sci. 2005, 96, 2203-2211. DOI:10.1002/app.21691
26.	H. W. Zhang, J. B. Wang, X. Guo, J. Mech. Phys. Solids 2005, 53, 1929-1950. DOI:10.1016/j.jmps.2005.05.001
27.	J. A. Gopi, G. B. Nando, Adv. Polym. Sci. Techn. 2014, 4, 43- 51.
28.	G. Radonjic, I. Smit, J. Polym. Sci. B. Polym. Phys. 2001, 39,
566-580. DOI:10.1002/1099-0488(20010301)39:5<566: :AID-POLB1030>3.0.CO;2-P
29.	L. Nicolais, M. Narkis, Polym. Eng. Sci. 1971, 11, 194-199.
30.	Y. Zare, Int. J. Adhes. Adhes. 2016, 70, 191-195.
31.	A. Pustak, M. Denac, A. Sever Skapin, I. Svab, V. Musil, I. Smit, J. Polym. Res. 2016, 23, 163 (1-13).
32.	C. B. Bucknall, in: S. G. Aggarwal (Ed.): Comprehensive Polymer Science: The Synthesis, Characterization, Reactions and Applications of Polymers, Pergamon, Oxford, UK, 1989, pp. 27-34. DOI:10.1016/B978-0-08-096701-1.00205-6
33.	A. Pustak, I. Svab, E. Govorcin Bajsic, M. Denac, V. Musil, I. Smit, Polym. Plast. Technol. Eng. 2017, 57(3), 229-241. DOI: 10.1080/03602559.2017.1320720
34.	M. Fujiyama, Int. Polym. Proc. 1998, 4, 411-416. DOI: 10.3139/217.980411
35.	I. Svab, V. Musil, A. Pustak, I. Smit, Polym. Compos. 2009, 30, 1091-1097. DOI:10.1002/pc.20660
36.	B. Pukanszky, Eur. Polym. J. 2005, 41, 645-662. DOI:10.1016/j.eurpolymj.2004.10.035
37.	V. Mittal, in: V. Mittal (Ed.): Polymer Nanotube Nanocom-posites: Synthesis, Properties, and Applications, Wiley&Sons, Inc. Hoboken, New Jersey & Scrivener Publishing LLC, Salem, Massachusetts, USA, 2010, pp. 449-460.
38.	S. Steinmann, W. Gronski, C. Friedrich, Polymer. 2002, 43, 4467-4477. DOI:10.1016/S0032-3861(02)00271-9
39.	G. Guerrica-Echevarria, J. I. Eguizabal, J. Nazabal Polym. Test. 2000, 19, 849-854. DOI:10.1016/S0142-9418(99)00055-0
40.	G. Biresaw, C. J. Carriere, Compos. Part. A, 2004, 35, 313-320. DOI:10.1016/j.compositesa.2003.09.020
41.	H. Liang, R. Xu, B.D. Favis, H.P. Schreiber, Polymer 1999, 40, 4419-4423. DOI:10.1016/S0032-3861(98)00767-8
42.	M. Jenkins, N. J. Mills, in: Plastics: Microstructure and Engineering Applications, 3rd edition, Butterworth-Heinemann for Elsevier, Oxford, UK, 1993, pp. 229-249.
43.	A. K. Ghosal, Crystallization of Isotactic Poly(Propylenes) with Enachanted Melt Strength, Ph. D. Thesis, Florida State University, USA, 2008.
44.	G. M. Jordhamo, J. A. Manson, L. H. Sperling, Polym. Eng. Sci. 1986, 26, 517-524. DOI:10.1002/pen.760260802
45.	C. Lotti, C. A. Correa, S. V. Canevarolo, Mat. Res. 2000, 3, 37-44. DOI:10.1590/S1516-14392000000200007
46.	C. J. Chou, K. Vijayan, D. Kirby, A. Hiltner, E. Baer, J. Mater. Sci. 1988, 23, 2521-2532. DOI:10.1007/BF01111912
47.	J. A. W. van Dommelen, W. A. M. Brekelmans, F. P. T. Baai-jens, Mech. Mater. 2003, 35, 845-863. DOI:10.1016/S0167-6636(02)00307-1
Povzetek
V delu smo preučevali vpliv dveh metalocenskih elastomerov na osnovi etilena/propilena (m-EPR1 in m-EPR2), ki sta se razlikovala v molekulski masi in viskoznosti, na mehanske, reološke in medpovršinske lastnosti. V iPP matrico smo dodali 2.5, 5, 10, 15 in 20 vol.% m-EPR elastomera. Ugotovili smo, da imajo mešanice iPP/m-EPR1 višje vrednosti tor-zijskega momenta mešanja, raztezka ob pretrgu in udarne žilavosti kot mešanice iPP/m-EPR2 zaradi višje viskoznosti taline m-EPR1 kot m-EPR2 elastomera. Manjše razlike v Youngovem modulu, meji plastičnosti in natezni trdnosti pri pretrgu kažejo, da natezne lastnosti mešanic iPP/m-EPR niso v veliki meri odvisne od viskoznosti ali molekulske mase, mešljivosti in velikosti sferolitov. Optimizirani diagrami kažejo, da so m-EPR elastomeri učinkoviti modifikatorji žilavosti za polipropilen in kažejo ugodno ravnotežje mehanskih lastnosti mešanic iPP/m-EPR.
DOI: I0.i7344/acsi.20i7.4034	Acta Chim. Slov. 2018, 65, 354-364	^commons
Scientific paper
Capsicum annuum Fruit Extract: A Novel Reducing Agent for the Green Synthesis of ZnO Nanoparticles and Their Multifunctional Applications
Haraluru Shankraiah Lalithamba,1,* Mahadevaiah Raghavendra,1 Kogali Uma,1 Kalanakoppal Venkatesh Yatish,1 Das Mousumi,2 and Govindappa Nagendra3
1 Department of Chemistry, Siddaganga Institute of Technology, B.H. Road, Tumakuru - 572 103, Karnataka, India 2 Department of Biotechnology, Siddaganga Institute of Technology, B.H. Road, Tumakuru - 572 103, Karnataka, India 3 Fakultat fur Chemie und Chemische Biologie, Technische Universität Dortmund, Germany * Corresponding author: E-mail: lalithambasit@yahoo.co.in Received: 28-11-2017
Dedicated to the 111th Birthday (born April 1,1907) of Dr. Sree Sree Sree Shivakumara Mahaswamiji, Siddaganga Matt, Tumakuru, Karnataka, India.
Abstract
A simple, efficient and convenient method for the preparation of zinc oxide (ZnO) nanoparticle was described. Several parameters like size and morphology of the prepared nanoparticles were characterized thorough a variety of analytical techniques such as XRD, FT-IR, UV-Vis, SEM, and EDX. The prepared ZnO nanoparticles were successfully used as catalyst for the formylation of amino acid esters and biodiesel synthesis. Further, the synthesized formamide esters were well characterized through HRMS, 'H NMR and 13C NMR analysis and subjected for the in vitro antibacterial and antifungal tests and the results indicated that some of them showed promising activity against targeted bacterial pathogens.
Keywords: Zinc oxide NPs; Solution combustion; Formylation; Biodiesel production; Biological activities
1. Introduction
Zinc oxide is a multifunctional material with its unique physical and chemical properties, such as high chemical stability, high electrochemical coupling co-efficient, high range of radiation absorption and high photo-stability.1 ZnO as a catalyst with high specific surface area2 finds the potential use in electronics, optoelectronics, laser technology and is made possible because of broad energy band (3.37a eV), high bond energy (60 MeV), thermal and mechanical stability at room temperature.3 ZnO NPs have fascinated the research world through its significant applications in pigment electronics, spintronics and piezoelectricity fields.4 Nano structured material ZnO has the ability to generate power, which also finds an extensive application in self-power generating devices for medical, wireless technologies and sensor applications.5 ZnO shows diverse group of growth morphologies such as nano rings, nano springs, nano combs, nanowires and nano cages.6
These have been synthesized using solid-vapour phase thermal sublimation technique7 under specific growth condition. ZnO nanoparticles have drawn attention due to their antimicrobial activity; this finds application in food packaging.8 Biocompatibility and biodegradability makes it a material of interest for biomedicine and in pro-ecological systems.9 Nano ZnO plays a vital role as a semiconductor photo catalyst for UV-induced degradation of methylene blue10 and doped ZnO also exhibits good optical and electrical properties.
Dhiman et al. reported the synthesis of Fe-doped ZnO nanoparticles by solution combustion method.11 Recently, there are several attempts for the green biosynthesis approach for the preparation of ZnO, SnO2, silver and reduced graphene oxide-silver (RGO-Ag) nanocomposites using leaf extracts of Plectranthus amboinicus and Corym-bia citriodora as a reducing agent at different temperatures. The synthesized NPs showed a superior photocatalytic, catalytic activity towards dye molecules degradation and
also investigated the electrochemical properties of ZnO, RGO-Ag.12-16 It has been widely studied that, ZnO is a highly efficient catalyst for a plethora of organic reactions, such as Friedel-Crafts acylation, Beckmann rearrangements, synthesis of cyclic ureas from diamines, N-alkyla-tion of imidazoles and ring-opening of epoxides.17 Nehal and others synthesized the ZnO nanoparticles and studied the effect of annealing temperature on its particle size.18 The prepared ZnO NPs were reported to be employed in various functional group transformations. Among the transformations, protection of reactive amino groups is commonly required in organic synthesis using formyl group.19 Formylation of amine is one of the important protocol in organic synthesis and medicinal chemistry. Various formylating reagents such as formic acid-DCC, formic acid-EDCI, KF-alumina, and ammonium formate were employed.20-23 The obtained formamides are the main class of organic intermediates, which act as Lewis bases.24 Synthesis of formamide was also achieved by the reaction of isocyanate and formic acid in the presence of DMAP,25 acetic formic anhydride,26 and metallic zinc.27 Literature survey reveals that, many catalysts were used for the N-formylation of amines with formic acid, such as amber-lite IR-120,28 TiO2-P25 or sulfated titania,29 and HEU zeolite.30 N-formylation of amines using hydroxylamine hy-drochloride as a catalyst under neat condition was reported by Deepali agarwal and co-workers.31 Using amine and formic acid in the presence of a catalytic amount of thia-mine hydrochloride, formamide derivatives have been synthesized in excellent yields.32 Nano MgO, ZnO, and CeO2 were also used as catalysts in the synthesis of formamides.33-35 Chandra shekhar et al. reported the facile N-formylation of amines using Lewis acids such as, FeCl3, AlCl3, and NiCl2 as novel catalysts.36 There are various methods to prepare nano structured particles. Some of the methods include chemical vapour deposition,37 hydro-thermal,38 precipitation,39 and sol-gel method.40 The conventional physical and chemical methods available for the synthesis of NPs have adverse effects like critical temperature conditions and pressure, expensive chemicals, toxic byproducts etc.
Herein, green synthesis of zinc oxide nanoparticles using eco-friendly and non-toxic Capsicum annuum extract was reported. Capsaicin is an alkaloid found mainly in the fruit of the Capsicum genus, which provides spicy flavour andhas pharmacological effects to determine specific applications, such as for weight-loss and as an analgesic.41 Literature survey confirms that the capsaicin has anti-bacterial and anti-diabetic properties.42 Capsicum annuum is a rich source of ascorbic acid generally known as vitamin C, a very essential antioxidant for human nutri-tion.43 This method has several benefits such as simple procedure, inexpensive reagents and good stability of nanopar-ticles. The solid catalyst is of great importance because of its advantages such as non-hazardous nature, requirement in small proportions and easier reaction workup.
Biodiesel is recognized as an alternative fuel due to its similar bearing with diesel fuel. Existing days, research has been intensive to the alternative sources of energy.44,45 Commonly, biodiesel is a mixture of fatty acid methyl ester (FAME), which is synthesized from vegetable oil, waste oils and animal fat through transesterification reaction. Homogeneous catalysts such as KOH, NaOH, CH3OK, and CH3ONa show a favorable catalytic efficiency with various drawbacks such as generation of waste water, corrosion of equipment.46 In display, solid heterogeneous catalysts are favorable for biodiesel synthesis because of environmentally friendly, easy separation, and could be reused many times.47 Many solid acid catalysts like zeolite,48 WO3/ZnO2,49 and sulphated zirconia50 were suitable for esterification reaction under 60-75 oC. In fact, solid acid catalysts (phosphotungstic acid, 12-tungstophosphoric acid, and ionic liquids) are used for the esterification and transesterification through one pot method. Meanwhile, solid base catalysts such as Ca(OCH3)2,51 CaO52, and KOH/Al2O3 were used in transesterification reaction at mild condition. Among the transition metal oxides, zinc oxide was reported the best catalyst for transesterification due to its minimum weight loss and high activity in the reaction.53 Currently, application of nano catalysts for biodiesel synthesis has drawn much attention, as a result of easy separation of products, less pollution, higher catalytic activity and reusability.54 Recently, nano catalysts such as CaO,55 Ti(SO4)O,56 KF/CaO-Fe3O4,57 Ag/ZnO58, and mixed oxide TiO2-ZnO59 were used for biodiesel production. Presently, non-edible oils are used for biodiesel production to reduce edible oil conflict among food and fuel purpose. In this study, Buteamonosperma oil (non-edible) is used for biodiesel production and this plant belongs to a fabaceae family which is native to Indian subcontinent and seeds contain 23% of oil.60,61
In the present work, we report the synthesis of ZnO NPs through solution combustion by using Capsicum ann-uum extract as the combustible fuel and the obtained ZnO is employed as catalyst for the N-formylation of amino acid esters and biodiesel production. Further, the synthesized formamide derivatives were subjected for biological activities.
2. Experimental Section 2. 1. General
All chemicals were purchased from Sigma-aldrich and Merck and used without purification. The pathogenic bacterial strains were procured from National chemical laboratory Pune, India. The Capsicum annuum fruits were collected from local market, Tumakuru district, Karnata-ka, India. TLC analysis was carried out using pre-coated silica gel F254. The phase identity and crystalline size of ZnO NPs were characterized through shimadzu powder X-ray diffractometer (PXRD-7000). IR spectra were re-
corded on Bruker Alpha-T FT-IR spectrometer (KBr windows, 2 cm-1 resolution), SEM analysis on Hitachi-7000 Scanning Electron Microscopy and elemental analysis was obtained from energy dispersive X-ray diffraction (EDX). UV-Vis diffused reflectance spectra were analyzed through Lambda-35 (Parkin Elmer) spectrophotometer. Mass spectra were recorded on a Micromass Q-ToF Micro Mass Spectrometer. Melting points were taken on open capillaries, 1H NMR, and 13C NMR spectra of the forma-mide derivatives were done on a Bruker AMX 400 MHz spectrometer using Me4Si (tetramethylsilane) as an internal standard and CDCl3 (deuterated chloroform) as a solvent.
2. 2. Synthesis of Nano Zinc Oxide Particles Through Solution Combustion Method
The Capsicum annuum fruit was collected and washed with distilled water. The whole mass was grinded to get the powder and then mixed with distilled water and boiled at 80 oC. After cooling to room temperature, the mixture was filtered using a Whatman filter paper no. 1 to obtain chilli extract. Zinc nitrate as precursor and Capsicum annuum fruit extract as fuel in the ratio of 4:1 were used for the synthesis of ZnO NPs through solution combustion method.62 The solution was heated to 450 oC for 30 min and then dried in hot air oven for 4-5 h to obtain ZnO NPs in good yield.
2. 3. General Procedure for the Synthesis of Formamide Esters Using ZnO NPs
The prepared amino acid ester (1.0 mmol) was dissolved in dry DCM (dichloromethane) and neutralized with NMM (N-methyl morpholine) (1.5 mmol). To this solution, formic acid (2.0 mmol) was added at room temperature, followed by the addition of nano ZnO (0.5 mmol). The reaction mixture was stirred for 2 to 3 hours. The product was extracted into DCM and the organic layer was washed with hydrochloric acid solution (10 mL), sodium carbonate solution (15mL), water (15 mL) and brine (15 mL). It was dried over anhydrous sodium sulphate and concentrated under reduced pressure.
2. 4. Synthesis of Biodiesel Using ZnO NPs as a Catalyst
Transesterification reaction was carried out in a three necked round bottom flask equipped with reflux condenser on the middle neck, thermometer on the side neck and placed on the plate of the magnetic stirrer. In the beginning, 100 ml of B. monosperma oil was pre heated at 70 oC then a mixture of 2% wt. ZnO and 9:1 molar ratio of methanol to oil was added. The entire reaction was carried out at 65 oC for duration of 2 h. After the completion of reaction, the mixture was allowable to phase separation,
the biodiesel (top layer), glycerine (middle layer) and catalyst (bottom layer) phase were separated. Then, the catalyst and glycerine were drained out and unreacted methanol was recovered from biodiesel. The obtained biodiesel was filtered to remove any dissolved zinc oxide catalyst.
3. Results and Discussion 3. 1. Characterization of ZnO NPs
XRD spectrum (Figure 1) has prominent peaks corresponding to the diffraction peaks at 29 = 31°, 34°, 36°, 47°, 56°, 62° and 67° were indexed with the diffraction planes (100), (002), (101), (102), (110), (103) and (112) approve with JCPDS card no. 36-1451,63 which confirms the hexagonal wurtzite structure of ZnO NPs. Average particle size (D) of synthesized NPs were found to be 33.26 nm using Scherer's formula. From the XRD spectrum, it is concluded that ZnO NPs synthesised by biologically initiated green synthesis conferred uniform size distribution fluctuates between 30 to 40 nm.
The average crystallite size of prepared sample was calculated by Debye-Scherrer's64 formula i.e.
(1)
Figure 1. XRD pattern of ZnO NPs.
where, D is crystalline size, À is X-ray wavelength (0.154 nm), p is full-width at half-maximum and 0 is Bragg's angle. The average crystallite size of the ZnO NP was found to be 33.26 nm.
Figure 2(a) and 2(b) show DRS spectra and band gap plot of ZnO nanoparticles respectively. DRS spectrum reveals that the absorption is at ~ 400 nm. The Kubelka -Munk function65,66 was utilized to determine the band gap energy (Eg) of ZnO NPs. The intercepts of the tangents to the plots of [F(R„) hv]1/2 versus photon energy (hv) were
shown in Figure 2(a) and 2(b). The Kubelka- Munk function F (R„) and photon energy (hv) can be calculated by following Equations (2), (3) and (4):
(2)
(3)
(4)
where reflection coefficient of the sample, A; the ab-sorbance intensity of ZnO nanoparticles and À; the absorption wavelength. The energy band gap value was found to 3.10 eV.
Figure 3 shows the SEM images of as prepared zinc oxide nano particles. Figure 3c is the enlarged part of 3b and 3a, which clearly shows that the particles are agglomerated cluster to form spongy cave like structures. The sizes of the particles are found to be in the 500 nm to 1 micrometer.
The Energy Dispersive X-ray Diffractive study was carried out for the prepared ZnO NPs to know about the elemental composition. The EDX spectrum confirms the
Wavelength* nm)	Energy (eV)
Figure 2. Diffuse reflectance spectrum (a) and direct band gap energy of ZnO (b).
U»c 30-0 11 Cntt 2.300 k»V Dtt Octtnt Pro CNt Figure 4. EDX spectrum of ZnO nanoparticles.
presence of zinc and oxygen signals and elemental analysis of the nanoparticle yielded 55.33% of zinc and 44.67% of oxygen.
Figure 5 is the FT-IR spectrum of ZnO NPs and the band in the region of 680-400 cm-1 is the characteristic
2000 1000 Wave number (cm-1)
Figure 5. FTIR spectrum of ZnO nanoparticles.
peak of ZnO NPs. Thus, the formation of pure ZnO NPs at 535 cm-1 is evidenced by FT-IR67 and the peak at 1122 cm-1 in FTIR spectrum is due to C-O stretching mode.68 The peaks observed at 1628 cm-1 and 3500 cm-1 were due to the presence of -OH stretching and bending vibrations respectively assigned to the H2O adsorption on the surface of metal.69
Figure 6(a), (b) show the photoluminescence (PL) spectra of ZnO NPs recorded at room temperature. The recombination of photo generated free charge carriers leads to photoluminescence emission in semiconductor materials. The spectrum was recorded under UV excitation (375 nm) using Xenon lamp as source. The result obtained reveals that nano ZnO shows the strong emission peak at 600 nm (Figure 6(a)). The emission spectrum was monitored at 375 nm showed a broad emission at 600 nm was shown in
Figure 6(b). The broad 600 nm peak was due to the transition between single charged oxygen vacancies. The correlated color temperature was one of the essential parameter to know the color appearance of the light emitted by a light source with respect to a reference light source
" 375 run
«Ki inn
J50 400 450 500 550 600 650 700 750 800 Wavelength (nm)
Figure 6. PL emission spectrum (a) and excitation spectrum (b) of nano ZnO.
—i—i—i—i—r—1—r—'—i—1—i—'—i 1—i i—r—i—i—1 320 340 360 380 400 420 440 460 480 5CC 520
Wavrlc-ngtli (mm
when heated up to a specific temperature. The color clarity of any luminescent material was expressed in terms of chromaticity coordinates, called Commission International De I'Eclairage (CIE).
3. 2. Application of ZnO NPs as a Catalyst for the Formylation of Amino Acid Esters
In the current years, the use of metaloxides as a catalysts and reaction media has received considerable tremendous interest because of their high level of environmental compatibility, chemo selectivity and availability at low cost. Therefore, we explored the application of nano ZnO powder as an inorganic catalyst to carry out N-formy-lation of amino acid ester (1 mmol) in DCM with aq. 98% formic acid (1.5 mmol) at room temperature. Formamide derivative of amino acid ester was obtained in trace amount in the absence of ZnO catalyst, while good results were obtained with use of 0.5 mmol ZnO catalyst after same reaction conditions as mentioned. But less than 0.5 mmol considerably decreased the percentage of forma-mide esters and may took longer time for the completion of reaction. Using more than 0.5 mmol of ZnO has less effect on the final yield of the products. Thus, we found that 0.5 mmol of ZnO could efficiently catalyze the reaction for preparation of the desired products and observed that the excellent yield obtained using 1.5 mmol of formic acid. In literature survey Suresh babu et al. achieved successful synthesis of formamide derivatives of protected amino acids by the reaction of isocyanate with aqueous formic acid using DMAP as an organo catalyst.70 However, this procedure suffers from the difficulties such as expensive reagents, highly toxic and may also require special care. Hence, it is necessary of convenient reagent for the synthesis of stable formamides in terms of economic via-
Table 1. List of formamide esters prepared using ZnO NPs
bility and operational simplicity. Therefore, it is necessary to study this reaction using nano ZnO with a variety of amino acid esters as starting materials which were subjected to formylation reaction and the results were presented in Table 1. For the synthesis of titled compounds (2a-h), amino acid ester containing different aryl/alkyl groups prepared from thionyl chloride was dissolved in dry DCM and neutralized with NMM, to which aqueous formic acid was added followed by the addition of nano ZnO. The reaction mixture was stirred till the completion of the reaction (as monitored by TLC). After the simple work-up, desired products were obtained in good yield (Scheme 1). Using this procedure several formamide esters were synthesized from amino acid esters and characterized by their 1H NMR, 13C NMR and mass spectral studies.
3. 3. Spectral Data of the Synthesized Compounds:
N-formyl Ala-OMe (2a): % Yield 90, Solid, Melting Point: 162 oC. 1H NMR (400 MHz, CDCl3) 5 1.39 (d, J = 8 Hz, 3H), 2.02 (s, 1H), 3.46 (s, 3H), 4.55 (m, 1H), 8.20 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 17.5, 46.36, 52.0, 162.3, 170.1. MS: Cald. for C5H9NO3 m/z: 131.06, found: 131.0576.
N-formyl Ser-OMe (2b): % Yield 80, Gum. 1H NMR (400 MHz, CDCl3) 5 1.81 (s, 2H), 3.60 (s, 3H), 4.06 (m, 2H), 4.42 (m, 1H), 8.22 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 51.4, 52.9, 60.5, 160.8, 171.0. MS: Cald. for C5H9NO4 m/z: 147.05, found: 147.002.
N-formyl Tyr-OMe (2c): % Yield 89, Solid, Melting Point: 188 oC. 1H NMR (400 MHz, CDCl3) 5 1.88 (s, 1H), 3.04 (m, 2H), 3.45 (s, 3H), 4.78 (m, 1H), 5.06 (s, 1H), 6.68 (d, J = 8 Hz, 2H), 6.80 (d, J = 8 Hz, 2H), 7.92 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 36.4, 50.8, 51.6, 114.8, 129.3, 131.4, 155.0, 162.6, 171.5. MS: Cald. for C11H13NO4 m/z: 223.08, found: 223.0802.
Entry	Product	Yield (%)	M.p./ oC
1	2a	90	162
2	2b	80	Gum
3	2c	89	188
4	2d	85	132
5	2e	79	Gum
6	2f	84	Gum
7	2g	85	158
8	2h	88	Gum
N-formyl Leu-OMe (2d): % Yield 85, Solid, Melting Point: 132 oC.1H NMR (400 MHz, CDCl3) 5 1.06 (d, J = 8 Hz, 6H), 1.74-1.80 (m, 3H), 2.0 (s, 1H), 3.47 (s, 3H), 4.46 (m, 1H), 8.10 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 22.4, 22.75, 40.34, 48.2, 51.62, 162.4, 170.8. MS: Cald. for C8H-15NO3 m/z: 173.11, found: 173.0998.
N-formyl Pro-OMe (2e): % Yield 79, Gum. 1H NMR (400 MHz, CDCl3) 5 1.60 (m, 2H), 1.68 (m, 2H), 2.65 (m, 2H),
hci.h2n
O.
Scheme 1. Synthesis of N-formamide esters
O R
A,
DCM, NMM
HCOOH, ZnO ^ fj
at RT	O
2a-h
O.
R = Amino acid side chains
3.53 (t, 1H), 3.62 (s, 3H), 8.0 (s, 1H).13C NMR (100 MHz, CDCl3) 5 22.8, 28.4, 43.92, 50.73, 58.02, 162.1, 172.0. MS: Cald. for C7H11NO3 m/z: 157.07, found: 157.0711.
N-formyl Val-OMe (2f): % Yield 84, Gum. 1H NMR (400 MHz, CDCl3) 5 1.08 (d, J = 8 Hz, 6H), 2.0 (s, 1H), 2.98 (m, 1H), 3.66 (s, 3H), 4.38 (d, J = 8 Hz, 1H), 8.0 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 17.8, 29.92, 51.0, 54.7, 163.4, 171.2. MS: Cald. for C7H13NO3 m/z: 159.09, found: 159.0898.
N-formyl Phe-OMe (2g): % Yield 85, Melting Point: 158 oC. 1H NMR (400 MHz, CDCl3)5 2.0 (s, 1H), 3.02 (m, 2H), 3.48 (s, 3H), 4.75 (t, 1H), 7.08-7.20 (m,5H), 8.17 (s, 1h). 13C NMR (100 MHz, CDCl3) 5 37.6, 50.82, 51.7, 126.2, 127.5, 128.0, 138.65, 162.88, 171.1. MS: Cald. for C11H-13NO3 m/z: 207.09, found: 207.0930.
N-formyl Met-OMe (2h): % Yield 88, Gum. 1H NMR (400 MHz, CDCl3) 5 1.86 (s, 1H), 2.04 (s, 3H), 2.20 (m, 2H), 2.38 (t, 2H), 3.55 (s, 3H), 4.40 (t, 1H), 8.11 (s, 1H). 13C NMR (100 MHz, CDCl3) 5 16.9, 29.64, 31.5, 50.12, 52.3, 163.82, 172.0. MS: Cald. for C7H13NO3S m/z: 191.06, found: 191.0602.
3. 4. Antibacterial and Antifungal Activity of Formamide Derivatives
The synthesized compounds were evaluated for their antibacterial activity against E. coli (MTCC 443) and S.
Aureus (MTCC 5823). Lack of activity of the tested substances against Gram +ve bacteria could be explained by the differences in the structure of cell walls of Gram +ve and Gram -ve microorganisms. In most Gram +ve bacteria, the cell wall consists of many layers of peptidoglycan, forming a thick, rigid structure. Whereas, the cell walls of Gram -ve bacteria consist of one or a very few layers of peptidoglycan and a lipid-rich outer membrane.71 Similar type of results employing different type of compounds such as Schiff's bases and amine derived from alkyl 2-(2-formyl-4-nitrophenoxy) alkanoates was recorded by Goszczyn'ska.72 A contrasting difference in antibacterial activity employing Gram +ve and Gram -ve strains representing better susceptibility by E. coli than S. aureus employing novel benzothienopyrimidines compounds was shown.
In this study, the antibacterial screening indicated quite varied results among the tested samples as depicted in Table 2, 3, and 4 exhibiting antibacterial and antifungal activities respectively. For E. coli (MTCC 443), formamide ester derivatives of Ala, Tyr, Phe have shown good susceptibility over a wide volume range taken for a fixed concentration of samples (Table 2). Serine derivative has shown best result in comparison
to others at higher volume of fixed concentration of the sample tested. Rest of the samples were found to be resistant against the bacterial strain. A different result has been observed in terms of susceptibility pattern tested against S. aureus (MTCC 5823). Derivatives of Ala, Ser,
Figure 7. Photographs showing antibacterial activity of the formamides (3a, 3c and 3g) in agar well diffusion method with Gram -ve Escherichia coli bacteria.
Table 2. Antibacterial activity of standard and samples employing E. coli
Entry	Sample name Escherichia coli	Standard (Gentamicin)	50	100	Sample concentration (^l) 150 200 Zone of Inhibition (mm)	250	300
3a	OHCHN-Ala-OMe	++++	-	-	+ +	+	+
3b	OHCHN-Ser-OMe	++++	-	-	- +	+	++
3c	OHCHN-Tyr-OMe	++++	-	-	- +	+	+
3d	OHCHN-Leu-OMe	++++	-	-	- -	-	-
3e	OHCHN-Pro-OMe	++++	-	-	- -	-	+
3f	OHCHN-Val-OMe	++++	-	-	- -	-	-
3g	OHCHN-Phe-OMe	++++	-	-	+ +	+	+
3h	OHCHN-Met-OMe	++++	-	-	- -	-	-
Table 3. Antibacterial activity of standard and samples employing S. Aureus
Entry	Sample name S. Aureus	Standard (Gentamicin)	50	100	Sample concentration (^l) 150 200 250 Zone of Inhibition (mm)	300
3a	OHCHN-Ala-OMe	++++	-	-	- - -	-
3b	OHCHN-Ser-OMe	++++	-	-	- - -	-
3c	OHCHN-Tyr-OMe	++++	-	-	- - +	+
3d	OHCHN-Leu-OMe	++++	-	-	- - -	+
3e	OHCHN-Pro-OMe	++++	-	-	- - -	-
3f	OHCHN-Val-OMe	++++	-	-	- - -	+
3g	OHCHN-Phe-OMe	++++	-	-	- - -	+
3h	OHCHN-Met-OMe	++++	-	-	- - -	-
Zone of Inhibition: (-) 0-3mm; (+) 4-6 mm, (++) 7-9 mm, (+++) 10-12 mm, (++++) 12 mm
Table 4. Antifungal activity of standard and samples employing Humicolafuscoatra
Entry	Sample name Humicolafuscoatra	Standard (Fluconazole)	50	100	Sample concentration (^l) 150 200 Zone of Inhibition (mm)		250	300
3a	OHCHN-Ala-OMe	+++	+	-	-	+	+	-
3b	OHCHN-Ser-OMe	+++	-	+	+	+	+	+
3c	OHCHN-Tyr-OMe	+++	-	-	-	-	-	+
3d	OHCHN-Leu-OMe	+++	-	+	+	+	-	+
3e	OHCHN-Pro-OMe	+++	-	+	-	+	+	+
3f	OHCHN-Val-OMe	+++	-	+	+	+	+	-
3g	OHCHN-Phe-OMe	+++	-	+	+	+	+	+
3h	OHCHN-Met-OMe	+++	-	+	+	+	+	+
Zone of Inhibition: (-) 0-1 mm; (+) 2-4 mm, (++) 5-7 mm, (+++) 8 mm
Pro and Met were found to be resistant at fixed concentration with different range of volume from 50 to 300 ^l. While, Tyr, Leu, Val and Phe derivatives have shown (Table 3) moderate susceptibility in comparison to Gram -ve E. coli (MTCC 443). All comparisons were done keeping in record the values of standard tested. Zones of inhibition (in mm) were measured at varying dilutions and depicted in the photographs of the culture plates of the best cases (Figure 7).
Summarization of antifungal activity has shown in Table 4. Derivatives of Ala, Tyr, Leu, Pro and Val have shown some activity in comparison to standard. While the derivatives of Phe, Ser, and Met have also shown good activity over a wide range of volume of samples (50-300 ^l)
tested for a fixed concentration. We are also measured the equivalent zones of inhibition (in mm) at varying dilutions and depicted in the photographs of the culture plates for the best cases (Figure 8).
The antimicrobial activity of formamide esters were evaluated against standard MTCC strains of Gram +ve and Gram -ve bacteria (standard strains: Staphylococcus aureus MTCC 5823, Eschsrichia coli MTCC 443) and a strain of fungi Humicolafuscoatra (MTCC 3938) by agar well diffusion method.73 The optimum turbidity (<1.0) suitable for bacterial inoculum preparation was followed according to McFarland's test74 employing Luria Bertani Broth for E. coli and Nutrient Broth for S. aureus. For fungal inoculum preparation 72 h incubation period was optimized for
choosing the culture suspension employing Potato dextrose broth pertaining to antifungal activity. The standards used were fluconazole at the conc. of 0.10 mg/ml and gen-tamicin of 0.003 mg/ml concentration (Plating volume 50 ^l) for antifungal and antibacterial activity respectively. The wells of 6 mm diameter were punched employing a sterile cork borer into the Mueller hinton agar (MHA) having the test microorganisms at concentration about 5 x 106 CFU/ml for bacterial strains and 3 x 105 CFU/ml for fungi. The wells were filled with different volumes in a range from 50 ^l to 300 ^l, at the concentration of 0.10 mg/ ml employing DMSO. The plates were incubated for 18 h and 36 h at 35 ± 1 °C for E. coli and S. aureus respectively. For antifungal activity employing the same method with potato dextrose agar plates were incubated for 72 h at 28 ± 1 °C. Antimicrobial activity was evaluated by measuring the inhibition zone against the test microorganisms us-
ing an antibiogram scale and standard measurement protocol was followed according to CLSI guidelines.75,76
3. 4. Application of ZnO NPs as a Catalyst for the Biodiesel Production
After transesterification of Buteamonosperma oil, the yield of biodiesel was found to be 82.7%. In order to evaluate the quality of biodiesel, the fuel properties of the biodiesel were determined according to ASTM D6751 standards as shown in the Table 5. The fuel properties such as kinematic viscosity (4.3 cSt), flash point (151 oC), acid value (0.2 mg KOH/g), calorific value (37790 kJ/kg), density (880 kg/m3) and copper strip corrosion (1a) were within the range of ASTM standard. Schematic diagram of ZnO NPs catalyzed transesterification for the production of biodiesel is shown in the Figure 9.
Figure 9. Schematic diagram of transesterification reaction.
Table 5. Fuel properties of Buteamonosperma biodiesel
Properties	Units	Testing procedure ASTM	BMME/ biodiesel	Biodiesel standard ASTM D6751
Viscosity at 40 oC	cSt	D445	4.3	1.9-6.0
Flash point	°C	D4052	151	>130
Acid value	mg KOH/g	D664	0.2	0.8 max
Calorific value	kJ/kg	D240	37790	-
Density	kg/m3	D93	880	870-900
Copper strip corrosion, 50 oC, 3h	-	D130	1a	no. 3 max
BMME = Buteamonosperma methyl ester
4. Conclusions
Multifunctional ZnO nanoparticle has been synthesized via a simple solution combustion method using Capsicum annuum extract as a new fuel. The prepared NPs were characterized by UV-Vis DRS, XRD, SEM, and EDX and also evaluated its photoluminescence property. The method is environmental friendly and overcome the demerits of conventional physical and chemical methods of synthesis. In the presence of nano ZnO catalyst excellent yield of formamide esters and biodiesel have been obtained. The synthesized formamide esters were successfully characterized by JH NMR, 13C NMR, and mass spectroscopy analysis. Finally, the formamide esters were subject to biological activities against bacterial pathogens and few of the molecules exhibited considerable biological activities.
5. Acknowledgements
We thank the Principal and Director of Siddaganga Institute of Technology, Tumakuru, Karnataka, for the research facilities. One of the authors (HSL) is thankful to the Vision Group of Science and Technology, Department of Information Technology, Biotechnology and Science & Technology, Government of Karnataka for providing funds under CISEE programme (GRD No. 472) to carry out the present research work by means of a sponsored project.
6. References
1.	H. G. Reza, P. Ferdos, P. Hossein, B. R. Mosavar, Orientational J. Chem. 2015, 31, 1219-1221.
2.	S. M. Hosseini, S. Hashem, J. Org. Chem. 2006, 71, 6652-6654. DOI:10.1021/jo060847z
3.	K. R. Agnieszka, J. Teofil, Materials. 2014, 7, 2833-2881. DOI:10.3390/ma7042833
4.	D. Gnanasangeetha, T. D. Sarala, J. Chem. Biolog. Phy. Sci. 2013, 4, 238-246.
5.	D. Indrani, A. Nitin, Nanomaterials and Nanotech. 2013, 3, 1-16. DOI:10.5772/56188
6.	Z. W. Lin, J. Phys. Condens. Matt. 2004, 16, 829-858. DOI: 10.1088/0953-8984/16/45/025
7.	L. Miao, S. Tanemura, Y. Ieda, M. Tanemura, Y. Hayashi, H. Y. Yang, S. P. Lau, B. K. Tay, Y. K. Cao, Surface Sci. 2007, 601, 2660-2663. DOI:10.1016/j.susc.2006.12.011
8.	J. J. Velázquez, V. D. Rodríguez, A. C. Yanes, J. del Castillo, J. Méndez-Ramos, Appl. Phys. A. 2012, 108, 577-583. DOI:10.1007/s00339-012-6929-z
9.	G. M. Krishna, R. Jagannadha, J. Engg. Trends and Tech. 2015, 26, 272-275. DOI:10.14445/22315381/IJETT-V26P247
10. A. I. Muhammad, A. S. Iqbal, A. K. M. Rahman, A. M. Mah-bubul, S. M. I. Saiful, A. H. Mohammad, International J. Chemical Reactor Engg. 2011, 9, 1-20.
11.	P. Dhiman, K. M. Batoo, R. K. Kotnala, M. Singh, Micro & Nano Lett. 2012, 7, 1333-1335. DOI:10.1049/mnl.2012.0862
12.	L. Fu, Z. Fu, Ceramics International. 2015, 41, 2492-2496. DOI:10.1016/j.ceramint.2014.10.069
13.	L. Fu, Y. Zheng, Q. Ren, A. Wang, B. Deng, J. Ovonic Res. 2015, 11, 21-26.
14.	Y. Zheng, Z. Wang, F. Peng, L. Fu, Revista Mexicana de Ingeni-er'ia Qu'imica. 2017, 16, 41-45.
15.	Y. Zheng, A. Wang, W. Cai, Z. Wang, F. Peng, Z. Liu, L. Fu, Enzyme and Microbial Technology, 2016, 95, 112-117. DOI:10.1016/j.enzmictec.2016.05.010
16.	Y. Zheng, Z. Wang, F. Peng, L Fu, Brazilian Journal of Pharmaceutical Sciences, 2016, 52, 781-786. DOI:10.1590/s1984-82502016000400023
17.	Z. Ilona, S. Jakub, M. C. Anna, S. Kamil, L. Janusz, S. Jacinto, Chem. Science Rev. and Lett. 2015, 4, 735-745.
18.	A. S. Nehal, M. El-Kemary, M. I. Ebtisam, Nanoscience and Nanotech. 2015, 5, 82-88.
19.	S. Mojmir, A. H. E. Adam, H. E. H. Robert, Org. Lett. 2011, 13, 3952-3955. DOI:10.1021/ol201475j
20.	J. Waki, J. Meienhofer, J. Org. Chem. 1977, 42, 2019-2020. DOI:10.1021/jo00431a046
21.	F. M. F. Chen, N. L. Benoiton, Synthesis. 1979, 709-710. DOI:10.1055/s-1979-28805
22.	M. Miharam, Y. Ishino, S. Minakata, M. Komatsu, Synthesis. 2003, 15, 2317-2320.
23.	P. G. Reddy, G. D. K. Kumar, S. Baskaram, Tetrahedron. 2000, 41, 9149-9151. DOI:10.1016/S0040-4039(00)01636-1
24.	H. S. Mona, Green Chem.-Envi. Benign Appro. 2012, 6, 103-120.
25.	V. V Sureshbabu, N. Narendra, Int. J. Pept. Res. Ther. 2008, 14, 201-207. DOI:10.1007/s10989-008-9127-2
26.	A. Jafar, H. Malak, S. Mehdi, H. Akbar, Arkivok. 2009, xi, 123-129.
27.	K. Joong-Gon, J. Doo Ok, Bull. Korean Chem. Soc. 2010, 31, 2989-2991. DOI:10.5012/bkcs.2010.31.10.2989
28.	R. Madhusudana, T. M. V. Bhojegowda, N. Aatika, A. P. Mohamed, Chinese J. Cat. 2010, 31, 518-520.
29.	B. Krishnakumar, M. Swaminathan, J. Mol. Catalysis A: Chem. 2011, 334, 98-102. DOI:10.1016/j.molcata.2010.11.002
30.	B. Siavash, M. A. Babak, S. Mohammad, Z. Fereshteh, Bull. Korean Chem. Soc. 2012, 33, 2251-2254. DOI:10.5012/bkcs.2012.33.7.2251
31.	D. Agarwal, A. Agrwal, A. Bairagi, V. K. Kasana, Res. J. Chemical Sci. 2014, 4, 54-57.
32.	L. Min, M. Lei, H. Lihong, Tetrahedron Lett. 2010, 51, 41864188. DOI:10.1016/j.tetlet.2010.06.005
33.	M. M. B. Reddy, S. Ashoka, G. T. Chandrappa, M. A. Pasha, Catal. Lett. 2010, 138, 82-87. DOI:10.1007/s10562-010-0372-6
34.	S. S. Mohammad, M. Mehdi, R. Akbar, Lett. in Org. Chem. 2014, 11, 49-54. 35. M. Raghavendra, K. V. Yatish, H. S. Lali-thamba, Eur. Phys. J. Plus. 2017, 132, 1-12.
36. S. A. Chandra, K. A. Ravi, G. Sathaiah, P. V. Luke, S. Madab-hushi, R. P. Shanthan, Tetrahedron Lett. 2009, 50, 7099-7101. D0I:10.1016/j.tetlet.2009.10.006
37.	R. Namita, International J. Adv. in Engg. & Tech. 2015, 7, 1806-1881.
38.	R. Donya, B. H. Mohd Zobir, T. Y. Yun Hin, Chm. Central J. 2013, 7, 1-10. DOI:10.1186/1752-153X-7-1
39.	H. R. Ghorbani, F. P. Mehr, H. Pazoki, B. M. Rahmani, Oriental J. Chem. 2015, 31, 1219-1221.
40.	S. Jurablu, M. Farahmandjou, T. P. Firoozabadi, J. Sci. Islamic Republic of Iran. 2015, 26, 281-285.
41.	R. E. Maria de Lourdes, G. G. M. Edith, V. T. Erika, Molecules. 2011, 16, 1253-1270. DOI:10.3390/molecules16021253
42.	S. D. Joao, Food and Nutrition Sci. 2012, 3, 1354-1374. DOI:10.4236/fns.2012.310179
43.	A. O. Benin, H. Ahissou, Gbaguidi, F. Sanoussi, A. Houng-beme, A. Dansi, A. Sanni, Int. J. Curr. Microbiol. App. Sci. 2015, 4, 394-403.
44.	S. Veena, H. H. Bassim, C. S. Yogesh, Energy conversion and man. 2016, 122, 52-62.
45.	Muhammadi, Shabina, M. Afzal, S. Hameed, Green Chem. Let. and Rev. 2015, 8, 56-77.
DOI: 10.1080/17518253.2015.1109715
46.	Z. Quan, Z. Heng, C. Fei, L. Hu, P. Hu, X. Wei, H. De-Yu, Y. Song, J. Industrial and Engg. Chem. 2015, 31, 385-392. DOI:10.1016/j.jiec.2015.07.013
47.	E. M. Shahid, Y. Jamal, Renewable and Sustainable Energy Rev. 2011, 15, 4732-4745. DOh10.1016/j.rser.2011.07.079
48.	Y. M. Park, J. Y. Lee, S. H. Chung, I. S. Park, S. Y. Lee, D. K. Kim, J. S. Lee, K. Y. Lee, Bioresource Tech. 2010, 101, S59-S61. DOI:10.1016/j.biortech.2009.04.025
49.	K. H. Chung, B. G. Park, J. Ind. Eng. Chem. 2009, 15, 388-392. DOI:10.1016/j.jiec.2008.11.012
50.	X. R. Chen, Y. H. Ju, C. Y. Mou, J. Phys. Chem. C. 2007, 111, 18731-18737. DOI:10.1021/jp0749221
51.	X. Liu, X. Piao, Y. Wang, S. Zhu, H. He, Fuel. 2008, 87, 10761082. DOI:10.1016/j.fuel.2007.05.059
52.	X. Liu, H. He, Y. Wang, S. Zhu, X. Piao, Fuel. 2008, 87, 216221. DOI:10.1016/j.fuel.2007.04.013
53.	S. J. Yoo, H. S. Lee, V. Bambang, J. D. Kim, Y. W. Lee, Bior. Technol. 2010, 101, 8686-8989.
54.	S. Hu, L. Wen, Y. Wang, X. Zhen, H. Han, Bior. Tech. 2012, 123, 413-418. DOI:10.1016/j.biortech.2012.05.143
55.	P. R. Pandit, M. H. Fulekar, J. Environ. Manage. 2017, 198, 319-329. DOI:10.1016/j.jenvman.2017.04.100
56.	G. Jabbar, H. Ali, L. Xiaojun, H. A. Mukhtar, Appl.catalysis A: general. 2016, 527, 81-95. DOI:10.1016/j.apcata.2016.08.031
57.	H. Shengyang, G. Yanping, W. Yun, H. Heyou, Appl. Energy., 2011, 88, 2685-2690. DOI:10.1016/j.apenergy.2011.02.012
58.	G. Nagaraju, Udayabhanu, S. A. Shivaraj, M. S. Prashanth, K. V. Yathish, C. Anupama, D. Rangappa, Mat. Res. Bull. 2017, 94, 54-63. DOI:10.1016/j.materresbull.2017.05.043
59.	M. Rajesh, P. Shakkthivel, Bior. Tech. 2013, 150, 55-59. DOI:10.1016/j.biortech.2013.09.087
60.	A. U. Khan, Environ. Monit. Assess. 2010, 170, 171-184. DOI:10.1007/s10661-009-1224-y
61.	F. Rana, M. Avijit, Int. J. Rese. Pharm. Chemi. 2012, 2, 1035-1039.
62.	M. Raghavendra, H. S. Lalithamba, B. S. Sharath, H. Rajanai-ka, Scientia Iranica C. 2017, 24, 3002-3013.
63.	U. S. Rao, G. Srinivas, T. P. Rao, Procedia Materials Science. 2015, 10, 90-96.
64.	S. P. Vinay, N. Chandrasekhar, IOSR J. App. Chem. 2017, 10, 57-63.
65.	L. Wan, J. F. Li, J. Y. Feng, W. Sun, Z. Q. Mao, Mater. Sci. Eng. B. 2007,139, 216-220. DOI:10.1016/j.mseb.2007.02.014
66.	J. Zhang, J. Xi, Z. Ji, J. Mater Chem. 2012, 22, 17700-17708. DOI:10.1039/c2jm32391e
67.	S. Yedurkar, C. Maurya, P. Mahanwa, Open Journal of Synthesis Theory and Applications. 2016, 5, 1-14. DOI:10.4236/ojsta.2016.51001
68.	D. Panchavarnam, S. Menaka, A. Anitha, M. Arulmozhi, Int. J. ChemTech Research. 2016, 9, 308-315.
69.	S. N. Rao, M. V. B. Rao, American Journal of Materials Science. 2015, 5, 66-68.
70.	N. S. Sudarshan, N. Narendra, H. P. Hemantha, V. V. Suresh-babu, J. Org. Chem. 2007, 72, 9804-9807. DOI:10.1021/jo701371k
71.	J. B. Terry, J. bacteriology. 1999, 181, 4725-4733.
72.	G. Agata, K. Halina, F. Karol, Med. Chem. Res. 2015, 24, 3561-3577. DOI:10.1007/s00044-015-1397-6
73.	K. Uma, H. S. Lalithamba, M. Raghavendra, V. Chandramo-han, C. Anupama, Arkivoc. 2016, 4, 339-351.
74.	W. Irith, H. Kai, E. W. H. Robert, Nature Proto. 2008, 3, 163175. DOI:10.1038/nprot.2007.521
75.	L. B. Reller, M. Weinstein, J. H. Jorgensen, M. J. Ferraro, Clin Infect Dis. 2009, 49, 1749-1755. D0I:10.1086/647952
76.	S. P. Vinay, N. Chandrasekhar, App. Nanoscience. 2017, 7, 851-861. DOI:10.1007/s13204-017-0624-5
Povzetek
S preprosto, učinkovito in priročna metodo smo pripravili nanodelce cinkovega oksida ZnO. Različne parametre, kot so velikost in morfologija, tako pripravljenih nanodecev, smo preučevali z naslednjimi metodami: rentgenska praškovna difrakcija (XRD), infrardeča spektroskopija (FT-IR), UV-Vis spektroskopija, vrstično elektronsko mikroskopijo (SEM), in energijsko disperzijsko spektroskopijo rentgenskih žarkov (EDX). Nanodelce ZnO smo uporabili kot katalizatorje pri pripravi estrov aminokislin in v postopku sinteze biodizla. Tako sintetizirane estre smo karakterizirali z masno spektroskopijo (HRMS) in NMR spektroskopijo in z njimi opravili nekaj in vitro antibakterijskih in protiglivičnih testov. Nekateri izmed njih so pokazali obetajočo aktivnost proti bakterijskim patogenom.
DOI: 10.17344/acsi.2017.4053	Acta Chim. Slov. 2018, 65, 365-371	©commohs
Scientific paper
Phase Equilibria in the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 Section of the Tl-Pb-Bi-Sm-Te System
Samira Zakir Imamaliyeva,1,* Alakbarzade Ganira Ilgar,2 Mahmudova Matanat Aydin,3 Amiraslanov Imameddin Rajabali3 and Mahammad Baba Babanly1
1 Institute of Catalysis and Inorganic Chemistry named after acad. M. Nagiyev, Azerbaijan National Academy of Sciences,
113, H. Javid. ave., AZ-1143, Baku, Azerbaijan
2 Azerbaijan State Oil and Industry University, 16/21, Azadlig Ave., AZ-1010, Baku, Azerbaijan
3 Physics Institute, Azerbaijan National Academy of Sciences, 131, H. Javid ave., Az-1143, Baku, Azerbaijan

Corresponding author: E-mail: samira9597a@gmail.com Received: 04-12-2017
Abstract
Phase equilibria in the section Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 of the Tl-Pb-Bi-Sm-Te system were determined by combination of differential thermal analysis, powder X-ray diffraction methods as well as microhardness measurements. The phase diagrams of the boundary systems Tl4PbTe3-Tl9SmTe6, Tl9SmTe6-Tl9BiTe6, isothermal section at 820 and 840 K, some isopleth sections and as well as liquidus and solidus surfaces projections, were plotted. Unlimited solid solutions, which crystallize in Tl5Te3 structure type were found in the system at the solidus temperatures and below.
Keywords: Thallium-lead telluride; thallium-samarium tellurides; thallium-bismuth tellurides; phase equilibria; liquidus and solidus surfaces; solid solutions
1. Introduction
Complex chalcogenides based materials of great interest for many years due to their functional properties such as optic, photoelectric, magnet, thermoelectric et al.1-3 Some of these materials exhibit properties of topological insulators and can use in spintronic devices.4-6 Furthermore, a number of papers present the results of the study of interactions of the rare-earth elements with heavy elements chalcogenides.7-9
Tl5Te3 compound crystallizes in tetragonal structure (Sp.gr.I4/mcm, a = 8.930; c = 12.598 A), 1(U1 and has a number of ternary substitutional analogs of Tl4AIVTe3 and Tl9BVTe6 -type (AIV-Sn, Pb; BV-Sb, Bi),12-14 which also possess a good thermoelectric performance.15,16 Moreover, authors17 found the Dirac-like surface states in the [Tl4]TlTe3 (Tl5Te3) and its non-superconducting tin-doped derivative [Tl4](Tl1-xSnx)Te3.
A new thallium lanthanide tellurides of Tl9LnTe6 -type (Ln-Ce, Nd, Sm, Gd, Tb, Tm) were found to be a new structural analog of Tl5Te3.18,19 H. Kleinke and co-workers 20-22
confirmed the results of the studies,18,19 and determined the thermoelectric and magnetic properties for a number Tl9LnTe6-type compounds.
The development of the novel preparative methods for direct synthesis of functional materials requires to provide an accurate study of phase relations and plot the phase diagram.
Early, we presented the results of a study of phase relations for a number of systems including the Tl5Te3 compound or its structural analogs.23-25 The formation of unlimited solid solutions was shown for these systems.
In this paper, we continue to study similar systems and present the experimental results on phase equilibria in the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 section of the Tl-Pb-Bi-Sm-Te system.
The initial compounds of above-mentioned system have been studied in a number of papers. Tl4PbTe3 and Tl9BiTe6 melt congruently at 893 K,26 and 830 K,14 respectively, while Tl9SmTe6 is formed incongruently at 755 K.25 The tetragonal lattice constants of Tl4PbTe3, Tl9SmTe6, and Tl9BiTe6 are following: a = 8.841, c =
13.056Â, z = 427; a = 8.888; c = 13.013 Â, z = 228; a = 8.855, c = 13.048 Â, z = 2.25
According to Ref.26, the boundary system Tl4PbTe3-Tl9BiTe6 is quasi binary and characterized by the formation of unlimited solid solutions (6) with Tl5Te3-structure.
The alloys of the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 system were prepared by melting of previously synthesized ternary compounds. After synthesis the samples containing >60% Tl9SmTe6 were powdered, carefully mixed, pressed into pellets and annealed at 700 K during ~ 800 h in order to complete the homogenization. The total mass of each ingot is about 1 g.
2. Experimental 2. 1. Materials and Syntheses
The following reagents were used as starting components: thallium (granules, 99.999%), lead (ingot, 99.99%), samarium (powder, 99.9%), bismuth (granules, 99.999%), and tellurium (broken ingots 99.999%).
We used protective gloves at all times when working with thallium because thallium and its compounds are highly toxic and contact with skin is dangerous.
Stoichiometric amounts of the starting components were weighed with accuracy ±0.0001 g. Then they were put into silica tubes of about 20 cm in length and diameter about 1.5 cm and sealed under a vacuum of 10-2 Pa. Tl4PbTe3 and Tl9BiTe6 were synthesized by heating in a resistance furnace at 920 K followed by cooling in the switched-off furnace.
In the case of Tl9SmTe6, the ampoule was graphitized using pyrolysis of toluene in order to prevent the reaction of samarium with quartz. Taking into account the results of the work26, the intermediate ingot of Tl9SmTe6 was powdered in an agate mortar, carefully mixed, pressed into a pellet and annealed at 700 K within ~700 h.
The resulting ingots were homogeneous polycrystals alloys that were established by the differential thermal analysis (DTA) and X-ray diffraction (XRD).
2.	2. Methods
DTA and XRD analyses, as well as microhardness measurements, were used to analyze the samples of the investigated system.
The phase transformation temperatures were determined using a NETZSCH 404 F1 Pegasus differential scanning calorimeter within room temperature and ~1400 K at a heating rate of 10 K • min-1 and accuracy about ±2 K. The phase identification was performed using a Bruker D8 dif-fractometer utilizing CuKa radiation. The powder diagrams of the ground samples were collected at room temperature in the 20 range of 6-75°. The unit cell parameters of intermediate alloys were calculated by indexing of powder patterns using Topas V3.0 software. An accuracy of the crystal lattice parameters is shown in parentheses (Table). Microhardness measurements were done with a microhardness tester PMT-
3,	the typical loading being 20 g and accuracy about 20 MPa.
3. Results and Discussion
The Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 section was plotted based on combined analysis of experimental results and literature data on boundary system Tl4PbTe3-Tl9BiTe626 (Fig. 1-6).
Table 1. Experimental data of the DTA, microhardness measurements and parameters of tetragonal lattice for the alloys of the Tl4PbTe3-Tl9SmTe6 and Tl9BiTe6-Tl9SmTe6 sections of the Tl-Pb-Bi-Sm-Te system
Solid phase	Thermal	Microhardness,	Tetragonal lattice	
compositions	effects, K	MPa	parameters, Â a c	
Tl4PbTe3	893	1120	8.8409(5)	13.0556(6)
Tl8.2Pb1.6Sm0.2Te6	845-875	1160	8.8504(4)	13.0482(9)
Tl8.4Pb1.2Sm0.4Te6	820-850	1180	8.8602(5)	13.0387(8)
Tl8.5Pb1.0Sm0.5Te6	817-845	-	8.8645(6)	13.0343(9)
Tl8.6Pb0.8Sm0.6Te6	790-830	1150	8.8702(6)	13.0298(9)
Tl8.8Pb0.4Sm0.8Te6	775-800;1190	1140	8.8788(5)	13.0280(9)
Tl8.9Pb0.2Sm0.9Te6	760-775; 1155	-	-	-
Tl9SmTe6	755; 1180	1080	8.8882(5)	13.0132(7)
TL,Bi0,1Sm0,9Te6	760;1150	-	-	-
Tl9Bi0,2Sm0,8Te6	765-775; 1095	1120	8.8810(4)	13.0201(7)
Tl9Bi0,4Sm0,6Te6	770-790	1140	8.8741(5)	13.0279(8)
Tl9Bi0,5Sm05Te6	780-800	-	8.8710(5)	13.0301(8)
Tl9Bi0,6Sm0,4Te6	785-810	1110	8.8673(5)	13.0340(9)
Tl9Bi0,8Sm0,2Te6	810-820	1070	8.8614(5)	13.0410(8)
Tl9BiTe6	830	980	8.8545(4)	13.0476(7)
The Table presents the results of DTA, microhard-ness measurements, and parameters of the tetragonal lattice for starting compounds and some intermediate alloys.
Fig. 1. Polythermal sections (a), concentration dependencies of mi-crohardness (b), and lattice parameters (c) for the alloys of the Tl9S-mTe6-Tl9BiTe6 and Tl4PbTe3-Tl9SmTe6 sections of the Tl-Pb-Bi-Sm-
Te system.
Phase diagrams and the composition dependences of properties are plotted based on these data.
Tl4PbTe3-Tl9SmTe6 and Tl9BiTe6-Tl9SmTe6 sections (Fig. 1) are characterized by the formation of unlimited solid solutions (5) with Tl5Te3-structure. But, they are non-quasi-binary sections of the Tl-Pb-Sm-Te and Tl-Bi-Sm-Te quaternary systems due to the peritectic character of melting of Tl9SmTe6. As the result, the crystallization of TlSmTe2 compound occurs in a wide composition interval which leads to the formation of two-phase L+TlSmTe2 and three-phase L+TlSmTe2+5 areas. The L+TlSmTe2+5 area is shown by a dotted line because not fixed experimentally due to a narrow interval of temperatures.
In order to determine the phase constituents, polished surfaces of the intermediate samples were visually observed under the microscope of microhardness meter. The microhardness curves have a flat maximum which is typical for systems with unlimited solid solutions (Fig. 1b). 29
The XRD powder patterns for some alloys of the Tl4PbTe3-Tl9SmTe6 and Tl9BiTe6-Tl9SmTe6 sections are presented in Fig. 2. Powder diffraction patterns of Tl4PbTe3, Tl9SmTe6, and Tl9BiTe6 as well as intermediate alloys are single-phase and have the diffraction patterns qualitatively similar to Tl5Te3 with slight reflections displacement from one compound to another. For example, we present the powder diffraction patterns of alloy with composition 20, 50 and 80 mol% Tl9SmTe6 for both systems. Parameters of the tetragonal lattice of solid solutions obey the Vegard's law (Table, Fig. 1c).
Isopleth sections of the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 system (Fig. 3).
In order to construct a complete T-x-y diagram and to refine the boundaries of areas of primary crystallization of 5-phase and TlSmTe2, we constructed some isopleth sections. Figs.3a-c present the isopleth sections Tl9SmTe6-[A], Tl9BiTe6-[B] and Tl4PbTe3-[C] of the Tl4PbTe3-Tl9Sm-Te6-Tl9BiTe6 system, where A, B, and C are equimolar alloys from the respective boundary system as shown in
Fig. 4.
Along the Tl9SmTe6-[A] section, the 5-phase crystallizes in the composition area <60 mol% Tl9SmTe6. In the Tl9SmTe6- rich interval the TlSmTe2 primary crystallizes, then a monovariant peritectic process L+TlSmTe2 — 5 takes place (Fig. 3 a).
Over the entire compositions range of the Tl9 BiTe6-[B] and Tl4PbTe3-[C] sections, crystallization of the 5-phase occurs from the melt (Fig. 3b,c,).
The XRD powder patterns for selective alloys on polythermal sections confirmed continuous solid solutions with the Tl5Te3- structure.
The liquidus and solidus surfaces projections (Fig. 4)
Projection of liquidus of Tl4PbTe3-Tl9SmTe6-Tl9 BiTe6 section consists of two fields of the primary crystallization of TlSmTe2 and 5- solid solutions. These fields are separated by a monovariant peritectic curve L+TlSmTe2 — 5 (ab curve). The solidus projection (dashed lines) con-
a)
-JLjJ
u
L


JuJ
-U-LUj_LwL
JO mol% TljPbTej + 70 mol VoTbSmTe»
J_Jl___._■_
JJLwj^J__U
SO mol% TiiPbTej + 50 mol %TI„SmTefl
J_.
70 mol% TUPbTej + JO mol %TI,Sn>Te6
-^jJUui^^i_L
3	i
ii
TIjPbTtj
b)
2-Theta - Scale
« . 1,	1 Tl,SniTe«
, i Jl	80 mol% TbSmTe6 + 20 mol% TIsBiTet
	| SO mol% TUSmTet + 50 mol% TloBiTtt
*	20 mol% ThSmTcs+SO mul% TtBiTes
rl M " r"< a H k Jli	g TlsBiTes 11 3 3 ^ 2 2 a £ a 8 "A " * T , 1
Fig. 2
2-Theta - Scale
XRD powder patterns for starting compounds and some alloys of the Tl4PbTe3-Tl9SmTe6 (a) and Tl9SmTe6-Tl9BiTe6 (b) systems.
TL,SmTes 80
60 40 mol % TlsSmTes a)
20
[A]
b)
c)
Fig. 3. Polythermal sections Tl9SmTe6-[A], Tl9BiTe6-[B] and Tl4P-bTe3-[C] of the phase diagram of the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 section of the Tl-Pb-Bi-Sm-Te system. A, B, and C are equimolar alloys from the respective boundary system as shown in Fig. 4.
sist of one surface corresponding to the completion of the crystallization of the S-phase.
Isothermal sections at 820 and 840 K of the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 section (Fig. 5) are consists of areas of L-, TlSmTe2 and S- phases. In alloys <60 mol% Tl9SmTe6 in the two-phase L+S region the directions of the
Fig. 4. The liquidus and solidus surfaces projections Tl4PbTe3-Tl9S-mTe6-Tl9BiTe6 section of the Tl-Pb-Bi-Sm-Te system. The investigated sections are shown by dash-dot lines. A, B and C are equimolar compositions of the boundary systems. Primary crystallization phases: 1-Ô; 2-TlSmTe2
Fig. 5. Isothermal sections at 820 and 840 K in the Tl4PbTe3-Tl9S-mTe6-Tl9BiTe6 section of the Tl-Pb-Bi-Sm-Te system.
connodes are on the studied composition plane. It should be noted that comparison of the isopleth sections (Fig. 3) and isothermal sections (Fig. 5) shows that the directions of the connodes in the two-phase region L+S deviate from the T-x plane and constantly vary with temperature. Isothermal sections at 820 and 840 K clearly confirm this.
4. Conclusion
A complete phase diagram of the Tl-Pb-Bi-Sm-Te system in the Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 composition interval is plotted. Unlimited solubility of components in the solid state is found in the studied section. Obtained experimental results can be used for choosing the composition of solution-melt for the growth of the high-quality crystals of 6- phase which is of interest as thermoelectric material.
5. Acknowledgment
The work has been carried out within the framework of the international joint research laboratory "Advanced Materials for Spintronics and Quantum Computing" (AMSQC) established between Institute of Catalysis and Inorganic Chemistry of ANAS (Azerbaijan) and Donostia International Physics Center (Basque Country, Spain).
6. References
1.	Applications of Chalcogenides: S, Se, and Te, ed. by Gurinder Kaur Ahluwalia, Springer, 2016.
2.	A. V. Shevelkov, Russ. Chem. Rev, 2008, 77, 1-19 DOI: 10.1070/RC2008v077n01ABEH003746
3.	M. G. Kanatzidis, in T. M. Tritt (ed.), Semiconductors and semimetals. San Diego; San Francisco; N. Y.; Boston; London; Sydney; Tokyo: Academ. Press. 2001, 69, 51-98.
4.	N. Singh and U. Schwingenschlogl, Phys. Status Solidi RRL. 2014, 8, 805-808. DOI:10.1002/pssr.201409110
5.	Y. L. Chen, Z. K .Liu, J. G. Analytis, J. H. Chu, H. J. Zhang, B. H. Yan et al., Phys Rev Lett., 2010, 105, 266-401.
DOI: 10.1103/PhysRevLett.105.266401
6.	S. V. Eremeev, Yu. M. Koroteev, E. V. Chulkov, JETP Lett., 2010, 92, 161-165. DOI:10.1134/S0021364010150087
7.	C. Zhou, L. Li, J. Phys. Chem. Solids, 2015, 85, 239-244. DOI:10.1016/j.jpcs.2015.05.021
8.	B. Yan, H-J. Zhang, C-X. Liu, X-L. Qi, T. Frauenheim and S-C. Zhang, Phys. Rev. B. 2010, 82, 161-108(R)-7
9. O. V. Andreev, V. G. Bamburov, L. N. Monina, I. A. Razumk-ova, A. V. Ruseikina, O. Yu. Mitroshin, V. O. Andreev, Phase equilibria in the sulfide systems of the 3d, 4f-elements. Ekaterinburg: Editorial Publication Department of the UR RAS, 2015
10.	I. Schewe, P. Böttcher, H. G. Schnering, Z Kristallogr. 1989, Bd188, 287-298. DOI:10.1524/zkri.1989.188.3-4.287
11.	R. Cerny, J. Joubert, Y. Filinchuk, Y. Feutelais, Acta Crystal-logr. C., 2002, 58, 163.
12.	A. A. Gotuk, M. B. Babanly, A. A. Kuliev, Inorg. Mater. 1979, 15, 1062-1067.
13.	M. B. Babanly, A. Azizulla, A. A. Kuliev, Russ. J. Inorg. Chem. 1985, 30, 1051-1059.
14.	M. B. Babanly, A. Azizulla, A. A. Kuliev, Russ. J. Inorg. Chem. 1985, 30, 2356-2359.
15.	B. Wolfing, C. Kloc, J. Teubner, E. Bucher, Phys. Rev. Let. 2001, 36, 4350-4353. DOI:10.1103/PhysRevLett.86.4350
16.	Q. Guo, M. Chan, B. A. Kuropatwa, H. Kleinke, J. Appl. Phys., 2014, 116, 183702/1-9
17.	K. E. Arpino, D. C. Wallace, Y. F. Nie, T. Birol, P. D. C. King, S. Chatterjee, M. Uchida, S. M. Koohpayeh, J.-J. Wen, K. Page, C. J. Fennie, K. M. Shen, and T. M. McQueen, Phys. Rev. Lett. (PRL). 2014, 112, 017002-5. DOI:10.1103/PhysRevLett.112.017002
18.	S. Z. Imamalieva, F. M. Sadygov, M. B. Babanly, Inorg. Mater. 2008, 44, 935-938. DOI:10.1134/S0020168508090070
19.	M. B. Babanly, S. Z. Imamaliyeva, D. M. Babanly, Azerb. Chem. J. 2009, 2, 121-125.
20.	S. Bangarigadu-Sanasy, C. R. Sankar, P. Schlender, H. Kleinke, J. Alloys Compd. 2013, 549, 126-134. DOI:10.1016/j.jallcom.2012.09.023
21.	S. Bangarigadu-Sanasy, C. R. Sankar, P. A. Dube, J. E. Greed-an, H. Kleinke, J.Alloys. Compd. 2014, 589, 389-392. DOI:10.1016/j.jallcom.2013.11.229
22.	Q. Guo, H. Kleinke, J. Alloys. Compd. 2015, 630, 37-42. DOI:10.1016/j.jallcom.2015.01.025
23.	S. Z. Imamaliyeva, T. M. Gasanly, V. A. Gasymov, M. B. Babanly, Acta Chim. Slov., 2017, 64, 221-226. DOI:10.17344/acsi.2017.3207
24.	S. Z. Imamaliyeva, I. F. Mekhdiyeva, V. A. Gasymov, M. B. Babanly, Mater.Res., 2017, 20, 1057-1062. DOI:10.1590/1980-5373-mr-2016-0894
25.	S. Z. Imamaliyeva, V. A. Gasymov, M. B. Babanly, Chemist, 2017, 90, 1-6.
26.	M. B. Babanly, G. B. Dashdiyeva, F. N. Guseinov, Chem . Probl., 2008, 1, 69-72.
27.	S. Bradtmöller, P. Böttcher, Z. anorg. allg. chem., 1993, 619, 1155-1160. DOI:10.1002/zaac.19936190702
28.	T. Doert, P. Böttcher, Z. Kristallogr., 1994, 209, 95.
29.	V. M. Glazov, V. N. Vigdorovich, Mikrotverdost' metallov i poluprovodnikov (Microhardness of Metals and Semiconductors), Moscow: Metallurgiya, 1969.
Povzetek
V sistemu Tl-Pb-Bi-Sm-Te smo preučevali fazna ravnotežja dela Tl4PbTe3-Tl9SmTe6-Tl9BiTe6 s termično analizo, rentgensko praškovno difrakcijo in meritvami mikrotrdote. Pripravili smo fazne diagrame sistemov Tl4PbTe3-Tl9SmTe6, Tl9SmTe6-Tl9BiTe6, izotermične krivulje pri 820 K in 840 K, nekatere izopletne krivulje ter projekcije tekočinsko trdnih površin. Trdne raztopine kristalizirajo v Tl5Te3 kristalnem sistemu pri temperaturah strjavanja in nižjih.
DOI: I0.i7344/acsi.20i7.4096	Acta Chim. Slov. 2018, 65, 372-379	©commohs
Scientific paper
Synthesis, X-ray Structural Characterization, and DFT Calculations of Mononuclear Nickel(II) Complexes Containing Diamine and Methacrylate Ligands
Rasoul Vafazadeh,1^ Mansoor Namazian,1 Behnoosh Shahpoori-Arani,1 Anthony C. Willis2 and Paul D. Carr
1 Department of Chemistry, Faculty of Science, Yazd University, Yazd, Iran. 2 Research School of Chemistry, Australian National University, Canberra, ACT 2601, Australia. * Corresponding author: E-mail: rvafazadeh@yazd.ac.ir Received: 14-12-2017
Abstract
The mononuclear Ni(II) complexes [Ni(en)2(H2O)2](MAA)2 (1) and [Ni(pn)2(MAA)2] (2), where MAA, en and pn are methacrylate, ethylendiamine and 1,3-propylendiamine, respectively, have been synthesized and characterized by elemental analysis, FT-IR and UV-Vis spectroskopy. Structures of the complexes have been determined by single-crystal X-ray diffraction analyses. In the nickel(II) complexes 1 and 2 nickel(II) ion is six-coordinate and has a distorted octahedral geometry. Ni(II) is bonded to four nitrogen atoms of the two diamines and additionally to two oxygen atoms of aqua ligand in 1, and two oxygen atoms of methacrylate ligands in 2. The theoretical geometries of the studied compounds have been calculated by means of density functional theory (DFT) at the B3LYP/6-311+G(d,p)/LanL2DZ level and considering effective core potential (ECP). The comparison of the results indicates that the employed DFT method yields good agreement with experimental data.
Keyword: Nickel(II) complex; mononuclear; methacrylate; diamine; DFT
1. Introduction
Transition metal complexes containing poly-dentate amine ligands the most widely used in coordination chemistry.1-5 There have been numerous of investigation on polydentate amines. These ligands, and in particular diamines such as ethylene diamine (en) and 1,3-propane diamine (pn) find great utility due to ease synthesis and the ability to form stable complexes with first-row transition metal ions.5-9 On the other hand, the complexes with organic, inorganic carboxylates and their derivatives are widely used in coordination chemistry. The carboxylates
in the complexes exhibit various possible bonding modes, mono- and bidentate by forming chelation or bridges in coordinating to the transition metal. The coordination mode of the carboxylate ligands depends on metal ion and other ligands employed in the synthesis of the complex-es.10-15
In our previous work, we reported the synthesis, spectroscopic characterization, structural aspects and density functional theory (DFT) calculations for two Cu(II) complexes containing diamine, acetate, and methacrylate ligands.15 In order to investigate the effect of the metal on the structural complexes with these ligands, we
H2N
diamine
n = 1, en ii = 2, pn
OH
MAA
Scheme 1. Synthesis of the complexes 1 and 2
"<CH2)n
\ Ni(CH3COO);
+H3N	NH3+	^
MAA"	MAA"
n = 1,L1 n = 2, L2
[Ni(en)2(H20)J(WAA)2 (1)
[Ni(pn)2(MAA)j] (2)
carried out the synthesis of two Ni(II) complexes by reaction of diaminum-methacrylic acid salt (diamines are eth-ylendiamine and 1,3-propylendiamine) with Ni(II) acetate (Scheme 1). The structures of the complexes have been determined by single-crystal X-ray diffraction analyses and calculated by density functional theory.
2. Experimental
2. 1. Starting Materials and Physical Measurements
All chemicals were of analytical reagent grade and were used without further purification. Infrared spectra were taken with an Equinox 55 Bruker FT-IR spectrometer using KBr pellets in the 400-4000 cm-1 range. Absorption spectra were determined in the solvent of dimethyl-formamide (DMF) using GBC UV-Visible Cintra 101 spectrophotometer with 1 cm quartz, in the range of 200-800 nm. Elemental analyses (C, H, N) were performed by using a CHNS-O 2400II PERKIN-ELMER elemental analyzer.
2. 2. X-Ray Crystallography
Diffraction images of 1 and 2 were measured at 150 K on Agilent Xcalibur and SuperNova diffractometers using Cu Ka (X = 1.54180 Â) and Mo Ka (X = 0.71073 Â) radiation, respectively. Data were extracted using the
Table 1. Crystallographic data and structural refinement for complexes 1 and 2
Compound	1	2
Empirical formula	C12H3oN4NiO6	C14H30N4NiO
Formula weight	385.10	377.13
Crystal system	Monoclinic	Monoclinic
Space group	C2/c	P21/c
Temperature (K)	150	150
a /Ä	24.4016 (10)	10.0738 (5)
b /Ä	6.9977 (3)	8.3205 (3)
c /Ä	10.7021 (6)	11.1221 (6)
a /°	90	90
ß /°	93.316 (4)	103.659 (3)
Y /°	90	90
V /Ä3	697.29 (9)	1610.89 (6)
Z	4	2
F(000)	824	404
4dc (g cm-3)	1.402	1.383
p (mm-1)	1.84	1.10
Measured reflections	9955	10433
Independent reflectionss	1803	2280
Observed reflections	1710	1868
Rint	0.036	0.044
RiF2 > 2a(F2)]	0.054	0.043
wR(F2) (all data)	0.159	0.098
CrysAlis PRO package.16 The structures were solved by direct methods with the use of SIR92.17 The structures were refined on F2 by full matrix last-squares techniques using the CRYSTALS program package.18 Atomic coordinates, bond lengths, and angles and displacement parameters have been deposited at the Cambridge Crystallographic Data Centre. Crystallographic data and refinement details for the complexes are given in Table 1. Details of the refinement procedures for the structures are given in the Supplementary Information.
2. 3. Theoretical Calculations
All computations were performed by means of standard DFT method using the Gaussian09 (G09) program package.19,20 The geometries of the studied complexes have been optimized at the B3LYP level of the theory.21 The basis set of 6-31G(2df,p) was used for the C, H, N, and O atoms as recommended by Curtiss and his co-workers,22 while the basis set of LanL2DZ was employed for Ni atom considering the size of complexes and hardware limita-tions23-25 Special care was taken to select the (global) minimum energy conformation via systematic conformational searching at this level. The nature of each stationary point was established by frequency calculations at the same level of B3LYP/6-31G(2df,p)/LanL2DZ. The geometry optimizations have been completed in the absence of solvent molecules and other impurities, and the optimized structures were compared with the crystalline structures. Charges on atoms have been calculated using Natural Bond Orbital (NBO) theory at the higher level of B3LY-P/6-311+G(2df,p)/LanL2TZf.26,27
2. 4. Syntheses of Compounds L1 and L2
The compounds L1 and L2 were prepared as previously reported elsewhere by us by reaction between two equivalents of methacrylic acid (20 mmol, 1.70 mL) and one equivalent of related diamine, 1,2-ethylendiamine (10 mmol, 0.67 mL) and 1,3-propandiamine (10 mmol, 0.84 mL) in methanol (40 mL), respectively.15 The resulting bright yellow solution was heated to reflux for two hours. After two days, the solid yellow powder obtained was filtered, washed with acetone and acetonitrile, and dried in air.
2. 5. Synthesis of Nickel(II) Complexes
Ni(CH3COO)2 • 4H2O (2.00 mmol, 0.496 g) was slowly added to an ethanol solution (40 mL) of the corresponding compound (L1, 2.00 mmol, 0.464 g; L2, 2.00 mmol, 0.492 g) and the resulting solution was stirred for two hours at room temperature. Two days upon evaporation of the solvents, a blue-green oil formed. The oil form obtained was re-suspended in ether and stirred at room temperature until a precipitate formed. The solid product
4
was recrystallized from suitable solvents according to the following procedures:
[Ni(en)2(H2O)2](MAA)2 (1)
Yield: 0.36 g (47%). The light violet solid product was re-crystallized from dichloromethane/toluene (1:1 v/v). The light violet crystals were filtered and dried in air. Anal. Calc. for C12H30N4NiO6 (385.09): C, 37.43; H, 7.85; N, 14.55%. Found: C, 37.62; H, 7. 91; N, 14.39%. IR (KBr, cm-1): 3276, 3192, 1628, 1547 and 1450. Electronic spectra for CH3OH: 1max (log s) 225 nm (2.93), 284 nm (2.46), 370 nm (2.26), 631 nm (0.93) and 1009 nm (0.93).
[Ni(pn)2(MAA)2] (2)
Yield: 0.50 g (66%). The blue-green solid product was re-crystallized from dichloromethane/n-hexane/toluene (3:1:2 v/v). Blue crystals were filtered and dried in air. Anal. Calc. for C14H30N4NiO4 (377.11): C, 44.59; H, 8.02; N, 14.86%. Found: C, 44.82; H, 8.18; N, 14.66%. IR (KBr, cm-1): 3290, 3176, 1632, 1546 and 1451. Electronic spectra for CH3OH: 1max (log s) 226 nm (4.60), 284 nm (3.65), 377 nm (3.40), 630 nm (0.71) and 1041 nm (0.46).
3. Results and Discussion 3. 1. Syntheses and Characterization of the Complexes
The diaminum-methacrylic acid salt ligands were obtained by reaction of related diamine (ethylendiamine, en, and 1, 3-propylendiamine, pn) and methacrylic acid in methanol under reflux. The reaction of nickel(II) acetate with L1 and L2 leads to the formation of mononuclear complexes 1 and 2, while in the reaction of copper(II) acetate with these ligands dinuclear copper complexes were formed.
The most significant IR bands for ligands and complexes are given in the experimental section. In the IR
spectra of the compounds L1 and L2 two strong bands at 1650 and 1455 cm-1 (for L1) and 1646 and 1455 cm-1 (for L2) corresponding to stretching frequencies of the carbox-ylate group: asymmetric vasym(COO-) and symmetric vsym(COO-), respectively.
In IR spectra of 1, [Ni(en)2(H2O)2](MAA)2, the appearance of two bands at 1628 and 1450 cm-1 due to asymmetric vasym(COO-) and symmetric vsym(COO-), respectively, reveal the uncoordinated methacrylate ions. In contrast, complex 2, [Ni(pn)2(MAA)2], shows two strong bands at 1632 and 1381 cm-1 corresponding to stretching frequencies of the carboxylate group: asymmetric vasym(COO-) and symmetric vsym(COO-), respectively. The difference between asymmetric and symmetric frequencies (A[vasym(COO-) - vsym(COO-)] > 200 cm-1) indicates a monodentate coordination mode for the methac-rylate ion (see the description of X-ray crystal structures section).10,12,28,29
The absorption spectra of the compounds L1 and L2 in methanol solution show band n-n* transitions at 226 and 216 nm, respectively. Electronic spectra of 1 and 2 show broad bands at 1009 and 631 nm (for 1) 1041 and 630 nm (for 2), respectively. These spectral features are consistent with six-coordinate octahedral geometry for Ni(II). These bands arise from spin-allowed d-d transitions of the nickel(II) ion in a distorted octahedral environment where two maxima observed in the visible region result from 3A2g^3T1g and 3A2g^3T2g transitions, respectively.30 The sharp a signal at 370 (for 1), and 377 nm (for 2) can be assigned to be charge transfer transition. Two bands at 284 and 225 nm (for 1) and 284 and 226 nm (for 2) assigned to intraligand n-n* transitions.
3. 2. Description of X-Ray Crystal Structures
3. 2. 1. Crystal Structures of 1 and 2
The molecular structure of nickel(II) complexes 1 and 2 are shown in Figs. 1 and 2, respectively. The com-
a)
b)
Fig. 1. The ORTEP view of complex 1 (a) with one methacrylate anion (b), showing 30% probability thermal ellipsoids
Fig. 2. The ORTEP view of complex 2 showing 30% probability thermal ellipsoids
plexes 1 and 2 crystallizes in monoclinic space group C2/c and monoclinic space group P2/c and there are four (Z = 4) and two (Z = 2) molecules in the unit cell, respectively.
The Ni-O and Ni-N bond lengths of the complexes 1 and 2 have good agreement with Ni(II) complexes previously reported.31-33
In both complexes, the nickel(II) ion is six-coordinate (N4O2 donor atoms) and have a distorted octahedral geometry. The equatorial plane is formed by four nitrogen atoms from two diamine ligands (ethylendiamine, 1, and 1,3-propylendiamine, 2) coordinates to the metal center. The ethylendiamine and 1,3-propylendiamine ligands form with Ni(II) atom five-membered and six-membered
Table 2. Selected bond lengths (Â) and angles (°) in complexes 1 and 2
Bond lengths (Â)	Bond angles (°)
Complex 1
Ni1-N1	2.088 (3)	N1	-Ni1	-N2	83.51 (13)
Ni1-N2	2.099 (3)	O1	-Ni1	-O1a	180
Ni1-O1	2.159 (3)	N1	-Ni1	-N2a	96.49 (13)
C3-O2	1.261 (5)	N1	-Ni1	-O1	88.17 (12)
C3-O3	1.264 (5)	O3	-C3-	O2	124.1 (3)
Complex 2					
Ni1-N1	2.105 (2)	N1	-Ni1	-N2	86.69 (9)
Ni1-N2	2.104 (2)	O1	-Ni1	-O1b	180
Ni1-O1	2.1225 (19)	N1	-Ni1	-N2b	93.31 (9)
C4-O1	1.267 (3)	N1	-Ni1	-O1	89.47 (8)
C4-O2	1.260 (3)	O1	C4-	O2	125.0 (3)
Symmetry codes: a = -x + 3/2, -y + 3/2, -z + 1; b = -x + 2, -y + 1,
-z + 1
chelate rings, respectively. The Ni-N bond lengths in the complex 2 are at distances 2.104(2) and 2.105(2) A, which are longer than Ni-N bond lengths (2.088(3) and 2.099(3) A) in the complex 1, possibly due to the increased chelate rings formed with the Ni(II) atom. The main difference between the two complexes is that in 1 where are two water molecules coordinated to the Ni(II) ion and two methac-rylate ions are not coordinated to the Ni(II) ion and acts only as counter anions, whereas in 2 the two methacrylate ions are coordinated to the center ion. The Ni-O bond length of complex 1 (2.159(3) A) is longer than the corresponding bond of complex 2 (2.1225(19) A). This variation is consistent with the anionic nature of the methacry-late ligands. The chelating N-Ni-N angle is 83.51(13)° for
1 and 86.69(9)° for 2, whereas the non-chelating N-Ni-N angles are 96.49(13)° and 93.31(9)° for 1 and 2, respectively. Selected bond lengths and angles, as well as interatomic distances, are summarized in Table 2.
In 1, there is a disorder pattern in the packing of the -C(CH3) =CH2 group over two positions, with relative occupancies of 52%:48% (Fig. 1b). However, in 2 two meth-acrylate ions are coordinated to the Ni(II) ion.
Table 3. Hydrogen bonding (Â) and angles (°) in complexes 1 and 2
D-H-A	D-H	H-A	D-A	D-H-A	Symmetry code
N1-H811—O1	0.95 (5)	2.59 (5)	3.337 (4)	135 (4)	-x + 3/2, y + H, -z + 3/2
N1-H811—O2	0.95 (5)	2.44 (5)	3.214 (4)	139 (4)	x, -y + 1, z + H
N1-H812—O3	0.91 (5)	2.15 (5)	3.041 (4)	170 (4)	x, y + 1, z
1 N2-H821—O3	0.91 (5)	2.19 (5)	3.066 (4)	164 (4)	x, -y + 1, z - H
N2-H822—O2	0.90 (5)	2.17 (5)	2.066 (4)	171 (4)	x, y, z
O1-H911—O2	0.96 (5)	1.78 (5)	2.731 (4)	172 (4)	-x + 3/2, -y + H, -z + 1
O1-H912—O3	0.84 (6)	1.91 (6)	2.747 (4)	173 (4)	x, y, z
N1-H5—O2 N2-H9-O2 2 N1-H12—O2 N2-H13—O2	0.89 (3) 0.88 (3) 0.91 (3) 0.88 (3)	2.44 (3) 2.16 (3) 2.13(3) 2.24 (3)	3.144 (4) 3.007 (4) 3.030 (4) 2.989 (4)	136 (1) 162 (1) 171 (1) 142 (1)	x, y, z -x + 2, y - H, -z + H x, -y + 3/2, z + H x, y, z
Crystal structures of complexes 1 and 2 both show hydrogen bonding interactions. In 1 one hydrogen atom of the coordinated water molecule is involved in a intramolecular hydrogen bonding interaction with the oxygen atom O3 of a methacrylate anion, and the other water H atom is hydrogen bonded to O2A of the methacrylate anion (symmetry code: x, -y + 1, z + with donor(D)-ac-ceptor(A) distances of 2.747(4) and 3.214(4) A and D-H-A angles of 173(5) and 139(4)°, respectively. Also, there is a hydrogen bonding interaction between the hydrogen atoms of the NH2 of the ethylendiamine ligands with the oxygen atoms of a methacrylate anion. In 2, there are hydrogen bonding interaction, between the hydrogen atoms bonded of the 1,3-propylendiamine with oxygen atoms of the methacrylate ligand. Full details of the hydrogen bonding are given in Table 3.
Fig. 3. Various hydrogen bonding interactions in complexes 1 and 2, other hydrogen atoms are omitted for clarity.
3. 3. DFT Optimized Geometries
The geometry optimization of nickel(II) complexes was carried out in their singlet and triplet spin states. The optimized geometric parameters at their most stable spin states, which are triplet for complexes 1 and 2 is shown in Fig. 4.
Fig. 4. The optimized structures of the complexes 1 and 2.
As shown in Table 4, the calculated bond lengths for the studied complexes agree well with the X-ray experimental data.
The differences between optimized geometrical parameters and experiment are less than 0.05 Â (bond distances) and 2° (bond angles) in most cases (Fig. 5).
<D	(2)
Fig. 5. Atom-by-atom superimposition of the calculated structures (black) over the X-ray structure (red); hydrogen atoms have been removed for clarity.
Table 4. Selected geometric parameters from X-ray experiment and DFT-B3LYP calculations
Bond length (A)	Expt.	Calc.	|Ad|	Bond angle (°)	Expt.	Calc.	|A0|
Ni1-N1	2.09	2.10	0.01	N1-Ni1-N2	83.5	82.11	1.4
1 Ni1-N2	2.10	2.14	0.04	O1-Ni1-O1a	180	178.3	1.7
Ni1-O1	2.16	2.26	0.10	N1-Ni1-O1	88.2	89.1	0.9
Ni1-N1	2.10	2.16	0.06	N1-Ni1-N2	86.7	83.6	3.1
2 Ni1-N2	2.10	2.16	0.06	O1-Ni1-O1b	180.0	180.0	0.0
Ni1-O1	2.12	2.10	0.02	N1-Ni1-O1	89.5	89.8	0.3
Symmetry codes: a =	-x + 3/2, -y + 3/2,	-z + 1; b = -x + 2,	-y + 1, -z + 1				
In general, the predicted bond lengths are slightly longer in comparison with the values based on the X-ray crystal structure data. The geometrical differences might be a result of crystal packing forces which have an influence on the molecules as expected for the experimental ones (solid state), but the calculated geometries are in the gas phase.34,35 The crystal packing forces, which have an influence on the molecules, as expected for the experimental parameters (solid state), is a reason for the difference of calculated bond lengths in the gas phase and solid phase.
The vibrational frequency calculations were performed based on the optimized structures of complexes. The calculated and experimental IR spectra of complexes are in good agreement with experimental data (Fig. 6 and Fig. S1).
The energies of the HOMO and LUMO molecular orbitals have been also calculated. The experimental values of HOMO-LUMO gap (A) for the complexes of 1 and 2 based on UV-Vis spectra are 5.51 and 5.49 eV, respectively, which corresponds to n — n* transitions. The theoretical
EÙÛ-
IR Spectrum
										
										
										
						U1				uJ
.............jj		Luii			J				m^-J	
□
-TWO—
-800
Frequency {cm )
Fig. 6. The experimental (top) and calculated (down) IR spectra of complex 2.
values have been calculated as 6.36 and 5.25 eV, respectively, which are in line with the experimental values with relatively low deviations.
The calculated charges on the metal centers in complexes 1 and 2 are +1.306 and +1.267 respectively, and these values are greatly lower than the formal charge of +2. These differences are as a result of charge donation from the donor atoms of ligands.
4. Conclusion
The reaction of nickel(II) acetate with L1 and L2 li-gands led to the formation of mononuclear complexes 1 and 2. The crystal structures were determined for two studied complexes. In mononuclear nickel(II) complexes 1 and 2, metal centers are hexacoordinated with a distorted octahedral geometry. The optimized structure of the complexes has been studied using the B3LYP/6-31G(d)/Lan-L2DZ level of theory. The calculated molecular geometries are in a very good agreement with the experimental data. It has been revealed that the triplet state for nickel(II) complexes 1 and 2 are more stable than their singlet state.
5. Supplementary Material
The deposition numbers of the studied complexes, 1 and 2 are CCDC 1481553 and 1481554, respectively. These data can be obtained free-of-charge via www.ccdc.cam. ac.uk/data_request/cif, by emailing data-request@ccdc. cam.ac.uk, or by contacting The Cambridge Crystallo-graphic Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK; fax +44 1223 336033.
6. Acknowledgement
MN is thankful to Prof. Michelle L. Coote and Research School of Chemistry, The Australian National University for the offer of campus visiting position and for the Gaussian calculations. BS is grateful to the graduate school of Yazd University for the post-graduate scholarships. MN and RV are also grateful to Yazd University and the Australian National University for their valuable support.
7. References
1.	G. C. Giri, A. Patra, G. Vijaykumar, L. Carrella, M. Bera, RSC Adv. 2015, 5, 99270-99283.
2.	P. Bhowmik, S. Biswas, S. Chattopadhyay, C. Diaz, C. J. Gómez-García, A. Ghosh, Dalton Trans. 2014, 43, 12414-12421
3.	K. Zheng, L. Jiang, Y. T. Li, Z. Y. Wu, C. W. Yan, RSC Adv. 2015, 5, 51730-51744.
4.	X. Sala, E. J. Garcia Suarez, Z. Freixa, J. Benet-Buchholz, P. W. N. M. van Leeuwen, Eur. J. Org. Chem. 2008, 6197-6205.
5.	H. Shirase, Y. Miura, Y. Fukuda, Monatsh Chem. 2009, 140, 807-814.
6.	M. Behrens, S. Scherb, C. Näther, W. Bensch, Z. Anorg. Allg. Chem. 2003, 629, 1367-1373.
7.	X. Wang, D. S. Yang, J. Phys. Chem. A 2006, 110, 7568-7576.
8.	F. Emmenegger, C. W. Schlaepfer, H. Stoeckli-Evans, M. Pic-cand, H. Piekarski, Inorg. Chem. 2001, 40, 3884-3888.
9.	H. Golchoubian, E. Rezaee, G. Bruno, H. Amiri Rudbari, In-org.Chim. Acta, 2013, 394, 1-9.
10.	L. N. Wang, L. Fu, J. W. Zhu, Y. Xu, M. Zhang, Q. You, P. Wang, J. Qin, Acta Chim. Slov. 2017, 64, 202-207.
11.	C. J. Lina, J. L. Qia, Y. Q. Zheng, J. L. Lina, J. Coord. Chem. 2013, 66, 3877-3890.
12.	R. Vafazadeh, Z. Moghadas, A. C. Willis, J. Coord. Chem. 2015, 68, 4255-4271.
13.	G. T. Musie, X. Li, D. R. Powell, Inorg. Chim. Acta 2006, 359, 1989-1996.
14.	S. Singh, D. Saini, S. K. Mehta, D. Choquesillo-Lazarte, J. Coord. Chem. 2011, 64, 1544-1553.
15.	R. Vafazadeh, M. Namazian, M. Chavoshiyan, A. C. Willis, P.
D.	Carr, Acta Chim. Slov. 2017, 64, 613-620.
16.	Agilent. CrysAlis PRO. Agilent Technologies Ltd, Yarnton, Oxfordshire, England, 2014.
17.	A. Altomare, G. Cascarano, G. Giacovazzo, A. Guagliardi, M. C. Burla, G. Polidori, M. Camalli, J. Appl. Cryst. 1994, 27, 435-436.
18.	P. W. Betteridge, J. R. Carruthers, R. I. Cooper, K. Prout, D. J. Watkin, J. Appl. Cryst. 2003, 36, 1487-1487.
19.	W. J. Hehre, L. Radom, P. V. R. Schleyer, J. A. Pople, Ab initio Molecular Orbital Theory, Wiley, New York, 1986.
20.	Gaussian 09, Revision D.01, M.J. Frisch, G. W. Trucks, H. B. Schlegel, G. E. Scuseria, M .A. Robb, J. R. Cheeseman, G. Scal-mani, V. Barone, B. Mennucci, G. A. Petersson, H. Nakatsuji, M. Caricato, X. Li, H.P. Hratchian, A. F. Izmaylov, J. Bloino, G. Zheng, J. L. Sonnenberg, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M. Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai, T. Vreven, J.A. Montgomery Jr., J.E. Peralta, F. Ogliaro, M. Bearpark, J. J. Heyd, E. Brothers, K. N. Kudin, V. N. Staroverov, T. Keith, R. Kobayashi, J. Normand, K. Raghavachari, A. Rendell, J. C. Burant, S. S. Iyengar, J. To-masi, M. Cossi, N. Rega, J. M. Millam, M. Klene, J .E. Knox, J. B. Cross, V. Bakken, C. Adamo, J. Jaramillo, R. Gomperts, R.
E.	Stratmann, O. Yazyev, A. J. Austin, R. Cammi, C. Pomelli, J. W. Ochterski, R. L. Martin, K. Morokuma, V. G. Zakrzewski, G. A. Voth, P. Salvador, J. J. Dannenberg, S. Dapprich, A. D. Daniels, O. Farkas, J. B. Foresman, J. V. Ortiz, J. Cioslowski, D. J. Fox, Gaussian Inc., Wallingford CT, 2010.
21.	A. D. Becke, J. Chem. Phys. 1993, 98, 5648-5652.
22.	L. A. Curtiss, P. C. Redfern, K. Raghavachari, J. Chem. Phys. 2007, 126, 084108-084120.
23.	J. B. Foresman, A.E. Frisch, Exploring Chemistry with Electronic Structure Methods, Gaussian Inc., Pittsburgh, PA, 1998.
24.	P. J. Hay, W. R. Wadt, J. Chem. Phys. 1985, 82, 270-283.
25.	P. J. Hay, W. R. Wadt, J. Chem. Phys. 1985, 82, 284-298.
26.	P. J. Hay, W. R. Wadt, J. Chem. Phys. 1985, 82, 299-310.
27.	J. P. Foster, F. Weinhold, J. Am. Chem. Soc. 1980, 102, 72117218.
28.	Y. Thio, X. Yang, J. J. Vittal, Dalton Trans. 2014, 43, 3545- 3556.
29.	K. Nakamoto, Infrared and Raman Spectra of Inorganic and Coordination Compounds, 4th ed., Wiley, New York, 1986.
30.	B. Shaabani, A. A. Khandar, M. Dusek, M. Pojarova, F. Mahmoudi, A. Feher, M. Kajnakova, J. Coord. Chem. 2013, 66, 748-762.
31.	R. Vafazadeh, A. Gorji, S. Ansari, A. C. Willis, Acta Chim. Slov. 2012, 59, 897-903.
32.	P. Ghorai, A. Chakraborty, A. Panja, T. K. Mondal, A. Saha, RSC Adv. 2016, 6, 36020-36030.
33.	D. Das, N. Sahu, S. Mondal, S. Roy, P. Dutta, S. Gupta, T. K. Mondal, C. Sinha, Polyhedron 2015, 99, 77-86.
34.	R. Vafazadeh, B. Khaledi, A. C. Willis, M. Namazian, Polyhedron 2011, 30, 1815-1819.
35.	G. Alpaslan, M. Macit, Spectrochim. Acta A 2014, 121, 372380.
Povzetek
Sintetizirali smo dva enojedrna Ni(II) kompleksa [Ni(en)2(H2O)2](MAA)2 (1) in Ni(pn)2(MAA)2] (2), kjer so MAA, en in pn metakrilat, etilendiamin in 1,3-propilendiamin. Okarakterizirali smo ju z elementno analizo, FT-IR in UV-Vis spektroskopijo. Strukture obeh kompleksov smo določili z monokristalno rentgensko analizo. V kompleksih 1 in 2 je okoli nikljevega(II) iona popačena oktaedrična geometrija. Ni(II) je v obeh spojinah vezan na štiri dušikove atome dveh diaminov ter nadalje na dva kisikova atoma aqua liganda v 1 oziroma dva kisikova atoma metakrilatnih ligandov v 2. Teoretične geometrije proučevanih spojin smo izračunali na podlagi teorije gostotnostnega funkcionala (DFT) na B3LYP/6-311+G(d,p)/LanL2DZ nivoju in ob uporabi efektivnih potencialov (ECP). Primerjava rezultatov kaže na dobro ujemanje uporabljene DFT metode z eksperimentalnimi podatki.
DOI: I0.i7344/acsi.20i7.4098	Acta Chim. Slov. 2018, 65, 380-387	©commohs
Scientific paper
Determination of Titanium Dioxide Content in Bauxites Using X-ray Fluorescence Spectrometry by Fusion and by Pressing
Dragana Blagojevic,1'* Dragica Lazic,2 Dragana Kešelj,2 Gordana Ostojic3
and Mugdin Imamovic4
1 Department of Chemistry, Faculty of Natural Sciences and Mathematics, University of Banja Luka, Mladena Stojanovica 2,
78 000 Banja Luka, BiH
2 Department of Chemical Technology, Faculty of Technology, University of East Sarajevo, Karakaj bb, 75400 Zvornik, BiH
3 Alumina Factory 'Alumina"Zvornik, Karakaj, 75400 Zvornik, BiH
4 Cement Factory "Lukavac", Lukavačkih brigada bb, 75300 Lukavac, BiH
* Corresponding author: E-mail: dragana_blagojevic@yahoo.com Tel.: +387 65 870 534
Received: 15-12-2017
Abstract
Bauxites of different deposits were analysed for their content of TiO2 (mass %), using X-ray fluorescence spectrometry and the reference spectrophotometric method JUS B.G8.514. The samples were prepared in two ways: fusion with a borax technique and pressing, after which beads were formed for the purpose of analysis. Certified reference samples of bauxite were used for producing a calibration curve. The equation for calculating the content of TiO2 (mass %) in the samples of bauxite was derived from the calibration curve. Results of the XRF method were tested statistically by means of the F-test and the t-test (the standard sample of the bauxite and the reference method). The values obtained from the afore mentioned tests for the fusion beads showed that the XRF method was precise and correct and that there were no systematic errors, whereas for the pressed beads this method showed significant systematic errors.
Keywords: XRF analysis, bauxite, titanium dioxide
1. Introduction
Bauxite is the principal ore for producing aluminium metal via a two-stage process that involves, firstly, the refining of bauxite to alumina through a wet chemical caustic leach process (the Bayer process) and, secondly, the electrolytic reduction of alumina to aluminium metal (the Hall-Heroult process).1 The remaining bauxite is used in the refractory, abrasive and chemical industries.2
The main minerals that are present in bauxite include several forms of hydrated aluminium oxide: gibbsite (Al2O3 ■ 3H2O), boehmite (Al2O3 ■ H2O), and diaspore (Al2O3 ■ H2O). In addition to these, the rock also contains significant quantities of the following minerals: corundum, goethite, hematite, kaolinite, halloysite, anatase, and rutile.3 This means that, in addition to the aluminium mineral, the
main components of bauxite are the following elements: iron, silicon, titanium, calcium, and magnesium. The mixture may also contain minerals of a series of other elements: Na, K, P, Cr, V, Ga, Zn, Pb, Cu, Ni, Mn,Co, and others.4
The mineralogy of bauxite deposits controls the efficacy of the Bayer process. Some of the gangue components, such as clays, fine-grained quartz, and titanium oxides, are deleterious as they react with the leaching solution, which causes caustic soda losses in the Bayer process.1
Bauxite usually contains 2-4 mass % of TiO2. TiO2 exists in the form such as anatase, rutile and brookite minerals.5 Various methods have been used for determining titanium content in different types of samples, such as: inductively coupled plasma-atomic emission spectrometry (ICP-AES),6 inductively coupled plasma-mass spectrometry (ICP-MS),7 graphite furnace atomic absorption spec-
trometry (GFAAS),8 catalytic adsorptive stripping voltam-metry (CASV),9 neutron activation analysis (NAA),10 spectrophotometry,11,12,13 X-ray fluorescence (XRF),14 and laser induced breakdown spectroscopy (LIBS).15
Chemical composition of bauxite is usually expressed in the content of Al2O3, SiO2, Fe2O3, TiO2, and CaO, with the loss on ignition at 1075 °C. In the alumina factory "Alumina", chemical determination of TiO2 content in bauxite is carried out using the spectrophotometry method JUS B.G8.514.
X-ray fluorescence spectrometry is a technique for the analysis of bulk specimens. It is based on the interaction of X-rays with atoms in the sample.16 Each of the elements present in a sample produces a set of characteristic fluorescent X-rays ("a fingerprint") that is unique for that specific element, which is why XRF spectroscopy is an excellent technology for qualitative and quantitative analysis of material composition.17
XRF is widely used for environmental, industrial, pharmaceutical, forensic, and scientific research applications to determine the presence or absence and, in some cases, to measure the concentration of elemental constituents or contaminants.18
Some examples in which the XRF technique was used are: determination of the chemical composition of different bauxites,19,20 bauxitic-based ceramic proppants,21 brown fused alumina,22 red mud (bauxite residue),23,24,25 determination of trace elements in rocks, soils, and sediments,26 analysis of ceramic oxide refractories.27
2. Experimental
Bauxites labelled "Brazil", "Grcka", and "Madarska", prepared in alumina factory "Alumina", in Zvornik, BiH, were used for the experimental part of the research.
Bauxite samples were first ground to particle size below 200 ^m and dried, and then annealed at 1075 °C. The loss on ignition was calculated at that temperature.
In the XRF analysis, for the purpose of the preparation of fused beads, 1 g of the annealed sample was separated and mixed with 8 g of Li2B4O7 in a platinum pot. After gentle stirring, using a glass rod, the pot was mounted on the "VULCAN" fusion system from Fluxana. After 15 min of melting at around 1250 °C, the sample was poured into a heated platinum mould. After cooling for 10 min, the bead obtained in this way was recorded by WDXRF "S8 TIGER" (BRUKER).
For the purpose of preparing pressed beads, 47.5 g of the annealed sample was separated and mixed with 2.5 g of wax and ground in a mill. The sample prepared in this way (10 g) was then transferred to the mould in the press and subjected to the pressure of 150 KN for 10 s.
The calibration curve was obtained based on the certified reference bauxite samples, which were also annealed prior to the process (Table 1).
One series of samples was prepared by fusion and poured into moulds for beads, and the other series was prepared by pressing in the moulds. The samples were recorded afterwards.
The parameters in the process of recording titanium were as follows: Line Ti KA1, Mask: 34 mm, Mode: Vacuum, 50 kV, 60 mA, Filter: None, Crystal (nominal): 2d = 4.026 A, Collimator aperture (nominal) = 0.46 degrees, Detector: flow counter LLD = 50, ULD = 150 % of nominal peak, Adjusted peak at 86.101 degrees 2-theta, Wavelength = 2.7485 A.
Spectrophotometric analysis involved the preparation of solutions by fusing the sample with a mixture of Na2CO3 and Na2B4O7 (3:1), according to a modified method JUS B.G8. 520/92 and ISO 6994/86. A UV-VIS spectro-
Table 1. Analysis of standard reference bauxite samples according to the certificate (mass %)
Components	69b NBS	696 NBS	697 NBS	698 NBS	BXT-09
	(Arkansas)	(Surinam)	(Dominican)	(Jamaican)	
AI2O3	48.80	54.50	45.80	48.20	53.40
BaO	0.008	0.004	0.015	0.008	-
CaO	0.13	0.018	0.71	0.62	0.010
Co	0.0001	0.00009	0.0013	0.0045	-
Cr2O3	0.011	0.047	0.100	0.080	0.037
Fe2O3	7.14	8.70	20.00	19.60	14.15
MgO	0.085	0.012	0.18	0.058	0.03
MnO	0.110	0.004	0.41	0.38	0.04
P2O5	0.118	0.050	0.97	0.37	0.07
K2O	0.068	0.009	0.062	0.010	-
SiO2	13.43	3.79	6.81	0.69	7.57
Na2O	0.025	0.007	0.036	0.015	-
SO3	0.63	0.21	10.13	0.22	-
TiO2	1.90	2.64	2.52	2.38	2.98
V2O5	0.028	0.072	0.063	0.064	0.06
Loss on Ignition	27.2	29.9	22.1	27.3	20.8
photometer Lambda 25 Perkin Elmer was used for measurement.
Mineralogical characterization of all the samples of bauxite was carried out using X-ray diffraction (XRD analysis) on a powder diffractometer PHILIPS PW 171. Radiation from the copper anticathode with the wavelength of CuKa = 1.54178 Â and a graphite monochromator were used for the analysis. The operating voltage on the tube was U = 40 kV, and the current intensity was I = 30 mA. Samples were tested in the range 29 5-50° and with time retention of 1s at each step. X'Pert Quantify computer software was used for instrument manipulation, whereas X'Pert HighScore was used for data processing.
3. Results and Discussion
According to XRD analysis and the obtained diffrac-tograms, the standard reference samples of bauxite have the following mineralogical composition: - Standard NBS 69b is a typical hydrargillite bauxite. In addition to gibbsite, this sample also contains kaolinite, hematite, goethite, and siderite (Figure 1).
Figure 1. Diffractogram of the standard bauxite sample NBS 69b (Arkansas)
Standard NBS 696 is a typical hydrargillite bauxite. In addition to gibbsite, this sample of bauxite also contains small traces of hematite, anatase, goethite, kaolinite, and pyrite (Figure 2).
251X1
	c		
			G-Gibl»ilc
			K-Kaoliniic
			Gct-Goclhile
			He-IIcmaLiic
			AC-Anutasc
	c		
	ÏJf	*t Ai tl	Hr.p j
Jt		K He	Pu c(t ? * C P
			
20	.10	JO
Position |°2TlKia|
■ Standard NBS 697 is a combined, gibbsite-boehmite type, with hematite content. In addition to the afore mentioned minerals, the sample also contains goethite and kaolinite, whereas anatase and calcinite are found in traces (Figure 3).
Figure 3. Diffractogram of the standard bauxite sample NBS 697 (Dominican)
■ Standard NBS 698 is a hydrargillite bauxite with hematite content. In addition to gibbsite, this sample also contains anatase, goethite, and hematite (Figure 4).
	
	G-CiiWssite
	Hc-Hcmatitc
	Get-Goelhile
	At-Anatasc
	r.rt.it* c (¡K.Hr CE« ^ i' r' k
	t „ I c G L
<;» H.At0 <• P He C«J*	
	!.. ^ IUI. V..y v1 v MV1 Vr ■,/ Vv• v¥■ *V*
1(1	20	30	40	JO
I'MliOll I I I'C .] I
Figure 4. Diffractogram of the standard bauxite sample NBS 698 (Jamaican)
Standard BXT 09 is a combined gibbsite-boehmite type of bauxite with hematite content. In addition to those
Figure 2. Diffractogram of the standard bauxite sample NBS 696 (Surinam)
Pisilion f^2Tht1a|
Figure 5. Diffractogram of the standard bauxite sample BXT-09
minerals, the sample also contains kaolinite, whereas anatase and quartz occur in traces (Figure 5).
According to the XRD analysis, the bauxite samples from different deposits ("Brazil", "Grcka", and "Madarska") have the following mineralogical composition: - "Brazil" is a typical hydrargillite type of bauxite. In addition to gibbsite, this sample contains boehmite, hematite, anatase, and kaolinite, all in traces (Figure 6).
Figure 6. Diffractogram of the bauxite sample "Brazil"
"Grcka" bauxite is diaspore bauxite with a boehmite and hematite contents. In addition to those minerals, the sample also contains calcite and anatase, whereas quartz, kaolinite, gibbsite, goethite, and rutile are present in traces (Figure 7).
Figure 7. Diffractogram of the bauxite sample "Grcka"
- "Madarska" is a gibbsite-boehmite combination with hematite and kaolinite contents. In addition to these minerals, the sample also contains goethite and traces of anatase and rutile (Figure 8).
Calibration curves were created based on data for standard certified reference samples of bauxite and the obtained values of intensity (Net) for the samples prepared by fusion and pressing (Figure 9 and Figure 10). The content of TiO2, which was taken as the basis for the development of the calibration curve, was calculated for an absolutely annealed sample.
---
-
Position I^TÍieJaJ
Figure 8. Diffractogram of the bauxite sample "Madarska"
Figure 9. Calibration curve for the beads prepared by fusion
The equation for calculating the percentage (mass %) of titanium dioxide in annealed bauxite was derived based on the calibration curve obtained for the beads resulting from fusion, Eq. (1):
TiO2(annealed)/% = 0.071917331 x
Net - 0.035012049
(1)
Figure 10. Calibration curve for the beads prepared by pressing
Another equation for calculating the percentage (mass %) of titanium dioxide in annealed bauxite was also derived based on the calibration curve obtained for the beads resulting from the process of pressing, Eq. (2):
TiO2 (annealed)/% = 0.019017877 x
Net + 0.621131611
(2)
The actual content of titanium dioxide in the samples of bauxite was calculated according to the following equation, Eq. (3):
100 -10/, Ti02/% - TiO: (annealed)/0/« * -
100
(3)
This calculation is based on the values of the loss on ignition (LOI) at 1075 °C (Table 2).
Table 2. Loss on ignition for bauxites from different deposits
Bauxite	LOI (1075 °C)/%
Brazil	27.84
Grcka	12.12
Madarska	19.05
On the basis of the calibration curve, the samples of different deposits prepared by fusion and by pressing were recorded, and the content of TiO2 was calculated according to the above equations (Table 3 and Table 4).
Table 3. The content of TiO2 in bauxites from different deposits, calculated using a spectrophotometric and XRF method (by fusion)
Bauxite	TiO2 (mass %)	Residual
	Spectrophotometry XRF	value
Brazil	1.267 1.3271	0.0601
Grcka	2.59 2.6219	0.0319
Madarska	2.113 2.1829	0.0699
x	- -	0.053966667
S	- -	0.01972849
Table 4. The content of TiO2 in bauxites from different deposits calculated using spectrophotometric and XRF method (by pressing)
Table 5. The content of TiO2 in ten different beads of the "Grcka" bauxite sample calculated using the XRF method (by fusion)
Bead	Intensity	TiO2 (mass %)
(kcps)	annealed	not annealed
1	42.1089	2.99335	2.6304
2	41.9086	2.97894	2.6178
3	41.8425	2.97419	2.6136
4	41.9263	2.98022	2.6189
5	42.0063	2.98597	2.6239
6	42.1625	2.99720	2.6338
7	41.9912	2.98488	2.6229
8	41.9809	2.98414	2.6223
9	41.9748	2.98370	2.6219
10	41.8317	2.97341	2.6129
Min	41.8317	2.97341	2.6129
Max	42.1625	2.99720	2.6338
x	41.97337	2.9836	2.6219
S	0.104991	0.007551	0.006622
Table 6. The content of TiO2 in one bead of the bauxite sample "Grcka" calculated using the XRF method (by fusion)
Number	Intensity	TiO2	(mass %)
of measu-	(kcps)	annealed	not annealed
rements			
1	42.1986	2.99980	2.6361
2	42.0286	2.98757	2.6254
3	41.9453	2.98158	2.6201
4	42.2673	3.00474	2.6399
5	42.2150	3.00098	2.6371
6	42.2632	3.00444	2.6402
7	41.9801	2.98408	2.6222
8	42.2027	3.00009	2.6364
9	42.2263	3.00179	2.6379
10	42.0353	2.98805	2.6258
Min	41.9453	2.98158	2.6201
Max	42.2673	3.00474	2.6402
x	42.13624	2.995312	2.6322
S	0.124065	0.008924	0.00779
Bauxite	TiO2 (mass %)	Residual
	Spectrophotometry XRF	value
Brazil	1.267 1.5703	0.3033
Grcka	2.59 2.6569	0.0669
Madarska	2.113 2.3959	0.2829
x	- -	0.2177
S	- -	0.130994351
The data presented here were obtained as a result of recording ten different beads from every sample, as well as recording a bead from each sample ten times. Moreover, ten samples for every bauxite were prepared for spectro-photometric analysis of the content of TiO2. The results for "Grcka" bauxite are shown in the tables below (Table 5, Table 6, and Table 7).
In order to check the precision of the XRF method for the beads prepared by fusion, a F-test was conducted,
Table 7. The content of TiO2 in ten different samples of "Grcka" bauxite calculated using spectrophotometric method JUS B.G8.514
r of analysis	TiO2 (mass %)
1	2.69
2	2.59
3	2.54
4	2.42
5	2.58
6	2.66
7	2.55
8	2.64
9	2.64
10	2.59
Min	2.42
Max	2.69
x	2.59
S	0.076739096
where the zero hypothesis tested was that the variances in the spectrophotometric method for calculating the content of TiO2 in bauxites-JUS B.G8.514 and in a non-standard XRF method were equal. The following value of the F-test was obtained:
Ï
F = —i—, z7 = 101,85 , v, = -1,
(4)
Critical value at a = 0.05, v1 = 9, v2 = 9 is F9.9 = 3.18. The calculated result is considerably higher than the critical value, which means that the difference between the variances of the two methods is significant, and, with a risk of 5%, the zero hypothesis on the equality of variances can be rejected. The standard method variance is higher than the XRF method variance, which leads to the conclusion that the XRF method is more precise.
The test of accuracy for the XRF method used in determining TiO2 was performed on the standard bauxite BXT-09, as well as compared to the same reference method. Ten beads of this standard were prepared by fusion and then recorded. The results obtained are given in Table 8.
equality of arithmetic means of the two methods. The following values were calculated for this purpose:
(6)
(7)
Critical value at a= 0.05, v = 9 is t= 2.262. Since in this case |f| < |f|critical the hypothesis of equality of arithmetic means of the two methods can be accepted and one can conclude, with the risk of 5 %, that the XRF method has no systematic error.
The following tables (Table 9 and Table 10) show results for "Grcka" bauxite sample obtained by measuring the beads prepared by pressing.
Table 8. The content of TiO2 in the certified bauxite sample BXT-09 determined by XRF method (by fusion)
Table 9. The content of TiO2 in ten different beads of "Grcka" bauxite calculated using the XRF method (by pressing)
Bead	Intensity	TiO2	(mass %)	Bead	Intensity	TiO2	(mass %)
	(kcps)	annealed	not annealed		(kcps)	annealed	not annealed
1	52.4692	3.73843	2.9608	1	126.1713	3.02064	2.6544
2	52.9908	3.77595	2.9906	2	125.9570	3.01657	2.6508
3	52.2886	3.72544	2.9505	3	126.4727	3.02637	2.6595
4	52.1599	3.71619	2.9432	4	126.4312	3.02558	2.6588
5	53.0883	3.78296	2.9961	5	126.2525	3.02219	2.6558
6	52.7425	3.75809	2.9764	6	126.6123	3.02903	2.6618
7	52.3993	3.73341	2.9569	7	126.3718	3.02445	2.6578
8	52.8240	3.76395	2.9811	8	126.1743	3.02070	2.6545
9	52.4176	3.73472	2.9579	9	126.4447	3.02584	2.6589
10	52.6323	3.75016	2.9701	10	126.3210	3.02349	2.6569
Min	52.1599	3.71619	2.9432	Min	125.9570	3.01657	2.6508
Max	53.0883	3.78296	2.9961	Max	126.6123	3.02903	2.6618
x	52.60125	3.74793	2.9684	x	126.3209	3.023486	2.6569
S	0.306229	0.022025	0.017461	S	0.188271	0.003579	0.003156
These results served as a starting point for the t-test, where the hypothesis on the equality of the reference value and the average value of the results was tested.
(5)
Critical value at a = 0.05, v = 9 is t = 2.262. Since |f| < Mcnticd, with the risk of 5%, the zero hypothesis can be accepted, and one can conclude, that the XRF method does not have a systematic error.
Testing the accuracy of the XRF method using the same reference method involved testing the hypothesis of
Another F-test was conducted in order to test the precision of the XRF method for the beads prepared by pressing and the results were as follows: , 2
F =-
S,2
F - 453.93
(8)
Again, the calculated value was considerably higher than the critical value, the difference between the variances of the two methods was significant and, with the risk of 5%, the zero hypothesis on equality of the variances had to be rejected. The variance of the standard method was higher than the variance of the XRF method, which again leads to the conclusion that the latter is more precise.
Table 10. The content of TiO2 in one bead of "Grcka" bauxite calculated using the XRF method (by pressing)
Number	Intensity	TiO2	(mass %)
of measu-	(kcps)	annealed	not anneal
rements			
1	126.1205	3.01968	2.6536
2	126.1848	3.0209	2.6546
3	126.0728	3.01877	2.6528
4	126.0922	3.01914	2.6531
5	125.9905	3.01720	2.6514
6	125.9390	3.01622	2.6505
7	126.5761	3.02834	2.6612
8	126.4619	3.02617	2.6593
9	126.3677	3.02438	2.6577
10	126.2962	3.02302	2.6565
Min	125.9390	3.01622	2.6505
Max	126.5761	3.02834	2.6612
x	126.2102	3.021382	2.6551
S	0.208899	0.003974	0.003499
Table 11. The content of TiO2 in the reference bauxite sample B 010 calculated using the XRF method (by pressing)
Bead	Intensity	TiO2	(mass %)
	(kcps)	annealed	not annealed
1	140.4317	3.29184	2.9245
2	139.7303	3.27851	2.9126
3	140.0871	3.28529	2.9187
4	140.2406	3.28821	2.9212
5	140.3696	3.29066	2.9234
6	140.4510	3.29221	2.9248
7	139.9880	3.28341	2.9169
8	140.3402	3.29010	2.9229
9	140.1154	3.28583	2.9191
10	140.0452	3.28449	2.9179
Min	139.7303	3.27851	2.9126
Max	140.4510	3.29221	2.9248
x	140.1799	3.287055	2.9202
S	0.229043	0.004353	0.003881
Testing the accuracy of the XRF method using the same reference method involved testing the hypothesis of equality of arithmetic means of the two methods. The following values were calculated for this purpose:
(9)
(10)
Critical value at a = 0.05, v = 9 is t = 2.262. Since in this case |f| > |f|critical, then, with the risk of 5%, the hypothesis of the equality of arithmetic means of the two methods must be rejected. It can be concluded that the XRF method for the beads prepared by pressing does not yield the same average value as the reference method, which means that it shows a systematic error.
The test of accuracy for the XRF method for determining TiO2 for the beads prepared by pressing was conducted using the reference bauxite B 010. Ten beads were prepared and recorded. The data obtained are given in Table 11.
These values served as the basis for the t-test and the hypothesis on equality of the reference value and the average value of the results investigated.
(11)
Critical value at a = 0.05, v = 9 is t = 2.262. Since |f| > | f|critical, the zero hypothesis can be rejected, with the risk of
5%, and it can be concluded that the XRF method in this case shows a systematic error.
4. Conclusions
Based on recording the intensities of the beads made from certified reference bauxite samples, prepared by fusion, the calibration curve was obtained with the correlation coefficient of r = 0.9966 and the standard deviation of S = 0.6335. For the samples prepared by pressing, the calibration curve obtained had the correlation coefficient r = 0.9807 and the standard deviation S = 5.7738. The calibration curve was the basis for the equation used for calculating the content of TiO2 (%) in the bauxite samples for both methods of bead preparation. The average residual value between the content of TiO2 calculated using the XRF method and the reference method JUS B.G8.514 was 0.054, with the standard deviation of 0.019, for the beads obtained by fusion, and 0.218, with the standard deviation of 0.131 for the beads obtained by pressing. The XRF method was then tested for precision and accuracy. The F-test results show, with the risk of 5%, that the zero hypothesis on the equality of variances can be rejected. The standard method variance is higher than the XRF method variance for both fused and pressed beads, which leads to the conclusion that the XRF method is more precise. A t-test was conducted to test the accuracy (using the reference method and the standard bauxite samples BXT-09 and B 010) for the beads obtained by fusion and by pressing. In the case of the beads prepared by fusion, it can be concluded, with the risk of 5%, that the reference values and the average values of the results investigated were equal, that the arithmetic means of the two methods showed no differences, and
that the method did not have any systematic errors. As far as the pressed beads are concerned, it can be concluded, with the risk of 5%, that the arithmetic means of the two methods differed, as well as the reference and the average values of the results investigated, and that the XRF technique for this method of bead preparation showed a systematic error.
Based on the results obtained, it can be concluded that the XRF, as a method for calculating the content of TiO2 in bauxite, is precise and accurate when beads are prepared by fusion. For the beads prepared by pressing, this method shows a systematic error, which is a consequence of insufficient homogeneity of the sample.
5. References
1.	F. M. Meyer, Nat. Resour. Res., 2004, 13, 161-172. DOI:10.1023/B:NARR.0000046918.50121.2e
2.	M. Authier-Martin, G. Forte, S. Ostap, J. See, JOM, 2001, 53, 36-40. DOI:10.1007/s11837-001-0011-1
3.	J. E. Kogel, R. C. Nikhil, in J. E. Kogel (Ed.): Industrial Minerals and Rocks: Commodities, markets and Uses, Elsevier, New York, 2006, pp. 225-269.
4.	R. Vracar, 2. Zivkovic, Ekstraktivna metalurgija aluminijuma, Naucna knjiga, Belgrade, Serbia, 1993, pp. 1-14.
5.	J. Q. Li, Y. Zou, C. Y. Chen, Y. Z. Jia, Adv Mat Res, 2013, 1124-1127.
DOI:10.4028/www.scientific.net/AMR.734-737.1124
6.	G. Alkan, C. Schier, L. Gronen, S.Stopic and B. Friedrich, Metals, 2017, 7, 458. DOI:10.3390/met7110458
7.	H. Mahmoud, A. Abdel-Lateef, A. Attiah, J. Anal. Sci., Methods Instrum., 2013, 3, 62-66. DOI: 10.4236/jasmi.2013.31007
8.	T. M. S0rlie,G. Wibetoe, Anal Bioanal Chem, 2003,376, 721727. DOI:10.1007/s00216-003-1938-6
9.	M. Gawrys, J. Golimowski, Analytica Chimica Acta, 2001, 427, 55-61. DOI:10.1016/S0003-2670(00)01183-1
10. R. L. Njinga, M. N. Moyo and S. Y. Abdulmaliq, Int. J. Agron., 2013, 2013, 1-9. DOI: 10.1155/2013/156520
11.	R. K. Mondal, P. K. Tarafder, Microchim. Acta,2004,148, 327333. DOI: 10.1007/s00604-004-0272-9
12.	V. Srilalitha, A. R. G. Prasad, K. R. Kumar, V. Seshagiri, L. R. K. R. Ravindranath, Facta Univ., Ser.: Phys., Chem. Technol., 2010, 8, 15-24. DOI: 10.2298/FUPCT1001015S
13.	H. Z. Mousavi, N. Pourreza, J. Chin. Chem. Soc., 2008, 55, 750-754. DOI:10.1002/jccs.200800112
14.	B. Xing, X. Liu, Z. Zhang, K. Wang and K. Li, Commun. Soil Sci. Plant Anal., 2005, 35, 1839-1850. DOI:10.1081/LCSS-200026803
15.	D. N. Stratis, K. L. Eland, S. M. Angel, Appl. Spectrosc., 2000, 54, 1719-1726. DOI:10.1366/0003702001948871
16.	P. J. Potts, A Handbook of Silicate Rock Analysis, Springer, Boston, MA, 1992, pp. 226-285.
DOI: 10.1007/978-1-4615-3270-5
17.	S. Jagadeeswari, P. D. Devi, Asian J. Appl.Sci.Technol., 2017, 1, 196-198.
18.	Z. W. Chen., M.W. Gibson, H. Huang, X-Ray Opt. Instrum., 2008, 8, 1-10. DOI: 10.1155/2008/318171
19.	B. K. Gan, Z. Taylor, B. Xu, A. Riessen, R. D. Hart, X. Wang and P. Smith, Int. J. Miner. Process., 2013, 123, 64-72. DOI:10.1016/j.minpro.2013.05.005
20.	F. S. Oliveira, A. F. D. C. Varajâo, C. A. C. Varajâo, B. Boulangé, C.C. V. Soares, Catena, 2013, 105, 29-39. DOI:10.1016/j.catena.2013.01.004
21.	A. I. Assem, H. A. Nasr-El-Din, J. Pet. Sci. Eng., 2017, 158, 441-453. DOI:10.1016/j.petrol.2017.08.075
22.	E. R. Passos, J. A. Rodrigues, Ceramica, 2016, 62, 38-44. DOI: 10.1590/0366-69132016623611960
23.	R.-X. Liu, C.-S. Poon, J. Cleaner Prod., 2016, 112, 384-391. DOI:10.1016/j.jclepro.2015.09.049
24.	F. M. Kaußen, B. Friedrich, Hydrometallurgy, 2018, 176, 4961. DOI:10.1016/j.hydromet.2018.01.006
25.	N. Yalçin, V.Sevinç, Ceram. Int., 2000, 26, 485-493. DOI:10.1016/S0272-8842(99)00083-8
26.	A. G. Revenko, X-Ray Spectrom., 2002, 31, 264-273. DOI:10.1002/xrs.564
26. M. F. Gazulla, M. P. Gómez, A. Barba and J. C. Jarque, X-Ray Spectrom., 2004, 33, 421-430. DOI:10.1002/xrs.743
Povzetek
V boksitih iz različnih depozitov smo določali delež TiO2 (masni %) z X-žarkovno fluorescenčno spektrometrijo (XRF) in z referenčno spektrofotometrično metodo JUS B.G8.514. Vzorce smo pripravili na dva načina: tehnika fuzije z bo-raksom in stiskanje, zatem pa smo za namen analize oblikovali kroglice. Za pripravo umeritvene krivulje smo uporabili certificirane referenčne standarde boksita. Enačbo za izračun deleža TiO2 (masni %) v vzorcih boksita smo izpeljali iz umeritvene krivulje. Rezultate XRF metode smo statistično testirali z uporabo F-testa in t-testa (s standardnim vzorcem boksita in z referenčno metodo). Vrednosti iz zgoraj navedenih testov za kroglice po fuziji so pokazale, da je XRF metoda natančna in pravilna ter da nima sistematskih napak, medtem ko je za kroglice po stiskanju ta metoda pokazala signi-fikantno sistematsko napako.
DOI: I0.i7344/acsi.20i7.4i08	Acta Chim. Slov. 2018, 65, 388-393	©comriiohs
Scientific paper
Thin-Layer Chromatography: an Efficient Technique for the Optimization of Dispersive Liquid-Liquid Microextraction
Elena Kupcova,1'* Katarina Reiffova1 and Yaroslav Bazel'1
1 Department of Analytical Chemistry, Faculty of Science, Pavol Jozef Safarik University in Kosice, Moyzesova 11, SK-040 01, Kosice, Slovakia
* Corresponding author: E-mail: elena.kupcova@gmail.com Tel.: +421 908 408 121
Received: 18-12-2017
Abstract
Thin-layer chromatography (TLC) is an often omitted analytical technique due to its lower sensitivity and separation capacity. Even in the era of high-performance liquid chromatography (HPLC), thin-layer chromatography still offers many advantages, such as simplicity, rapidity, and cost-effectiveness, which predict TLC to be the first-choice method for the laborious optimization process requiring analysis of numerous samples. In this work, a thin-layer chromatography method with chemical and densitometric detection was used to optimize a dispersive liquid-liquid microextraction (DLLME) process for the extraction and preconcentration of estradiol in human urine. The chromatographic system consisted of silica gel plates as the stationary phase and toluene-ethanol (9:1; v/v) mixture as the developing solvent. The plates were dyed with 10% phosphomolybdic acid reagent and sequentially evaluated densitometrically at X = 430 nm. In the context of DLLME optimization, parameters including the type and volume of extraction and dispersive solvents, centrifugation, salt addition and extraction time, were studied. The proposed DLLME-TLC method was successfully applied to the determination of estradiol in real human urine samples.
Keywords: Thin-layer chromatography; post-chromatographic detection; dispersive liquid-liquid microextraction; es-tradiol; human urine
1. Introduction
Estrogens are human hormones primarily responsible for the development and function of female gonadal system, regulation of menstrual cycle, and maintenance of pregnancy1 which also take part in various biochemical processes within the organism in both males and females.2 Estrogens originate in steroidogenesis with estradiol (E2) being the primary product and the most potent human estrogen. Urinary estradiol levels are essential for the monitoring of regular pregnancy progress as well as for the diagnosis of reproductive and hormonal diseases.3 Estradiol concentrations in urine are typically low and fluctuate during pregnancy. While mean daily excretion of estradiol in menstruating women is 3.5 ^g, it usually elevates up to 259-330 ^g per day during pregnancy.4 Besides clinical applications, development of new analytical methods for the monitoring of estrogens in environmental and food samples is required due to their adverse effects on living organisms and environment.5,6 Chromatographic methods, pri-
marily high-performance liquid chromatography, are the most commonly used for the quantification of estrogens owing to their high sensitivity.7,8 Still, sample pretreatment remains a crucial step in the analysis of estrogens because of their low concentrations and complex character of the samples.9
Dispersive liquid-liquid microextraction (DLLME) was introduced in 200610 as a fast and straightforward sample preparation technique offering high preconcentra-tion factors and recoveries. DLLME is based on a ternary solvent system in which a dispersive solvent causes dispersion of an extraction solvent within the aqueous sample. A mixture of extraction and dispersive solvents is rapidly injected into the aqueous sample with a syringe resulting in the formation of tiny droplets of extraction solvent in the solution thus allowing fast transfer of the desired analyte into the extraction solvent. This state, called cloudy solution, disappears during centrifugation when the aqueous and organic phases are separated. The organic drop sedi-mented at the bottom of the tube is removed with a mi-
crosyringe and analyzed by the compatible analytical system.11 Although DLLME was initially introduced as an extraction technique for organic compounds from predominantly water samples, it has evolved to be suitable even for the extraction of analytes from more complex matrices, including biological samples.12 Few DLLME applications for estrogen extraction have been described13-17 so far; however, most of them were limited to water samples, except for two DLLME modifications used for the extraction of estrogens from milk18 and urine.19
This work describes optimization of a dispersive liquid-liquid microextraction for the extraction and precon-centration of estradiol in human urine samples using thin-layer chromatography (TLC) with chemical and den-sitometric detection which has, to the best of our knowledge, not been described yet. The main advantage of open planar arrangement over column chromatography lies in the possibility for simultaneous analysis of numerous samples at once, while column arrangement allows analysis of only one sample at a time. This factor significantly decreases the time needed for the analysis itself, making TLC the first-choice method for laborious optimization process, despite its lower sensitivity. Moreover, new aspects regarding the DLLME application to biological sample are presented, emphasizing the effects of centrifugation and salt addition on extraction recovery.
2. Experimental 2. 1. Chemicals and Reagents
Standard of 17^-estradiol (>98%) was purchased from Cayman Chemical (USA). Acetone, methanol, toluene, ethanol, tetrachloromethane, tetrachloroethane, chloroform and phosphomolybdic acid were obtained from Lambda Life (Slovakia), sodium chloride, sodium carbonate and potassium carbonate were from Mikrochem (Slovakia). All reagents were of analytical grade. Distilled water was used throughout all experiments.
2. 2 Instrumentation
End-capped plastic 5-mL test tubes, 100-^L mi-crosyringe (Hamilton, Switzerland), centrifuge MPW-310 (Poland), thermal chamber (Laboratorni pristroje Praha, Czech Republic), 5-^L microsyringe (Hamilton, Switzerland), alumina-backed TLC plates with silica gel coating ALUGRAM Sil G/ UV 254 (Macherey-Nagel, Germany) and vertical chromatographic chamber (Lublin, Poland) were used throughout the experiments.
2. 3 Thin-Layer Chromatography
Chromatographic separation was carried out on alumina-backed silica gel 60 TLC plates (10 x 10 cm, 0.20 mm) with fluorescent indicator UV254. The samples were
applied manually with a 5 ^L microsyringe to the starting line 1 cm from the bottom edge. The TLC plates were placed into the chromatographic chamber saturated with vapors of developing solvent, toluene-ethanol (9:1; v/v) mixture, at laboratory temperature. The developing distance was 8 cm and chromatographic separation in this system took 20 min. Developed TLC plates were dried in the stream of air at laboratory temperature for approximately 5 min and subjected to post-chromatographic detection. TLC plates were shortly (1-2 s) immersed in the detection reagent (10% phosphomolybdic acid in methanol20) and then heated in a thermal chamber at 110 °C for approximately 10 min, until dark-blue estradiol spots appeared on a yellow-greenish background. For quantification, the spots were evaluated densitometrically at X = 430 nm. The volume of sample applied to the plates was 0.3 ^L.
2. 4. Standard Solutions and Calibration Curve
Estradiol stock solution at a concentration of 5 mg mL-1 was prepared in methanol. Working standard solutions were prepared by further dilution of stock solution with methanol. The calibration curve in the range of 0.10 -5.00 mg mL-1 consisted of the following calibration points (n = 3): 0.10, 0.25, 0.50, 0.75, 1.00, 2.50 and 5.00 mg mL-1.
2. 5. Urine Samples
Urine samples obtained from healthy individuals were checked with diagnostic strips for the presence of pathological constituents such as blood, sugar, or proteins. The urine samples were frozen and stored at -10 °C. On the day of analysis, the urine samples were thawed in lukewarm water, centrifuged at 10 000 rpm for 5 min and only the supernatants were used for further study.
Urine of a 3-year old boy, spiked with estradiol at concentration of 0.1 mg mL-1, was used as a model urine sample throughout the optimization process. The real urine sample was prepared by blending pregnancy urines obtained from five healthy women in the second half of pregnancy as follows: 5 mL from each urine sample was combined together and diluted to 50 mL with distilled water.
2. 6. Dispersive Liquid-Liquid Microextraction
A mixture of tetrachloromethane as an extraction solvent and methanol as a dispersive solvent (500 ^L; 1:9, v/v) was rapidly injected into 2 mL urine sample with 1.5 mol L-1 NaCl. After gentle agitation for 30 s, the sample was centrifuged at 10 000 rpm for 5 min. Sedimented organic drop (75 ^L) was removed by a microsyringe and subjected to TLC analysis.
3. Results and Discussion 3. 1. Thin-Layer Chromatography
Silica gel aluminum-backed TLC plates were after the application of samples developed in vertical chromatographic chamber previously saturated with the vapors of developing solvent, a mixture of toluene and ethanol (9:1; v/v). After development, estradiol on TLC plate was visualized with 10% phosphomolybdic acid detection reagent as dark-blue spots on greenish background20 and it was quantified densitometrically at wavelength of X = 430 nm. TLC chromatogram and densitogram of estradiol standard analyzed in the described chromatographic system are demonstrated in Figure 1.
Figure 1. TLC chromatogram and densitogram of estradiol (E2) standard (0.25 mg mL-1; n = 3); stationary phase: silica gel, developing solvent: toluene-ethanol (9:1; v/v), detection reagent: 10% phosphomolybdic acid in methanol, X = 430 nm, sample volume: 0.3 |rL
Qualitative chromatographic parameter - Rf value for estradiol in this system was 0.28 (n = 3, RSD = 0.23%). Optimized TLC method was linear within the concentration range of 0.1 - 5.0 mg mL-1 (r = 0.9979) with LOD = 0.03 mg mL-1 and LOQ = 0.1 mg mL-1. The limit of detection (LOD) and the limit of quantification (LOQ) were calculated based on the standard deviation of response (a) and slope of calibration curve (b): LOD = 3 a/b and LOQ = 10 a/b.
3. 2. Optimization of Dispersive Liquid-Liquid Microextraction
The efficiency of DLLME procedure is significantly influenced by several factors which were studied in the following manner: (1) type and volume of extraction and dispersive solvents, (2) centrifugation conditions, (3) salt addition, and (4) extraction time. A model urine sample containing 0.1 mg mL-1 estradiol was used throughout the optimization process so the influence of real matrix on the extraction efficiency could be assessed.
The selection of dispersive and extraction solvents is crucial in order to attain efficient extraction of the analyte. The requirement for extraction solvent is higher density than water, good extraction capacity for the target analyte and low miscibility in water. On the other hand, high mis-cibility with dispersive solvent is mandatory. According to these requirements, three halogenated solvents were selected as extraction solvents: chloroform (p = 1.5 g cm-3), tetrachloromethane (p = 1.6 g cm-3) and tetrachloroethane (p = 1.6 g cm-3). The only demand for the dispersive solvent is high miscibility in both extraction solvent and the aqueous phase. Two dispersing solvents were tested in combination with selected extraction solvents: methanol and acetone. Dispersive solvent (500 ^L) was mixed with 100 ^L extraction solvent before injection into the model urine sample (2 mL). As a result of the rapid injection, a cloudy solution of a different character was formed, depending mainly on the type of the dispersive solvent: while acetone induced poor dispersion, methanol resulted in fine droplets of extraction solvent scattered within the sample. Consequently, the type of dispersive solvent greatly affected the quality of sedimented organic phase after centrifugation. The sedimented organic phase emerged as a compact drop and was well separated from the solution containing methanol. On the other hand, the sedimented organic phase obtained with acetone was inconsistent and exceeded the initial volume of extraction solvent which suggests that the phase also contained some undesirable portion of the sample or dispersive solvent besides the extraction solvent. According to the obtained results, methanol was selected as a suitable dispersive solvent. The extraction solvents were compared for extraction recovery. Chloroform provided the least extraction potential for es-tradiol in combination with both methanol and acetone, reaching extraction recoveries of 41% and 40%, respectively. Extraction recoveries obtained with tetrachlo-roethane and tetrachloromethane in both dispersive solvents ranged from 68% to 74%, reaching their highest level with tetrachloromethane in combination with methanol. Since the requirements for the optimal progress of DLLME procedure were fulfilled with methanol and tetrachloromethane, they were tested in various ratios for adequate development of dispersion, volume of sedimented organic phase and extraction recovery. These demands were met with 500 ^L tetrachloromethane-methanol (1:9; v/v) mixture which was used throughout the following experiments.
After the selection of extraction and dispersive solvents, the centrifugation conditions were investigated. Although most of the literature published about DLLME so far claims that 4 000 rpm is sufficient for extraction of estrogens in environmental water samples,13-17 this study indicated that urine sample requires higher centrifugation speed for adequate separation of phases. Centrifugation causes the separation of phases and is essential for the formation of compact organic drop sedimented on the bot-
tom of the tube. This parameter is of critical importance to the following removal of extraction solvent which should be free of dispersive solvent or sample components. Cen-trifugation reached optimal conditions for the separation of phases at 10 000 rpm.
The complex character of urine sample resulted in the forming of precipitate which, during centrifugation, covered the sedimented organic drop and hindered the removal for the following analysis. Three types of salts, including potassium carbonate, sodium carbonate, and sodium chloride, were tested in order to prevent the development of this undesired state. Potassium carbonate and sodium carbonate had no influence on the presence of the precipitate. However, the addition of NaCl significantly reduced the amount of precipitation and, moreover, resulted in an unforeseen increase in extraction recovery. This led to further study of the NaCl effect on the extraction efficiency with series of additions ranging from NaCl concentration of 0.5 mol L-1 to 2.0 mol L-1 which is demonstrated in Figure 2. The highest extraction recovery was reached with the NaCl concentration of 1.5 mol L-1 in the sample.
Table 1. Conditions for optimized DLLME method
Studied parameters	Optimal conditions
Extraction solvent (ES)	Tetrachloromethane
Dispersive solvent (DS)	Methanol
Volume of ES and DS mixture	500 ||L (1 : 9, v/v)
Salt addition	1.5 mol L-1 NaCl
Extraction time	30 s
Centrifugation conditions	5 min, 10 000 rpm
Table 2. Evaluation of optimized DLLME method with model urine	
sample spiked with estradiol (0.1 mg mL	1)
Evaluation of DLLME	
Volume of sample	2.0 mL
Volume of organic phase	75 |L
	(n=3, RSD = 2.67%)
Preconcentration factor	25
	(n = 3, RSD = 6.81%)
Extraction recovery	93.75%
	(n = 3, RSD = 6.81%)
Figure 2. Effect of NaCl concentration on extraction efficiency. Experimental conditions: 2 mL model urine sample containing estradiol (0.1 mg mL-1) with NaCl addition; 500 |iL tetrachloromethane - methanol (1:9; v/v), centrifugation: 5 min, 10 000 rpm
In the final step, the extraction time (time from injection of extraction and dispersive solvents mixture into the sample until the start of centrifugation) was optimized. The initial extraction time in previous experiments was 60 s while the sample was gently agitated to enhance the extraction process. However, the study of the extraction time ranging from 0 to 120 s showed that the extraction efficiency rapidly increases during the first 30 s and does not noticeably change afterwards.
3. 3. Evaluation of Extraction Process
Optimal conditions and characteristics of DLLME procedure for extraction and preconcentration of estradiol in human urine are summarized in Table 1 and Table 2.
Figure 3 presents the preconcentration obtained with optimized microextraction technique as the differ-
ence in estradiol concentration detected in model urine sample before and after DLLME.
=> <
tl) in c o
Q.
O
a) Q
E2 I	
jafter^DULME / V	
before DLLME /\	
	
10 20 30 40 Migration distance (mm)
50
Figure 3. Chromatogram of model urine sample spiked at 0.1 mg mL-1 with estradiol (E2) before and after DLLME. Experimental conditions: 2 mL model urine sample with NaCl addition (1.5 mol L-1); 500 |iL tetrachloromethane - methanol (1:9; v/v) mixture, extraction time: 30 s; centrifugation: 5 min, 10 000 rpm
3. 4. Application to Real Samples
An optimized DLLME-TLC method was applied to the analysis of real urine prepared from five urine samples obtained from women in the second half of pregnancy. The real urine sample was spiked with estradiol at two concentration levels. Table 3 shows found estradiol concentrations in both spiked and non-spiked real urine samples analyzed by the DLLME-TLC method.
Table 3. Extraction recovery (ER) obtained from the determination of estradiol in real urine samples (n = 3)
Spiked	Found	ER	RSD
(mg mL-1)	(mg mL-1)	(%)	(%)
non-spiked	ND	-	-
0.20	0.18	89%	1.12%
0.10	0.09	91%	1.10%
ER: Extraction recovery; RSD: Relative standard deviation, ND: Not detected
4. Conclusion
Thin-layer chromatography with chemical and densitometric detection was used to optimize a DLLME procedure for the extraction and preconcentration of es-tradiol in human urine. TLC method enabled fast chromatographic separation of 19 samples within 20 min and, therefore, allowed fast optimization of extraction technique which provided preliminary results for further experiments carried out with HPLC. Optimum conditions for DLLME were reached after rapid injection of 500 ^L tetrachloromethane-methanol (1:9; v/v) mixture into 2 mL urine sample containing NaCl (1.5 mol L-1). The samples were after 30 s of gentle agitation centri-fuged at 10 000 rpm for 5 min. This study proved TLC to be an efficient method for the laborious optimization process.
5. Acknowledgement
This work was financially supported by the Scientific Grant Agency of the Ministry of Education of the Slovak Republic and of Slovak Academy of Sciences, VEGA 1/0253/16.
6. References
1.	G. Holder, H. L. J. Makin, H. L. Bradlow, in: H. L. J. Makin, D. B. Gower (Eds.): Steroid analysis, Springer, London, UK, 2008; pp. 605-742.
2.	K. Wend, P. Wend, S. A. Krum, Front Endocrinol. 2012, 3, 1-14. D0I:10.3389/fendo.2012.00019
3.	W. Rosner, S. E. Hankinson, P. M. Sluss, H. W. Vesper, M. E. Wierman, J. Clin. Endocrinol. Metab. 2013, 98, 1376-1387. D01:10.1210/jc.2012-3780
4.	A. C. Johnson, A. Belfroid, A. Di Corcia, Sci. Total Environment 2000, 256, 163-173. D0I:10.1016/S0048-9697(00)00481-2
5.	C. G. Campbell, S. E. Borglin, F. B. Green, A. Grayson, E. Wozei, W. T. Stringfellow, Chemosphere 2006, 65, 1265-1280. D0I:10.1016/j.chemosphere.2006.08.003
6.	H. Noppe, B. Le Bizec, K. Verheyden, H. F. De Brabander, Anal. Chim. Acta 2008, 611, 1-16. D0I:10.1016/j.aca.2008.01.066
7.	W. Yan, J. M. Lin, Chinese J. Anal. Chem. 2010, 38, 598-606. D0I:10.1016/S1872-2040(09)60038-4
8.	B. Chen, Y. Huang, M. He, B. Hu, J. Chromatogr. A 2013, 1305, 17-26. D0I:10.1016/j.chroma.2013.06.029
9.	Z. Liu, G. Lu, H. Yin, Z. Dang, H. Littier, Y. Liu, TrAC Trends Anal. Chem. 2015, 64, 149-164. D0I:10.1016/j.trac.2014.09.003
10.	M. Rezaee, Y. Assadi, M. R. M. Hosseini, E. Aghaee, F. Ahma-di, S. Berijani, J. Chromatogr. A 2006, 1116, 1-9. D0I:10.1016/j.chroma.2006.03.007
11.	A. Zgola-Grzeskowiak, T. Grzeskowiak, TrAC Trends Anal. Chem. 2011, 30, 1382-1399.
12.	M. Rezaee, Y. Yamini, M. Faraji, J. Chromatogr. A 2010, 1217, 2342-2357. D0I:10.1016/j.chroma.2009.11.088
13.	X. Du, X. Wang, Y. Li, F. Ye, Q. Dong, C. Huang, Chromato-graphia 2010, 71, 405-410. D0I:10.1365/s10337-009-1455-7
14.	M. R. Hadjmohammadi, S. S. Ghoreishi, Acta Chim. Slov.
2011,	58, 765-771.
15.	C. C. Chang, S. D. Huang, Anal. Chim. Acta 2010, 662, 39-43. D0I:10.1016/j.aca.2010.01.003
16.	D. L. D. Lima, C. P. Silva, M. Otero, V. I. Esteves, Talanta 2013, 115, 980-985. D0I:10.1016/j.talanta.2013.07.007
17.	C. Q. Wu, D. Y. Chen, Y. S. Feng, H. M. Deng, Anal. Lett.
2012,	45, 1995-2005.
D01:10.1080/00032719.2012.680086
18.	G. D'Orazio, M. Asensio-Ramos, J. Hernandez-Borges, M. A. Rodriguez-Delgado, S. Fanali, Electrophoresis 2015, 36, 615-625. D0I:10.1002/elps.201400452
19.	P. Wang, X. Qiu, Y. Yang, J. Liq. Chromatogr. Relat. Technol. 2015, 38, 640-646. D0I:10.1080/10826076.2014.913522
20.	K. Reiffova, E. Kupcova, J. Planar Chromatogr.-Mod. TLC
2013,	26, 375-378.
Povzetek
Tankoplastna kromatografija (TLC) je zaradi svoje slabše občutljivosti in ločljivosti pogosto spregledana analizna tehnika. Vendar celo v eri visokozmogljive tekočinske kromatografije (HPLC) tankoplastna kromatografija še vedno nudi mnoge prednosti, kot na primer: preprostost, hitrost, cenovno ugodnost; to pa postavlja TLC na prvo mesto pri izbiri metode za delovno intenziven proces optimizacije, ki zahteva analizo številnih vzorcev. V tej raziskavi smo uporabili tankoplastno kromatografijo s kemijsko in denzitometrično detekcijo za optimizacijo disperzivne mikroekstrakcije te-koče-tekoče (DLLME) za ekstrakcijo in predkoncentracijo estradiola iz človeškega urina. Kromatografski sistem je bil sestavljen iz silikagelskih plošč kot stacionarne faze in mešanice toluen-etanol (9:1; v/v) kot topila za razvijanje plošče. Plošče smo orosili z reagentom 10% fosfomolibdensko kislino in nadalje denzitometrično ovrednotili pri \ = 430 nm. V kontekstu optimizacije DLLME smo preučevali naslednje parametre: tip in volumen ekstrakcijskega in disperzijske-ga topila, centrifugiranje, dodatek soli ter čas ekstrakcije. Predlagano DLLME-TLC metodo smo uspešno uporabili za določitev estradiola v realnih vzorcih človeškega urina.
DOI: I0.i7344/acsi.20i7.4i39	Acta Chim. Slov. 2018, 65, 394-400	©commohs
Scientific paper
The Accuracy of Macro-Submicro-Symbolic Language of Future Chemistry Teachers
Dušica D. Rodic,1 Tamara N. Rončevic1 and Mirjana D. Segedinac1
1 Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, University of Novi Sad, Trg Dositeja Obradovica 3, Novi Sad, Republic of Serbia
* Corresponding author: E-mail: dusica.milenkovic@dh.uns.ac.rs
Received: 24-12-2017
Abstract
The present study is focused on the examination of language accuracy of future chemistry teachers in the macro-sub-micro-symbolic domain. Since the knowledge at the submicroscopic level is crucial for the understanding of chemical concepts and ideas, the aim of this study was to examine the accuracy of the language of future chemistry teachers while delivering chemical contents at this level. Within this objective, it was examined whether future chemistry teachers make a distinction between submicroscopic and macroscopic levels, as well as between submicroscopic and symbolic levels in their speech. Using qualitative methods of analysis, it was found that the majority of surveyed future chemistry teachers did not have the expected and necessary language accuracy within the examined domain. Most worrying were the attitudes of future chemistry teachers, who perceived the accurate expressions in the macro-submicro-symbolic domain as a redundant complication rather than a necessity.
Keywords: Future chemistry teachers; language accuracy; micro-submicro-symbolic language
1. Introduction
The concept of three levels of chemical representation, or the so-called "triplet relationship"1 has been attracting the attention of a large number of researchers in the field of chemical education for many years. Although this notion was first mentioned in 1982 it still seems to be very influential and widespread among researchers.2 From the basic idea that chemical contents can be taught on three levels, commonly called macroscopic (sensory accessible properties of substance), submicroscopic (particulate level) and symbolic (symbols, formulae, equations), multiple lines of research have been established over time. Nonetheless, most attention has been paid to the problems and misconceptions that occur as a result of misinterpretations regarding the submicroscopic level.3-5 Along with the fact that this level is the most abstract one and therefore the most difficult to master, some researchers have suggested that there is an additional issue that further fosters these difficulties, and that is the imprecise use of lan-guage.6,7 Namely, teachers, textbook writers or scientists are prone to use language in a way that does not maintain the necessary distinction between macroscopic and sub-microscopic levels. Thus, it is quite common to hear teachers saying e.g. that ammonia consists of nitrogen and hy-
drogen, that stearic acid has a long chain of C-atoms or that oxygen has a double bond, when in fact they referring to particles of these substances. However, students commonly lack the skill to shift between levels, which further complicates the already heavy and abstract submicrosco-pic concepts. The same can be said of the writers of school textbooks, who have a fairly inattentive approach to this issue. For example, in textbooks approved by the Ministry of Education of the Republic of Serbia for primary school chemistry, it is possible to find statements such as the following:
Each period, except the first, ends with the element that has 8 electrons in the highest energy level;8 electronegativity is the ability of a chemical element to attract the electron pair;9 carboxylic acids which have a higher number of carbon atoms are referred to as a higher fatty acid;10 benzene contains six carbon and six hydrogen atoms.11
The above examples clearly show the use of blurred language concerning macroscopic and submicroscopic. Furthermore, researchers have also pointed out the interference between macroscopic and submicroscopic levels in some presentations of the Periodic table of elements,12 as some of the data provided, refer to submicroscopic particles (e.g. electron configuration, atomic and mass number), while some of them refer to elementary substances
(e.g. density, state of matter) which leads to confusion among students.
Such inconsistencies, which are likely the result of teachers' or textbook writers' carelessness, may have some severe consequences on students' meaningful understanding. Namely, such approach could be one of the possible causes of the formation of a well-known and scrutinized misconception of transmission of substance macroscopic properties to its submicroscopic particles. Thus, it is not surprising that students believe that molecules of solids are hard unlike molecules of liquids and gasses,13 that molecules of water can be hot and cold, that molecules of naphthalene have an odour14 or that sulphur atoms are coloured yellow15 given that the macro-submicro terms are used quite often interchangeably during classes.
Besides this flimsy language between macro and submicro domains, inaccurate language can also appear between submicro and symbolic domains. Namely, the symbolic models may appear to be the reality for many students. Chittleborough and Treagust stated that teachers insufficiently emphasize the representational nature of the formulas, saying, for example that CH4 is methane, instead that it represents the composition of a methane mole-cule.16 Kleinman, Griffin, and Kerner reported about a student who believed that bromobenzene has no plane of symmetry since B # r, which is an obvious example of the fact that some students firmly adhere representations, instead of submicroscopic reality.17 Furthermore, favouring symbolic visualizations over underlying submicroscopic concepts is commonly present when dealing with chemical equations.18 It means that student may become very adept at manipulating a chemical equation, without its proper reasoning.
There is an interesting view that the language itself could act as a greater barrier for learning than contents of natural sciences.19 Namely, the peculiarity of chemistry by which it differs from other natural sciences is the developed system of scientific communication - chemical language. It often happens that words of chemical language are used in everyday life, but with different meaning, which can create difficulties for students. Confusion arises when teachers in explaining some chemical concepts use words that are also used in everyday life (e.g. pure, reduction, etc.), assuming that students will understand them in a chemical way.20 Sometimes in chemistry, even one word can have several meanings (e.g. neutral oxide, pH-neutral, neutral atom), which additionally frustrates students. Studies show that accurate and consistent use of chemical language, especially in describing the substance at the submicroscopic level enhances the students' ability to interpret concepts.15
Accordingly, it is important that teachers are aware of the significance of accurate and precise expression, which necessarily includes the precise expression in the macro-submicro-symbolic domain. Otherwise, the imprecise use of language, though often unintended, can create barriers to learning.
2. Methodology 2. 1. Aim of Research
Assuming that imprecise and inconsistent use of chemical language in the macro-submicro-symbolic domain by teachers can represent the basis for the formation of biases and misconceptions, the main objective of this study was to examine the precision of future chemistry teachers' language within macro-submicro-symbolic domain. Within this goal, two research tasks have been set:
T1: To determine whether future chemistry teachers make a clear distinction between macroscopic and submi-croscopic levels in their explanations.
T2: To determine whether future chemistry teachers make a clear distinction between submicroscopic reality and symbolic representations in their explanations.
2. 2. Context of the Study
In the Republic of Serbia, there are two basic university programs for education of chemistry teachers - bottom-up and concurrent model. At the faculties with a bottom-up model, students opt for teaching programme at the beginning of their studies. At the faculties with a concurrent model, such as the Faculty of Sciences (University of Novi Sad) where the research was conducted, students study compulsory chemistry courses, and to be profiled in the direction of teaching chemistry, students have to acquire a regulated number of credits in educational courses and compulsory school practice, during the studies through elective courses. Within school practice courses, students are required to undergo two main parts: (1) observations of classes performed by licensed mentor-practitioner, without participation in the teaching and (2) teaching under supervision of licensed mentor-practitioner.
At the Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, there are two courses of school practice: (1) School practice I (8th semester; primary school teaching: 7th and 8th grade) and (2) School practice II (10th semester; secondary school teaching: 9-12th grade). Within the first stage of the School practice (both I and II), students have to observe 25 classes (18.75 hours) performed by experienced mentor-practitioner. In the next stage, students are required to independently hold at least 5 classes under supervision of mentor-practitioner. Additionally, students are required to attend weekly coaching lessons.
2. 3. Participants and Setting
Students who enrolled in the School practice I course at the Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, Novi Sad in 2014/15 academic year were participants of this study (N = 16). All of them were female students majoring in chemistry teaching in their fourth and final year of their Bachelor
degree. Most of the subjects had completed obligatory subject matter courses before selecting the School practice I course. In addition, the majority of them have taken following educational courses as well: Pedagogy, Psychology, Introduction to Teaching Profession, Methods of Teaching Chemistry I and II and Modern Educational Technology in Teaching Chemistry.
The research was conducted in three public, urban schools located in the municipality of Novi Sad, Province of Vojvodina wherein students observed and held classes. Mentors-practitioners were three licensed chemistry teachers (one from each school) who have at least 5 years of work experience in primary school teaching and who have been achieving excellent educational results in their teaching practice.
Prior to conducting the survey, all participants were informed that the lessons will be voice recorded and that the results will be used for research purposes. After the research procedure was explained, all the students gave their consent to voluntarily participate in the research.
2. 4. Study Design
To obtain data, qualitative research methodology was used. Namely, two authors of this paper (university staff) have been present during all the classes that were held independently by students (a total of 80 classes, 60 hours) and marked the errors encountered. The role of university staff was both advisory and assessment similar to other research studies.21 In addition, all classes were voice recorded. Since there is no uniform protocol for monitoring school practice, which is in accordance with competency standards for the profession of teachers and their professional development in the Republic of Serbia, in this study we used an internal protocol developed by the authors of this paper. It involved consideration of the fol-
lowing points in line with the mentioned standards: content knowledge, pedagogical knowledge, connection of new information to prior knowledge, correlations to contents of other subjects, use of everyday life examples, classroom management, and literacy. In addition, special attention was paid to monitoring the precision of language in the macroscopic, submicroscopic and symbolic domain, which was the main topic of this study. In addition to observations, after each class, in the five-minute break between classes, the authors conducted brief interviews with the future chemistry teachers to determine their awareness of inaccurate use of language in the macro-submicro-symbolic domain, during teaching.
All teaching topics covered in this study are shown in Table 1.
3. Results and Discussion 3. 1. Macro-Submicro Inaccuracies
Within data interpretation, the field notes as well as voice recordings were carefully analysed and categorised according to two defined research questions.
Since the first task was related to the determination of language accuracy in macro-submicro domain, the first part of this section will be devoted to the analysis of the most frequent linguistic imprecisions that were noticed during the monitoring future teachers' classes. The list of imprecise and unclear statements has been extracted and summarized in Table 2. It is important to note that in addition to the statements specified in Table 2, similar statements have also been recorded, however, to avoid redundant repetition they are not included in the Table 2.
Statements of the type I (Imprecise expression of the particle type; S1-S4 in Table 2) were recorded during the various teaching topics and were constantly repeated by
Table 1. Topics Covered During Data Collection
Grade	Teaching unit	Type of class
VII	Solubility of substances and percentage composition of the solution	PNMT
VII	Solubility of substances and percentage composition of the solution	R
VII	Water	PNMT
VII	Chemical reactions. Analysis and synthesis	PNMT
VII	Chemical equations	R
VII	The law of conservation of mass	PNMT
VIII	Oxygen containing organic compounds	R
VIII	Physical and chemical properties of carboxylic acids	PNMT
VIII	Physical and chemical properties of carboxylic acids	R
VIII	Esters	PNMT
VIII	Carbohydrates, monosaccharides	PNMT
VIII	Disaccharides and polysaccharides	PNMT
VIII	Fats and oils	PNMT
VIII	Amino acids and proteins	PNMT
VIII	Vitamins	PNMT
*PNMT (Processing new teaching material); R (Revising)
Table 2. List of Imprecise Statements in relation to Macro-Submicro Level
Type	No.	Statement/Question
I	S1	Molecules of sodium chloride
I	S2	On the left side, we have three molecules of sodium hydroxide
I	S3	The molecules of soap can remove the stain
I	S4	On the third carbon atom, OH molecule is located on the left side
II	S5	Which atoms have that sugar?
II	S6	From one molecule of sucrose, glucose and fructose can be obtained
II	S7	Water is composed of two hydrogen atoms and one atom of oxygen
II	S8	The oligosaccharides contain 2-10 monosaccharides
II	S9	When equalizing this equation, we should first counter the number of oxygen
II	S10	How many hydrogens are there on the left side?
III	S11	Compounds with a polar covalent bond can be dissolved in water
III	S12	How are oxygen and hydrogen connected in water?
IV	S13	Tap water is a pure water
the majority of future chemistry teachers. Listening to the voice recordings, it was found that future chemistry teachers often used the expression "molecule" to represent main particles which build ionic compounds. Besides sentence such as: "there are molecules of sodium chloride in this solution", analogous sentences and questions were also recorded, such as: "on the left side, we have three molecules of sodium hydroxide", "molecules of soap can remove the stain", "what do we call a molecule of copper(II) sulphate", "if we want to obtain a molecule of iron(II) sulphide, we need 7 g of iron, and 4 g of sulphur" etc. Furthermore, while writing formula of glucose molecule, one future chemistry teacher said: "on the third carbon atom, OH molecule is located on the left side".
Reviewing the literature, we found information on the widespread school-made misconception among students, that the main particles that build the substance sodium chloride are neutral molecules,22-25 then CaCl2 molecules are present in water which contains calcium chlo-ride,26 or students write balanced equations of reactions in which the ionic compounds dissolve as neutral atoms or molecules.27 In the case where students have acquired this misconception, the inattentive speech of a teacher can additionally enhance it.
Statements of the type II (Neglecting particle terms and prevalent use of macroscopic terms; S5-S10 in Table 2) were recorded among the majority of future chemistry teachers. Based on the above examples it can be noted that future chemistry teachers' expressions in terms of particles are quite imprecise, and very often replaced by analogous macroscopic terms. However, such statements may confuse students who are at the very beginning of their chemical education and who have yet to establish a flexible system of knowledge with firmly incorporated fundamental chemical concepts. Due to the aforementioned statements, students may conclude that the main building blocks of sugars are free atoms ("which atoms have that sugar"), that water is a mixture composed of hydrogen and oxygen
("water is composed of two hydrogen atoms and one atom of oxygen") or may neglect the fact that small amounts of some substance contain an enormous number of particles ("from one molecule of sucrose glucose and fructose can be obtained"; "fructose consist of six carbon atoms, ketone carbonyl group and five hydroxyl groups"; "carboxylic acids which have 4-7 carbon atoms are malodorous"). The statements such as: "when equalizing this equation, we should first count the number of oxygen" and "how many hydrogens are there on the left side?", which are related to chemical equations, should be particularly stated. Namely, it is observed that future chemistry teachers rarely use par-ticulate terms while balancing equations, replacing them with terms such as "one hydrogen on the left side, two oxygens on the right side" and the like.
Within type III (Chemical bond as a feature of elementary substance), two statements were noted (S11 and S12 in Table 2). Namely, a future chemistry teacher asked: "how are oxygen and hydrogen connected in water", which can make students think that water is made of chemically bonded molecules of hydrogen and molecules of oxygen rather than water molecules. Another such case arises from the statement: "compounds with polar covalent bonds can be dissolved in water". Likewise, students can conclude that a polar covalent bond occurs between the particles of a compound, and not within the particle.
One statement of the type IV (Mixing chemical terms with everyday life terms; S13 in Table 2: Tap water is a pure water) has been observed in the case of four future teachers during the teaching topic "Water". Namely, comparing the prepared samples of tap water and water from a local canal, a future teacher used the term "pure water" instead of clear water without considering the fact that chemically pure water has a different meaning. As already mentioned, one of the problems, frequently encountered during teaching of chemistry, is that some words used in everyday life can sometimes be used in chemistry but with a different meaning. In the presented case, the future
teacher was thinking about physically pure water i.e. water that is not contaminated by other substances which may affect its physical appearance. However, the expression pure water in chemical and theoretical sense would mean that the tap water consists of water molecules only, which cannot be concluded merely on the basis of its physical appearance. This led to confusion, as in the final part of the class, during the revision, some students stated tap water as an example of a pure substance.
Taber stated that chemistry teachers use the term pure substance as a technical term thinking of the composition of the substance at the submicroscopic level, while at the same time students are more focused on the external appearance of a substance, which leads to common problems in teaching practice.28 In this case, it can be noted that the future teacher was also thinking about the external appearance of substance, without considering the possible biases that go along with that term.
After interviews with the future chemistry teachers, it was noticed that they do not pay attention to the precise language at the submicroscopic level. Moreover, they do not believe that it could have an impact on creating confusion among students. Some future chemistry teachers even after the interview and the reflection on differences between the two modes of expressions did not consider precise language as required, but rather as complicated. Similarly, Gilbert, and Treagust stated that some authors believe that the introduction of additional submicroscopic terms, with a view to precise language, unnecessarily complicates sentences and does not contribute to the removal of ambiguities among students.1 Worryingly, some future chemistry teachers in this study could not even comprehend the difference between the two modes of expressions.
3. 2. Submicro-Symbolic Inaccuracies
In this section, we present a table with noted inaccuracies within the submicro-symbolic domain. Recorded
Table 3. List of Imprecise Statements in relation to Submicro-Symbolic Level
Type	No.	Statement/Graphical representation
I	S1
II	S2 II	S3 II	S4
II	S5
II	S6
III	G1 III	G2
inaccurate statements (S1-S6) as well as graphical representations (G1-G2) are summarised and given in Table 3.
The statement of the type I (Reasoning at symbolic level; S1 in Table 3) was recorded during the teaching topic Esters. Namely, one future chemistry teacher explained the esterification reaction in the following manner: "In the esterification reaction, ester and water are formed. We know that the water is made up of two hydrogen atoms and one oxygen atom. Therefore, we have OH (showing on the condensed structural formula of ethanol), and H (showing on the condensed structural formula of ethanoic acid) and we get water, and all that remains combines into a new compound. So, on the left side we will have CH3CH2, and on the right side CH3COO and one free bond which we can use to connect the left and right side of the compound". In addition to the inaccurate expression at submicroscopic level and content knowledge flaws (probably substituting esterification with neutralisation reaction), the described situation clearly illustrates an example of reasoning at the symbolic level. Namely, the future teacher has poorly developed concepts of chemical bond and chemical reaction. Reviewing the literature, we came across various misconceptions regarding chemical bond and bonding. This area of research has proved to be one of the most studied one in the last several decades.29-33 Researchers, acting in this area, identified some interesting misconceptions, however, this study revealed another interesting misconception. Namely, the future chemistry teacher conceived chemical bond as a tangible strong connection (stick) that can be transferred from one place to another and used to connect the atoms or atomic groups, similar to molecular models. On the other hand, this future chemistry teacher understood the chemical equation as a simple combination of atoms without considering the mechanism of chemical reactions. This is not surprising, given that many researchers in literature reported the students' ability to write and equate chemical equations without proper submicroscopic reasoning.18
In the esterification reaction, ester and water are formed. We know that the water is made up of two hydrogen atoms and one oxygen atom. Therefore, we have OH (showing on the condensed structural formula of ethanol), and H (showing on the condensed structural formula of ethanoic acid) and we get water, and all that remains combines in a new compound We will write a reaction of photosynthesis Is there anyone who knows how to balance this reaction?
On the left side of the reaction there are ethanol and acetic acid, while on the right side there are ester and water
Substance that undergoes chemical change is written on the left side of the reaction We will write glucose
CII2-CII—CI12 I I I OH OH OH
C.jH^O,, * H,0	Q.HnO/, + QHi-A,
Within type II (Mixing symbolic terms and submi-croscopic reality) five statements were recorded (S2-S6 in Table 3). Namely, by observing the lessons of future chemistry teachers, we were able to notice that future teachers commonly do not make a distinction between reaction and the chemical equation as its representation in their speech; between a compound and its representation - formula, or between an atom of an element and its representation - symbol. Therefore, we were able to record some very imprecise constructions such as: reaction of photosynthesis, left side of the reaction, we will write glucose, and others listed in Table 3. However, since chemistry is a subject which emphasizes precision and accuracy, the precise use of language also implies.34
The third type of observed inaccuracies was related to imprecise writing of chemical formulas and equations. In the Table 3 we gave two examples, one for a formula and one for an equation, as presented by future chemistry teachers. According to the structure of glycerol presented in Table 3, students could incorrectly conclude that an oxygen atom is directly bonded to a hydrogen atom instead of a carbon atom. After a conversation with one future chemistry teacher, it was found that she does not realize the importance of proper writing of formulas, as she assumed that the students would understand them in the proper way. The second noticed imprecision refers to the writing of arrows in chemical equations. Although double-headed arrow implies the existence of a 'resonance hybrid', in this study, future chemistry teachers regularly used it to present an equilibrium condition. This is a well-known misinterpretation, explained by Bucat and Moceri-
no.6
Easy and smooth movement through the levels of representation of knowledge is very important for the development of chemical thinking and the development of proper mental models among students. To make these possible, students should be given the opportunity to meet and explore chemistry contents at all three levels, without neglecting certain levels or favouring others. In-service teachers, even university teachers do not pay sufficient attention to this, because as experts, they know the difference in use between macroscopic level as real and perceptually available and submicroscopic as real, but unavailable to direct sensory perception, or the difference in use between submicroscopic as real and symbolic as representational and assume that students will perceive them in the same way. However, for students, especially for those who have just started to study chemistry, it is difficult to perceive these differences. Therefore, it is important that teachers do not create additional confusion with inconsistent and inaccurate language within the triplet system. In line with that, it is essential that future chemistry teachers, in particular, become aware of the importance of accurate use of language, as being ones who will be in direct contact with novices, helping them to develop proper chemical concepts.
4. Conclusions
This study highlights areas of concern regarding submicro-macro and submicro-symbolic language. The main outcomes of this study are related to findings that future chemistry teachers tend to use imprecise language expressions in terms of particle types, prevalently using the term molecule regardless of the fact whether the compound is a covalent or ionic. It is also found that a vast majority of the covered sample avoided using particle terms, using macroscopic terms instead. Additionally, some concepts that belong to submicroscopic level were transferred to a bulk substance. Finally, concerning submicroscopic-symbolic relations, in one particular case, it was shown that future teachers do not pay the necessary attention to the terms that have different meanings in chemistry and in everyday life. Similarly, several issues in relation to submicroscopic-symbolic transitions were identified. It has been found that there were future chemistry teachers who reasoned at the symbolic level, and who did not have properly developed submicrosco-pic mental models. Furthermore, certain imprecisions regarding presentations of structural formulas have been noted as well. According to this, we may conclude that future chemistry teachers, which were involved in this study, did not possess adequate language accuracy within a triplet domain.
In light of this, we would like to emphasize the need to introduce students, future chemistry teachers, to the idea of the triplet model of content representation during their initial education. In accordance with that, students majoring in chemistry teaching should become aware of the importance of precise expression in this domain.
Regarding limitations of this study, it should be mentioned that studies with larger samples are needed before making any generalizations. Therefore, the findings of this study should be considered preliminary and additional research should be based on the cooperation with other university centres to be able to reach conclusions that are more general.
5. Acknowledgments
This paper was written with the support of a grant from the Ministry of Education, Science and Technological Development of the Republic of Serbia #179010. The authors would like to thank mentors-practitioners Gordana Gajic, Dragica Krivokuca and Sanja Rodic Roncevic, as well as future teachers of chemistry who participated in the study.
6. References
1. J. K. Gilbert, D. F. Treagust, in: J. K. Gilbert, D. F. Treagust (Eds.): Multiple Representations in Chemical Education, Springer, Berlin, Germany, 2009, pp. 1-8.
DOI: 10.1007/978-1-4020-8872-8
2.	A. H. Johnstone, Sch. Sci. Rev. 1982, 64, 377-379.
3.	I. Devetak, M. Urbančic, K. Wissiak Grm, D. Krnel, S. Glažar, Acta Chim. Slov. 2004, 51, 799-814.
4.	I. Devetak, J. Vogrinc, S. A. Glažar, Res. Sci. Educ. 2009, 39, 157-179. D0I:10.1007/s11165-007-9077-2
5.	M. I. Stojanovska, B. T. Šoptrajanov, V. M. Petruševski, Creat. Educ. 2012, 3, 619-631. D0I:10.4236/ce.2012.35091
6.	B. Bucat, M. Mocerino, in: J. K. Gilbert, D. F. Treagust (Eds.): Multiple Representations in Chemical Education, Springer, Berlin, Germany, 2009, pp. 11-29. D0I:10.1007/978-1-4020-8872-8_2
7.	B. Van Berkel, A. Pilot, A. M. W. Bulte, in: J. K. Gilbert, D. F. Treagust (Eds.): Multiple Representations in Chemical Education, Springer, Berlin, Germany, 2009, pp. 31-54. D0I:10.1007/978-1-4020-8872-8_3
8.	L. Mandic, J. Korolija, D. Danilovic, Hemija za 7. razred osnovne škole, Zavod za udžbenike i nastavna sredstva, Beograd, 2009, p. 61.
9.	J. Adamov, N. Makivic, S. Olic, Hemija za 7. razred osnovne škole, Gerundijum, Beograd, 2012, p. 72.
10.	L. Mandic, J. Korolija, D. Danilovic, Hemija za 8. razred osnovne škole, Zavod za udžbenike i nastavna sredstva, Beograd, 2010, p. 129.
11.	T. Nedeljkovic, D. Andelkovic, Hemija 8, Novi Logos, Beograd, 2010, p. 124.
12.	M. Stojanovska, V. M. Petruševski, B. Šoptrajanov, Nat. Math. Biotech. Sci. 2014, 35, 37-46.
13.	C. Horton, Student Alternative Conceptions in Chemistry, modeling.asu.edu/modeling/Chem-AltConceptions3-09. doc, (assessed June 24, 2014).
14.	E. Adadan, Promoting High School Students' Conceptual Understandings ofthe Particulate Nature of Matter through Multiple Representations, Ph.D. Thesis, Ohio State University, 2006.
15.	G. D. Chittleborough, The Role of Teaching Models and Chemical Representations in Developing Students' Mental Models of Chemical Phenomena, Ph.D. Thesis, Curtin University, 2004.
16.	G. D. Chittleborough, D. F. Treagust, Chem. Educ. Res. Pract. 2007, 8, 274-292. D0I:10.1039/B6RP90035F
17.	R. W. Kleinman, H. C. Griffin, N. K. Kerner, J. Chem. Educ. 1987, 64, 766-770. D01:10.1021/ed064p766
18.	V. Talanquer, Int. J. Sci. Educ. 2011, 33, 179-195. DOI: 10.1080/09500690903386435
19.	R. Vladušic, R. Bucat, M. Ožic, Chem. Educ. Res. Pract. 2016, 17, 474-488. D0I:10.1039/C6RP00037A
20.	H. K. Boo, J. Res. Sci. Teach. 1998, 35, 3-12. D0I:10.1002/(SICI)1098-2736(199805)35:5<569::AID-TEA6>3.0.C0;2-N
21.	K. S. Wissiak Grm, V. Ferk Savec, Acta. Chim. Slov. 2014, 61, 729-739.
22.	K. S. Taber, Educ. Chem. 1994, 31, 100-103.
23.	R. M. Kelly, L. L. Jones, J. Sci. Educ. Technol. 2007, 16, 413429. D0I:10.1007/s10956-007-9065-3
24.	L. T. Tien, M. A.Teichert, D. Rickey, J. Chem. Educ. 2007, 84, 175-181. D0I:10.1021/ed084p175
25.	J. Othman, D. F. Treagust, A. L. Chandrasegaran, Int. J. Sci. Educ. 2008, 30, 1531-1550.
DOI: 10.1080/09500690701459897
26.	H. D. Barke, Bull. Chem. Technol. Bosnia Herzeg. 2013, 40, 9-16.
27.	B. M. Naah, M. J. Sanger, Chem. Educ. Res. Pract. 2012, 13, 186-194. D0I:10.1039/C2RP00015F
28.	K. S. Taber, Chemical axioms, http://www.rsc.org/learn-che-mistry/resource/res00001138/chemical-axioms?cmpid=C-MP00002169, (assessed December 26, 2016).
29.	R. Peterson, D. F. Treagust, J. Chem. Educ. 1989, 66, 459-460. D0I:10.1021/ed066p459
30.	K. S. Taber, Educ. Chem. 1994, 31, 100-103.
31.	K. C. D. Tan, D. F. Treagust, Sch. Sci. Rev. 1999, 81, 75-83.
32.	R. K. Coll, D. F. Treagust, J. Res. Sci. Teach. 2003, 40, 464-486. D0I:10.1002/tea.10085
33.	R. Vladušic, R. B. Bucat, M. Ožic, Chem. Educ. Res. Pract. 2016, 17, 685-699. D0I:10.1039/C6RP00040A
34.	H. K. Boo, in: N. K. Goh, L. S. Chia, H. K. Boo, S. N. Tan, M. F. R. Tsoi (Eds.): Chemistry Teachers' Network, Singapore National Institute of Chemistry, Singapore, Singapore, 2000, pp. 60-63.
Povzetek
Raziskava je osredotočena na pregled jezikovne natančnosti izražanja bodočih učiteljev kemije na področju makro-submikro-simbolnih domen. Ker je znanje na submikroskopskem nivoju ključnega pomena za razumevanje kemijskih konceptov in idej, je namen te raziskave preverjanje natančnosti jezikovnega izražanja bodočih učiteljev kemije na tem nivoju. V okviru tega cilja smo proučevali ali bodoči učitelji kemije med poučevanje pri jezikovnem izražanju razlikujejo med submikroskopskim in makroskopskim nivojem in tudi med submikroskopskim in simbolnim nivojem. Z uporabo kvalitativnih metod analize smo ugotovili, da večina bodočih učiteljev kemije, ki so sodelovali v raziskavi, nima zadosti natančnega načina jezikovnega izražanja glede proučevanih nivojev. Zaskrbljujoče je, ker pogosto bodoči učitelji kemije gledajo na natančnost jezikovnega izražanja na področju makro-submikro-simbolnih domen kot na nepotrebno komplikacijo in ne kot nujnost pri jasnem podajanju snovi.
Scientific paper
Synthesis of Cyclic and Acyclic Pyrimidine Nucleosides Analogues with Anticipated Antiviral Activity
Mohamed F. El-Shehry,1* Emad M. El Telbani23 and Mohamed I. Hegab4,5
1 Pesticides Chemistry Department, National Research Centre, Dokki, 12622 Giza, Egypt 2 Green Chemistry Department, National Research Centre, Dokki, 12622 Giza, Egypt
3	Chemistry Department, Faculty of Science, Jazan University, Jazan, Saudi Arabia
4	Photochemistry Department, National Research Centre, Dokki, 12622 Giza, Egypt
5 Chemistry Department, Faculty of Science & Arts, Qurayat, Al-Jouf University, Saudi Arabia * Corresponding author: E-mail: moh_elshehry2000@yahoo.com Received: 25-12-2017
Abstract
A convenient method for preparation of cyclic and acyclic nucleosides was achieved by alkylation of 6-(2,4-dichlo-rophenoxymethyl)pyrimidine-2,4-dione (1) with a variety of acyclic and cyclic activated sugar analogues, namely (2-acetoxyethoxy)methyl acetate (3), 2-(acetoxymethoxy)propane-1,3-diyl dibenzoate (4), benzyloxymethyl acetate (5), 2-acetoxy-5-(benzoyloxymethyl)tetrahydrofuran-3,4-diyl dibenzoate (12), 5-chloro-2-((4-chlorobenzoyloxy)methyl) tetrahydrofuran-3-yl 4-chlorobenzoate (13) and 2-(acetoxymethyl)-6-bromotetrahydro-2ff-pyran-3,4,5-triyl triacetate (14), respectively. Deprotection of the synthesized nucleosides was achieved by using methanolic ammonia. The structures of the newly synthesized nucleoside analogues were fully characterized by analytical methods (mass spectrometry, 'H NMR, 13C NMR, and elemental analysis).
Keywords: Pyrimidines, nucleosides, vorbrùggen and niedballa's procedure, antiviral activity
1. Introduction
A number of base-modified nucleosides have been playing a vital and important role as therapeutic agents in the treatment of patients infected with different viruses including human immunodeficiency virus (HIV), herpes simplex virus (HSV), hepatitis B virus (HBV), hepatitis C virus (HCV) and cytomegalovirus (CMV) infections.1 According to U.S. Food and Drug Administration (FDA), many cyclic and acyclic nucleoside analogues, such as 3'-azido-3'-deoxythymidine (AZT), 2,3'-dideoxyinosidine (DDI), 2',3'-didehydro-3'-deoxythymidine (D4T), 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT), acyclovir, and penciclovir (Fig. 1) are effective in treatment of various viruses.2
Moreover, it is well known that functionalized nitrogen heterocycles play an interesting role in drug chemistry and therefore they have been intensively studied and used as scaffolds for searching and developing new drugs.3 Py-
rimidine-incorporating sugar residues represent an interesting class of nucleosides which have a promising antiviral chemotherapy potential, especially that class in which the cyclic sugar residue is replaced with open-chain "acyclic" sugar moieties. Moreover, heterocycles possessing pyrimidine nucleus are of great interest because they constitute an important class of natural and non-natural products which possess diverse biological activities and medicinal applications.4 Additionally, pyrimidine skeleton is also present in many natural products, such as vitamin B1 (thiamine) and a lot of synthetic compounds which possess a wide spectrum of biological activities including polio herpes viruses,5 diuretic, anti-HIV, cardiovascular,6 antibacterial,7-9 antifungal,10,11 antihypertensive,12 antipyretic,13 antiviral,14-15 antidiabetic,16 antioxidant,17-18 anticancer activities,19-20 antileishmanial,21 anti-inflammatory,22 an-algesic,23 antiallergic,24 anticonvulsant,25 antihistaminic,26 herbicidal,27 antidepressant,28 and also act as calcium
O	O
Acyclovir
Figure 1: Some examples of cyclic and acyclic antiviral agents
channel blockers.29 On the other side, fusion of pyrimi-dine moiety with different heterocycle scaffolds gives rise to a new class of hybrid heterocycles possessing improved biological activity. Fused pyrimidines like purines, quinazolines, pteridines, pyridopyrimidines, pyrazolopy-rimidines, pyrimidoazepines, triazolopyrimidines, furo-pyrimidines and pyrrolopyrimidines were studied in the past decade and were found to possess remarkable pharmacological properties, such as antibacterial activity, anti-fungal activity, anti-cancer agents, antihyperlipidemic activity, blood related disorders, analgesic and anti-inflammatory activities, anti-HIV agents, CNS related agents, and immunosuppressants.30
For the design and search of new drugs, the development of hybrid molecules through the binding of various pharmacophores in one frame could lead to molecules with interesting pharmaceutical properties. Based on above information and in continuations of our interest in the synthesis of bioactive molecules derived from the py-rimidine moeity,15,31-33 our investigation aimed to synthesize new cyclic and acyclic nucleosides using available cyclic and acyclic moieties, which will be coupled with pyrimidine base, hoping to increase their antiviral activities. The effective method of protection and deprotection will also be examined.
2. Experimental 2. 1. Chemistry
All the reagents were purchased from Sigma-Aldrich and the solvents from Merck and were used without further purification. Melting points were measured on an Apotec apparatus and are uncorrected. NMR spectra were recorded on Bruker AMX400 and Bruker Current AV400 Data spectrometers (400 MHz for :H, 100.6 MHz for 13C). ESI mass spectra were determined with a Finnigan Thermo Quest MAT 95XL spectrometer and FAB high-resolu-
Poiciciovir
tion (HR) mass spectra with a VG Analytical 70-250S spectrometer using an MCA method and poly( ethylene glycol) as the support. The reactions were monitored by thin layer chromatography (TLC) using silica gel (60 F254) coated aluminium plates (Merck) which were visualized by UV irradiation (254 nm) and iodine vapours. Column chromatography was performed by using silica gel (60120 mesh). All reactions were carried out under dry nitrogen. 6- (2,4- Dichlorophenoxymethyl)pyrimidine- 2,4- di-one (1) was prepared according to our previous report.15
2. 1. 1. Preparation of Nucleosides 6, 8, 10, 11, 16, 15, 17 and 19
A suspension of uracil derivative 1 (10 mmol) and ammonium sulphate (10 g) in HMDS (50 mL) was stirred and refluxed for 4 h. HMDS in excess was evaporated under reduced pressure to give bis(trimethylsilyl) compound 2. A solution of acylated acyclic reagents (10 mmol): (2-ace-toxyethoxy)methyl acetate (3), 2-(acetoxymethoxy)pro-pane-1,3-diyl dibenzoate (4), benzyloxymethyl acetate (5), 2-acetoxy-5-(benzoyloxymethyl)tetrahydrofuran-3,4-diyl dibenzoate (12), 5-chloro-2-((4-chlorobenzoyloxy)methyl) tetrahydrofuran-3-yl 4-chlorobenzoate (13) and 2-(ace-toxymethyl)-6-bromotetrahydro-2H-pyran-3,4,5-triyl triacetate (14), in dry acetonitrile (30 mL) and tin(IV) chloride (2 mL) was individually added to the residue of 2 and stirred at -30 °C for 24 h. After addition of pyridine (4 mL) the mixture was filtered to remove inorganic materials. The filtrate was diluted with chloroform (40 mL). The organic layer was washed with a saturated solution of sodium hydrogen carbonate (50 mL), followed by a 1N solution of hydrochloric acid (50 mL), then brine (50 mL) and water successively, dried over anhydrous sodium sulfate and concentrated to dryness under reduced pressure. The resulting crude nucleosides 6, 8, 10, 11, 15, 17 and 19 were separated by silica gel column chromatography (graduated mixture of ethyl acetate and pethroleum ether, 9:1) as white solid.
2-((6-((2,4-Dichlorophenoxy)methyl)-2,4-dioxo-3,4-di-hydropyrimidin-1(2H)-yl)methoxy)ethyl Acetate (6)
Yield 2.8 g (70%), m.p. 166-168 °C. NMR (DMSO-d6, 400 MHz) 5 2.11 (s, 3H, COCH3), 3.83, 4.42 (t, 4H, OCH-2CH2O), 5.45 (s, 2H, CH2 phenoxy), 5.62 (s, 2H, OCH2N), 6.10 (s, 1H, CH uracil), 7.48-7.90 (m, 3H, Ar-H), 12.50 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 20.9, 63.2, 65.1, 66.8, 72.1, 100.7, 115.9, 116.0, 122.9, 126.1, 128.6, 129.9, 151.5, 152.1, 162.7, 170.6. MS m/z = 402 [M-1]. Anal. Calcd for C16H16Cl2N2O6: C, 47.66; H, 4.00; N, 6.95. Found: C, 47.81; H, 4.09; N, 6.79.
2-((6-((2,4-Dichlorophenoxy)methyl)-2,4-dioxo-3,4-di-hydropyrimidin-1(2H)-yl)methoxy)propane-1,3-diyl Dibenzoate (8)
Yield 4.3 g (73%), m.p. 162-164 °C. 1H NMR (DMSO-d6, 400 MHz) 5 4.20-4.50 (m, 5H, 2CH2, CH), 5.11 (s, 2H, CH2 phenoxy), 5.41 (s, 2H, OCH2N), 5.62 (s, 1H, CH uracil), 7.10-7.93 (m, 13H, Ar-H), 12.10 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 64.1, 64.8, 71.3, 74.3, 100.6,
115.6,	122.8, 125.9, 128.4, 129.0, 129.5, 129.8, 133.8, 151.3,
151.7,	152.2, 162.5, 165.8. MS m/z = 599.2 [M+]. Anal. Calcd for C29H24Cl2N2O8: C, 58.11; H, 4.04; N, 4.67. Found: C, 58.24; H, 4.13; N, 4.53.
1-(Benzyloxymethyl)-6-((2,4-dichlorophenoxy)methyl) pyrimidine-2,4(1H,3H)-dione (10)
Yield 2.8 g (69%), m.p. 114-116 °C. 1H NMR (DMSO-d6, 400 MHz): 5 4.62 (s, 2H, CH2Ph), 5.25 (s, 2H, CH2 phenoxy), 5.45 (s, 2H, OCH2N), 5.81 (s, 1H, CH uracil), 7.287.81 (m, 8H, Ar-H), 12.01 (br s, 1H, NH). 13C NMR (DM-SO-d6, 100 MHz): 5 64.8, 70.3, 71.5, 100.6, 115.6, 122.6, 125.7, 127.0, 127.7, 128.1, 128.2, 129.5, 137.3, 150.9, 151.5, 151.6, 158.8. MS: m/z = 407.2 [M+]. Anal. Calcd for C19H-16Cl2N2O4: C, 56.04; H, 3.96; N, 6.88. Found: C, 56.11; H, 3.87; N, 6.97.
1,3-Bis(benzyloxymethyl)-6-((2,4-dichlorophenoxy) methyl)pyrimidine-2,4(1H,3H)-dione (11)
Yield 3 g (58%), m.p. 158-160 °C. 1H NMR (DMSO-d6, 400 MHz) 5 4.43, 4.45 (2 x s, 4H, 2 x CH2Ph), 5.24 (s, 2H, CH2 phenoxy), 5.34 (s, 2H, OCH2-N1), 5.46 (s, 2H, OCH2-N3), 5.91 (s, 1H, CH uracil), 7.25-7.67 (m, 13H, Ar-H). 13C NMR (DMSO-d6, 100 MHz) 5 65.1, 70.6, 71.4, 73.1, 100.2, 116.0, 122.9, 126.1, 127.7, 127.8, 128.1, 128.5, 128.6, 129.9, 137.7, 150.8, 152.2, 161.6. MS m/z = 527.3 [M+]. Anal. Calcd for C27H24Cl2N2O5: C, 61.49; H, 4.59; N, 5.31. Found: C, 61.55; H, 4.51; N, 5.39.
2-(Benzoyloxymethyl)-5-(6-((2,4-dichlorophenoxy) methyl) -2,4-dioxo-3,4-dihydropyrimidin-1 (2H) -yl)tet-rahydrofuran-3,4-diyl Dibenzoate (15)
Yield 4.5 g (62%), m.p. 113-115 °C. 1H NMR (DMSO-d6, 400 MHz) 54.31-4.40 (m, 2H, H-5',5"), 4.51-4.60 (m, 1H, H-4'), 4.91 (s, 2H, CH2 phenoxy), 5.71 (s, 1H, CH uracil), 5.90-6.11 (m, 2H, H-2, H-3'), 6.40 (d, 1H, J = 9.10 Hz,
H-1'), 7.10-7.98 (m, 18H, Ar-H), 12.01 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 63.7, 65.7, 70.7, 73.8, 78.2, 98.0, 115.7, 122.9, 125.9, 128.6, 128.8, 128.9, 129.1, 129.5, 129.6, 129.9, 133.7, 134.0, 134.2, 151.1, 152.2, 162.5, 164.9, 165.1, 165.8. MS m/z = 730 [M-1]. Anal. Calcd for C37H-28Cl2N2O10: C, 60.75; H, 3.86; N, 3.83. Found: C, 60.63; H, 3.94; N, 3.75.
(3-(4-Chlorobenzoyloxy)-5-(6-((2,4-dichlorophenoxy) methyl) -2,4-dioxo-3,4-dihydropyrimidin-1 (2H) -yl)tet-rahydrofuran-2-yl)methyl 4-Chlorobenzoate (17)
Yield 3.9 g (58%), m.p. 85-87 °C. 1H NMR (DMSO-d6, 400 MHz) 5 2.21-2.30 (m, 2H, H-2',2"), 4.81-4.25 (m, 2H, H-5',5"), 4.72 (m, 1H, H-4'), 4.90 (s, 2H, CH2 phenoxy), 5.40 (m, 1H, H-3'), 5.61 (s, 1H, CH uracil), 6.51 (m, 1H, H-1'), 7.10-8.00 (m, 11H, Ar-H), 11.93 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 66.4, 67.6, 74.9, 75.6, 79.5, 81.2, 82.3, 98.2, 102.9, 115.6, 128.5, 129.2, 129.8, 129.9, 130.6, 131.1, 131.4, 138.6, 150.4, 150.8, 151.1, 162.8, 163.0, 164.9. MS m/z = 678 [M-2]. Anal. Calcd for C30H22Cl4N2O8: C, 52.96; H, 3.26; N, 4.12. Found: C, 52.87; H, 3.31; N, 4.20.
2-(Acetoxymethyl)-6-(6-((2,4-dichlorophenoxy)meth-yl)-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahy-dro-2H-pyran-3,4,5-triyl Triacetate (19)
Yield 4.1 g (67%), m.p. 137-139 °C. 1H NMR (DMSO-d6, 400 MHz) 5 1.80-2.10 (4xs, 12H, 4 x COCH3), 3.31 (m, 1H, H-5'), 4.18 (m, 2H, H-6;6"), 5.02 (m, 4H, H-3', H-4;CH2 phenoxy), 5.42 (dd, 1H, J1,2 = 9.50, J2,3 = 9.10 Hz, H-2'), 5.60 (s, 1H, CH uracil), 6.20 ' (d, 1H, Ju = 9.50 Hz, H-1'), 7.10-7.81 (m, 3H, Ar-H), 12.01 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 15.5, 20.2, 20.5, 20.7, 62.0, 65.2, 67.9, 73.0, 77.8, 79.5, 96.6, 99.1, 115.7, 122.9, 125.9, 149.8, 151.7, 152.1, 162.1, 162.7, 169.3, 170.3. MS m/z = 617.3 [M+]. Anal. Calcd for C25H26Cl2N2O12: C, 48.64; H, 4.24; N, 4.54. Found: C, 48.59; H, 4.31; N, 4.60.
2. 1. 2. General Procedure for the Preparation of Deprotected Nucleosides 7, 9, 16, 18 and 20
Each protected nucleoside was dissolved individually in methanol saturated with ammonia and stirred for two days at room temperature. Then the solution was concentrated to dryness and the residue recrystallized in methanol to give deprotected nucleosides 7, 9, 16, 18 and 20.
6-((2,4-Dichlorophenoxy)methyl)-1-((2-hydroxyethoxy) methyl)pyrimidine-2,4(1H,3H)-dione (7)
Yield 3 g (83%), m.p. 228-230 °C. 1H NMR (DMSO-d6, 400 MHz) 5 3.70, 3.76 (2 x t, 4H, HOCH2CH2O), 4.90 (br s, 1H, OH), 5.50 (s, 2H, CH2 phenoxy), 5.56 (s, 2H, OCH2N), 6.03 (s, 1H, CH uracil), 7.40-7.80 (m, 3H, Ar-H), 11.83 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 5 60.3, 65.0, 70.7, 72.2, 100.5, 116.0, 122.9, 126.0, 128.6, 129.9, 151.9, 162.7. MS m/z = 360 [M-1]. Anal. Calcd for C14H14Cl2N2O5: C, 46.56; H, 3.91; N, 7.76. Found: C, 46.62; H, 3.83; N, 7.84.
6-((2,4-Dichlorophenoxy)methyl)-1-((1,3-dihydroxypro-pan-2-yloxy)methyl)pyrimidine-2,4(1H,3H)-dione (9)
Yield 3.2 g (84%), m.p. 190-192 °C. NMR (DMSO-d6, 400 MHz) 8 3.40-3.58 (m, 5H, 2CH2, CH), 4.53 (m, 2H, OH), 5.33 (s, 2H, CH2 phenoxy), 5.42 (s, 2H, OCH2N), 5.69 (s, 1H, CH uracil), 7.31-7.64 (m, 3H, Ar-H), 12.10 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 8 61.0, 65.1, 70.2, 80.6, 110.1, 115.4, 116.0, 122.8, 125.9, 128.6, 129.8, 151.9, 152.0, 152.2, 163.2. MS m/z = 390 [M-1]. Anal. Cal-cd for C15H16Cl2N2O6: C, 46.05; H, 4.12; N, 7.16. Found: C, 46.14; H, 4.20; N, 7.09.
6-((2,4-Dichlorophenoxy)methyl)-1-(3,4-dihydroxy -5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine -2,4(1H,3H)-dione (16)
Yield 2.7 g (65%), m.p. 128-130 °C. 1H NMR (DMSO-d6, 400 MHz) 8 3.40-3.44 (m, 2H, H-5',5''), 3.58-3.60 (m, 1H, H-4'), 3.70-3.85 (m, 1H, H-3'), 4.10-4.25 (m, 1H, H-2'), 4.15 (d, 1H, OH), 4.60 (d, 1H, OH), 4.90 (s, 2H, CH2 phenoxy), 5.13 (m, 1H, OH), 5.72 (s, 1H, CH uracil), 6.08 (d, 1H, J = 7.75 Hz, H-1'), 7.20-7.62 (m, 3H, Ar-H), 11.91 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 8 62.6, 65.7, 70.52, 71.1, 84.7, 87.7, 98.0, 115.6, 122.9, 125.8, 128.5, 129.0, 133.7, 150.6, 152.2. MS m/z = 421.1 [M+2]. Anal. Calcd for C16H16Cl2N2O7: C, 45.84; H, 3.85; N, 6.68. Found: C, 45.92; H, 3.93; N, 6.76.
6-((2,4-Dichlorophenoxy)methyl)-1-(4-hydroxy-5-(hy-droxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4 (1H,3H)-dione (18)
Yield 2.8 g (69.7%), m.p. 195-197 °C. 1H NMR (DMSO-d6, 400 MHz) 8 2.15-2.21 (m, 2H, H-2',2''), 3.22-3.31 (m, 2H, H-5',5"), 3.81(br s, 2H, 2 x OH), 4.50 (m, 1H, H-3'), 4.80 (s, 2H, CH2 phenoxy), 5.08 (m, 1H, H-4'), 5.40 (s, 1H, CH uracil), 5.51 (m, 1H, H-1'), 7.06-7.70 (m, 3H, Ar-H), 12.10 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 8 61.7, 65.6, 71.5, 81.1, 86.0, 87.7, 98.3, 115.6, 122.9, 125.8, 128.6, 129.9, 150.1, 151.1, 152.2, 163.1. MS m/z = 405.2 [M+2]. Anal. Calcd for C16H16Cl2N2O6: C, 47.66; H, 4.00; N, 6.95. Found: C, 47.59; H, 4.05; N, 6.87.
6-((2,4-Dichlorophenoxy)methyl)-1-(3,4,5-trihydroxy -6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl)pyrimi-dine-2,4(1H,3H)-dione (20)
Yield 2.5 g (55.7 %), m.p. 214-216 °C. 1H NMR (DMSO-d6, 400 MHz) 8 2.80-2.90 (m, 1H, H-3'), 3.19-3.45 (m, 4H, H-4; H-5; H-6,,6"), 4.10 (dd, 1H, J1,2 = 9.95 Hz, J2,3 = 9.15 Hz, H-2'), 4.10 (m, 4H, 4 x OH), 4.71 (s, 2H, CH2 phenoxy), 5.30 (d, 1H, J = 9.95 Hz, H-1'), 5.55 (s, 1H, CH uracil), 7.02-7.55 (m, 3H, Ar-H), 8.20 (br s, 1H, NH). 13C NMR (DMSO-d6, 100 MHz) 8 61.4, 65.8, 68.4, 70.4, 78.3, 81.2, 83.3, 96.9, 99.1, 115.6, 122.8, 125.7, 128.6, 129.8, 152.2, 163.7, 166.5. MS m/z = 451.1 [M+2]. Anal. Calcd for C17H18Cl2N2O8: C, 45.45; H, 4.04; N, 6.24. Found: C, 45.51; H, 4.09; N, 6.17.
3. Results and Discussion
Our strategy to design and synthesize pyrimidine nucleoside analogues was based on the alkylation of si-
HN
O^N H
I
HMDS (NIl^SOj
OSi(CH,)j
N
[I[3C),SiO N
CIVICS
R= X
3
SoCl4
[IN
(An
L'O—i I
s- 6: R -COCH,
,.ch3oh
7: R -H
'V
OB;
SnClj
0
R O
NH

OR
8: R' =B?
;,CH3GII (
^ =H
O
Ph O 0,U
=	HN
SnCl4	O N
II
Ph O N .
^ 1
O N II
>J
Scheme 1. Synthesis of acyclic nucleoside analogues containing pyrimidine moiety 6-11
lylated pyrimidine following Vorbruggen and Niedballa's procedure.33-35 The intermediate, bis(trimethylsilyl) 2, was prepared by the silylation of 6-(2,4-dichlorophenoxymeth-yl)pyrimidine-2,4-dione (1) using hexamethyldisilazane (HMDS) and subjected to react with different acyclic sugar analogues, namely (2-acetoxyethoxy)methyl acetate (3), 2-(acetoxymethoxy)propane-1,3-diyl dibenzoate (4) and benzyloxymethyl acetate (5) to afford the corresponding protected nucleosides analogues 6, 8 and 10, 11, respectively (Scheme 1).
Structures of new acyclic nucleoside analogues were fully characterized by analytical and spectral methods (1H NMR, 13C NMR, and elemental analysis). The 1H NMR showed the disappearance of -NH proton which was detected in the parent compound 1 and instead a new signal appeared at the range S 5.34-5.62 ppm characteristic for (-OCH2N) indicative for the acyclic nucleosides formation. It is interesting to note that the reaction of 2 with benzyloxymethyl acetate (5) afforded two products 10 and 11. 1H NMR showed the disappearance of the two -NH protons of 1 and two new signals appeared at 5.34 and 5.46 ppm at-
Scheme 1. Synthesis of acyclic nucleoside analogues containing pyrimidine moiety 6-11
tributed to (-OCH2N and -OCH2N3), supporting the formation of 11 via double alkylation of 2 (cf. Experimental).
Deprotection of compounds 6 and 8 was achieved by cleavage of the ester blocking group with methanolic ammonia solution to give compounds 7 and 9 in fair to moderate yield, respectively (c.f. Experimental). In the continuation of our study, compound 1 was reacted with various activated cyclic sugars, namely 2-acetoxy-5-(benzoy-loxymethyl)tetrahydrofuran-3,4-diyl dibenzoate (12), 5-chloro-2-((4-chlorobenzoyloxy)methyl)tetrahydrofu-ran-3-yl 4-chlorobenzoate (13) and 2-(acetoxymeth-yl)-6-bromotetrahydro-2H-pyran-3,4,5-triyl triacetate (14) under the same procedure as previously, giving the protected nucleosides 15, 17 and 19 as ^-anomers. 1H NMR showed a doublet signal at S 6.20-6.51 ppm corresponding to the anomeric proton of the sugar moiety with the spin-spin coupling constant (J12 = 9.10-9.50 Hz) which can be attributed to the diaxial orientation of H-1 and H-2 protons indicating the presence of ^-configuration. Compounds 15, 17, and 19 were deprotected by using methanolic ammonia solution at room temperature to give compounds 16, 18, and 20, respectively (Scheme 2).
4. Conclusions
A series of cyclic and acyclic nucleosides were prepared with moderate yields by alkylation of 6-(2,4-dichlo-rophenoxymethyl)pyrimidine-2,4-dione with various acyclic and cyclic activated sugars by performing Vorbruggen and Niedballa's procedure. Deprotection of the synthesized nucleosides was achieved by using methanolic ammonia solution.
5. Acknowledgments
The authors acknowledge Professor Chris Meier and Innovative Research Team in State Key laboratory of Organic Chemistry, Hamburg University, for their help during performing this work.
6. References
1.	E. De Clercq, A. Holy, Nat. Rev. Drug Discovery. 2005, 4, 928240. D0I:10.1038/nrd1877
2.	D. F. Ewing, V. Glaçon, G. Mackenzie, C. Len, Tetrahedron Lett. 2002, 43, 989-991. D0I:10.1016/S0040-4039(01)02298-5
3.	D. Pansuriya, K. Menpara, N. Kachhadiya, J. Menpara, K. Ladva, J. Appl. Chem. 2014, 3, 2335-2342.
4.	R. C. Elderfield, Heterocyclic compounds, John Wiley & Sons, Inc., New York, 1957, Vol. 6, p 744. D0I:10.1002/jps.3030460623
5.	A. E. Porter, Diazines and benzodiazines (Netherlands: Pre-gamon Press, Elsevier Science) BV 6. Amsterdam, 1979, p.14.
6.	C. O. Kappe, Tetrahedron. 1993, 49, 6937-7168. DOI:10.1016/S0040-4020(01)87971-07
7.	A. L. S. Rodrigues, J. M. Rosa, V. M. Gadotti, Pharmacol., Biochem. Behav. 2005, 82, 156-162. DOI:10.1016/j.pbb.2005.08.003
8.	J. S. Bradley, R. Guidos, S. Baragona, Lancet Infect. Dis. 2007, 7, 68-78. DOI:10.1016/S1473-3099(06)70689-2
9.	N. M. Thumar, A. A. Kaneria, M. Vadodaria, K. Ladva, Int. Lett. Chem. Phys. Astron. 2016, 65, 11-26. DOI:10.18052/www.scipress.com/ILCPA.65.11
10.	H. P. Schweizer, Microbiology Lett. 2001, 202, 1-7. DOI:10.1111/j.1574-6968.2001.tb10772.x
11.	K. Poole, J. App. Microbiol. 2002, 92, 55-64S. DOI:10.1046/j.1365-2672.92.5s1.8.x
12.	K. Poole, J. Pharm. Pharmacol. 2001, 53, 283-294. DOI: 10.1211/0022357011775514
13.	P. W. Taylor, P. D. Stapleton, J. P. Luzio, Drug Discov. Today. 2002, 7, 1086-1091. DOI:10.1016/S1359-6446(02)02498-4
14.	Y. Ju, D. Kumar, R. S. Varma, J. Org. Chem. 2006, 71, 66976700. DOI:10.1021/jo061114h
15.	M. F. El Shehry, J. Balzarini, C. Meier, Synthesis. 2009, 5, 841847. DOI:10.1055/s-0028-1083369
16.	Y. Ju, R. S. Varma, J. Org. Chem. 2006, 71, 135-141. DOI:10.1021/jo051878h
17.	C. A. Zificsak, D. J. Hlasta, Tetrahedron. 2004, 60, 8991-9016. DOI:10.1016/j.tet.2004.07.016
18.	T. Haino, M. Tanaka, K. Ideta, K. Kubo, A. Mori, Y. Fukazawa, Tetrahedron Lett. 2004, 45, 2277-2279. DOI:10.1016/j.tetlet.2004.01.116
19.	A. Manlove, M. P. Groziak, J. Heterocycl. Chem. 2009, 21, 375-414. DOI:10.1016/S0959-6380 (9)70040-6
20.	R. Singh, A. Chouhan, World J. Pharm. Pharm. Sci. 2014, 3, 574-597.
21.	M. Hassan, D. van der Lelie, D. Springael, U. Romling, N. Ahmed, M. Mergeay, Gene. 1999, 238, 417-425. DOI:10.1016/S0378-1119(99)00349-2
22.	D. M. Livermore, Intensive Care Med. 2000, 26, S14-21. DOI:10.1007/s001340051113
23.	L. Jeu, F. J. Piacenti, A. G. Lyakhovetskiy, H. B. Fung, Voriconazole. Clin. Ther. 2003, 25, 1321-1381. DOI:10.1016/S0149-2918(03)80126-1
24.	P. D. Lokhande, B.Y. Waghamare, S. S. Sakate, Indian J. Chem. Sect. B. 2005, 44, 2338-2342.
25.	G. J. Reddy, D. Manjula, K. S. Rao, M. Khalilullah, D. Latha, Indian J. Chem. Sect. B. 2005, 44, 2412-2415.
26.	M. Garcia-Valverde, T. Torroba, Molecules. 2005, 10, 318-320. DOI: 10.3390/10020318
27.	D. W. Hopper, A. L. Crombie, J. J. Clemens, S. Kwon, Prog. Heterocycl. Chem. 2009, 21, 330-374. DOI:10.1016/j.pbb.2005.08.003
28.	J. Tani, Y. Yamada, T. Oine, T. Ochiai, R. Ishida, I. Inoue, J. Med. Chem. 1979, 22, 95-99. DOI:10.1021/jm00187a021
29.	B. Kumar, B. Kaur, J. Kaur, A. Parmar, R. D. Anand, H. Kumar, Indian J. Chem. Sect. B. 2002, 41, 1526-1530.
DOI: 10.1155/2014/202784
30.	S. V. Dinakaran, B. Bomma, K. K. Spinivasan, Pharm. Chem. 2012, 4, 255-265.
31.	M. A. Abu-Zaied, E. M. El-Telbani, G. H. Elgemeie, G. A. M. Nawwar, Eur. J. Med. Chem. 2011, 46, 229-235. DOI:10.1016/j.ejmech.2010.11.008
32.	M. F. El Shehry, R. H. Swellem, S. M. Abu-Bakr, E. M. El-Tel-bani, Eur. J. Med. Chem. 2010, 45, 4783-4787. DOI:10.1016/j.ejmech.2010.07.043
33.	E. M. El-Telbani, S. M. Ghanem, F. A. El Essawy, A. F. El-Sayed, Lett. Drug. Des. Discov. 2011, 8, 822-829.
DOI:10.2174/1570180811108090822
34.	U. Niedballa, H. Vorbruggen, J. Org. Chem. 1974, 39, 36543660. DOI:10.1021/jo00939a008
35.	U. Niedballa, H. Vorbruggen, J. Org. Chem. 1976, 41, 20842086. DOI:10.1021/jo00874a002
36.	H. Vorbruggen, K. Krolikiewiecz, B. Bennua, Chem. Ber. 1981, 114, 1234-1255. DOI:10.1002/cber.19811140404
Povzetek
V članku predstavljamo priročno metodo za pripravo cikličnih in acikličnih nukleozidov s pomočjo alkiliranja 6-(2,4-diklorofenoksimetil)pirimidin-2,4-diona (1) s širokim izborom acikličnih in cikličnih aktiviranih analogov sladkorjev: (2-acetoksi)metil acetat (3), 2-(acetoksimetoksi)propan-1,3-diil dibenzoat (4), benziloksimetil acetat (5), 2-ace-toksi-5-(benzoiloksimetil)tetrahidrofuran-3,4-diil dibenzoat (12), 5-kloro-2-((4-klorobenzoiloksi)metil)tetrahidrofu-ran-3-il 4-klorobenzoat (13) in 2-(acetoksimetil)-6-bromotetrahidro-2ff-piran-3,4,5-triil triacetat (14). Odstranitev zaščitne skupine iz tako pripravljenih nukleozidov smo dosegli z uporabo amonijaka v metanolu. Nove nukleozide, ki smo jih na ta načini sintetizirali, smo tudi karakterizirali z analitskimi metodami (masna spektrometrija, 'H NMR, 13C NMR in elementna analiza).
DOI: I0.i7344/acsi.20i7.4i5i	Acta Chim. Slav. 2018, 65, 407-415	©commohs
Scientific paper
Investigation of High-Activity Activated Carbon-Supported Co-Cr-B Catalyst in the Generation of Hydrogen from Hydrolysis of Sodium Borohydride
Orhan Baytar
Siirt University, Faculty of Engineering and Architecture, Department of Chemical Engineering, Siirt, 56100, Turkey * Corresponding author: E-mail: orhanbaytar@siirt.edu.tr Received: 28-12-2017
Abstract
In this study, activated carbon-supported Co-Cr-B catalyst was synthesized by chemical impregnation and precipitation method for use in the catalytic hydrolysis of sodium borohydride (NaBH4). The activity of Co-Cr-B / activated carbon (5-20%) obtained by using different ratios was investigated while synthesizing activated carbon-supported Co-Cr-B catalyst. The effects of some parameters such as NaOH Concentration (0-5%), NaBH4 concentration (2.5-10%), amount of catalyst (25-100 mg) and solution ambient temperature were investigated in the catalytic hydrolysis of NaBH4. The hydrogen production rate of Co-Cr-B catalyst without support in hydrolysis of NaBH4 was found as 6.5 Lg-1 min-1catalyst while the hydrogen production rate of activated carbon supported Co-Cr-B catalyst was found as 30.2 Lg-1 min-1catalyst. In presence of activated carbon-supported Co-Cr-B catalyst, the hdyrolysis kinetic order and activation energy of NaBH4 were found as 0.126 and 16.27 kJ/mol, respectively. The results suggest that activated carbon-supported Co-Cr-B catalysts can be used for mobile applications of Proton exchange membrane fuel cell (PEMFCs) systems.
Keywords: Activated carbon; catalyst; Co-Cr-B; NaBH4
1. Introduction
Depletion of existing fossil fuels, global warming and environmental pollution are increasing demands for a clean and sustainable energy system.1 Hydrogen can be considered as energy for the future due to clean and zero emission.2 Therefore, a safe and practical hydrogen production system is required. Production, storage and consumption of hydrogen are very difficult due to its flam-mability and storage problem. Therefore, an aqueous solution of metal hydride stabilized can be considered as a suitable material for hydrogen storage.3 Metal hydrides are compounds such as NaBH4, NaH, CaH2, MgH2, Li-AlH2. Among these metal hydrides, NaBH4 has some advantages such as high hydrogen storage capacity (10.8%), high stability and non-flammability at high pH, optimum control over the rate of hydrogen production with supported catalysts, acceptable hydrogen production rate even at low temperatures, ease of use and availability.4-5 The hydrolysis of NaBH4 with water is indicated the following reaction.6
NaBH4(aq) + 2 H2O(l) - NaBO2 + 4 H2(g)
Self-hydrolysis of NaBH4 does not occur at high pH values. Therefore, hydrolysis of NaBH4 takes place in the presence of suitable catalyst. In other words, to be able to perform the hydrolysis of sodium borohydride in a suitable catalyst surface. Many catalysts such as Co-B-P6, Co-W-B7, Co-Cu-B8, Ce0.05-Ni-W9, carbon nanotube supported Co-B10 and carbon supported Ru3 are used for hydrolysis of NaBH4.
The activity of the catalyst is directly related to the particle size and surface area, since the catalyst having small particle size and high surface area is in more contact with the reactant. Therefore, higher amounts of catalyst are required to significantly increase the reaction rate. Hence, some materials with high surface area are used as support material.11 Activated carbon,11 carbon,3 Al2O312 and Pd-TiO24 can be used as suppport materials. Activated carbon is more advantageous than other support materials due to its porous, high surface area and functional groups in its structure.13 The activated carbon is synthesized by physical or chemical activation method. Physical activation is the process of activation of the raw material at high temperature with a gas such as water vapor or CO2. Chemical activation is the synthesis process using activators such as
KOH, ZnCl2, H3PO4.14 The activated carbon is synthesized from raw materials such as pistachio shell,14 acorn shell,15 eleagnus angistofolia,16 carob bean seed husk.17
In our previous study, activated carbon was synthesized from the elaeagnus seed by physical activation method using a mixture of CO2 and water vapor. In this current study, the synthesized activated carbon was used as support material for the Co-Cr-B catalyst to be used for the hydrolysis of sodium borohydride.18 The experimental conditions for the NaBH4 hydrolysis of the synthesized activated carbon supported Co-Cr-B catalyst were optimized. It was found that the activated carbon-supported Co-Cr-B catalyst has high activity in the hydrolysis of NaBH4.
2. Experimental Part 2. 1. Materials
All the chemical substances used in the experiments are in analytical grade purity and have not been subjected to any purification process. In our previous work,18 the production and properties of activated carbon were given and the BET surface area was determined as 1084 m2/g. NaBH4 from Merk, CoCl2 ■ 6H2O and CrCl3 ■ 6H2O from Alpha Ae-sar and ethanol (C2H5OH, > 99.9%) from Sigma-Aldrich, were purchased. Pure water was used in our experiments.
2. 2. Synthesis of Activated Carbon
The procedure followed for the synthesis of activated carbon is given below. Approximately 10 g of milled spindle core was subjected to physical activation for 60 minutes at 900 °C in the presence of a mixture of CO2 and water vapor. The activated material cooled to room temperature was first washed with 500 mL of 0.5 M HCl, then
with hot deionized water until the pH of the solution reached 6-6.5. The obtained activated carbon was used as support material for the Co-Cr-B catalyst.
2. 3. Preparation of Catalyst
Activated carbon supported Co-Cr-B catalyst was prepared by chemical impregnation and reduction method. The production scheme of the catalyst is given in Figure 1. Catalyst preparation procedure; A certain amount of CoCI2 ■ 6H2O and CrCI3 ■ 6H2O were dissolved in 50 ml of ethanol, then the required amount of activated carbon was added and the metals were adsorbed to activated carbon at room temperature for 24 hours. The ethanol in the medium was then removed at 50 °C and 50 ml of distilled water was added to the metal-impregnated activated carbon, then left in the ice bath. The 50 ml of The NaBH4 solution, prepared to be 5 times the total metal moles, was added dropwise to the metal impregnated activated carbon in the presence of N2 gas. The resulting catalyst was filtered and washed several times with distilled water and anhydrous ethanol. The synthesized catalyst was dried in a nitrogen atmosphere at 80 °C for 6 hours. The obtained catalyst was maintained in a closed vessel in a nitrogen atmosphere to use in the hydrolysis of NaBH4.
2. 4. Characterization of Catalyst
Characterization of synthesized activated carbon-supported Co-Cr-B catalyst, Co-Cr-B catalyst and activated carbon was performed with BET surface area, XRD, FTIR and SEM-EDX measurements. Nitrogen adsorption-desorption of BET surface area at 77 K was determined by Quantachrome Nova 1200 series instrument. The structural properties was studied by x-ray diffraction
AC-supportsd CoCrB	' NaBHj
Figure 1: Application steps for production of activated carbon supported Co-Cr-B catalyst and for hydrolysis of NaBH4.
(XRD) on a Rigaku x-ray diffractometer with Cu Ka (X = 154.059 pm) radiation. The functional groups of the synthesized materials were determined with a Bruker Vertex 70 FT-IR instrument in the range of 4000-400 cm-1 wave number. The surface morphology of the synthesized materials was determined by scanning electron microscopy (SEM) and the percentages were determined by EDX.
2. 5. Determination of Catalyst Activity
The activity of synthesized activated carbon-supported Co-Cr-B catalysts for the hydrolysis of NaBH4 was determined using the system given in Figure 1. Experimental studies in which catalyst activity was determined,
were carried out in 10 ml of solution containing 2.5-10% NaBH4, 0-5% NaOH and 25-100 mg of activated carbon supported Co-Cr-B (5-20% Co-Cr-B catalyst loaded). The temperature was changed between 20 and 60 °C. The released hydrogen was noted cumulatively by time.
3. Results and Discussions 3. 1. SEM and EDX Analysis
The SEM and EDX results of activated carbon, activated carbon supported Co-Cr-B catalyst (15% Co-Cr-B loaded) and Co-Cr-B catalyst used as support materials are shown in Figure 2.
a2
		b2
i.	L ■ — ■ 1.....	4 *....................

Figure 2: SEM and EDX results; a1 and a2) activated carbon, b1 and b2) activated carbon-supported Co-Cr-B catalyst, c1 and c2) Co-Cr-B catalyst.
Figure 2 (a1) shows that the surface of activated carbon is porous and the pore distribution is heterogeneous. It is apparent that there are more microspores on the surface of activated carbon and this increases BET surface area of the activated carbon. Figure 2 (c1) reveals that the surface of the Co-Cr-B catalyst is not porous and uneven. This causes the activity of the Co-Cr-B catalyst to be lowered in the hydrolysis of NaBH4. Figure 2 (b1) demonstrates that the Co-Cr-B catalyst in the activated carbon supported Co-Cr-B catalyst is retained on the surface of the activated carbon and inside the pores. This leads to a greater amount of hydrogen produced in the hydrolysis of NaBH4 with a small amount of Co-Cr-B catalyst, thereby increasing the activity of the catalyst. Looking at the EDX results, it appears that the Co-Cr-B catalyst is present on the surface of the activated carbon.
3. 2. XRD Analysis
The structure properties of activated carbon, activated carbon supported Co-Cr-B catalyst (15% Co-Cr-B loaded) and Co-Cr-B catalyst were determined by XRD and the obtained results are displayed in Figure 3a, Figure 3b and Figure 3c, respectively.
As can be seen from Figure 3 (a), the characteristic peak of the carbon was observed between 20 = 20-250. Zhu et al.1 found the same results in their study of the synthesis of car-
2 0 (degree)
2 0 (degree)
2 0 (degree)
Figure 3: XRD results of a) activated carbon, b) activated carbon supported Co-Cr-B catalyst (15% Co-Cr-B loaded), c) Co-Cr-B catalyst.
bon-supported CoB catalysts. Fernandes et al.23 reported that the Co-Cr-B catalyst gives a peak at 20 = 450. A peak at 20 = 450, is shown in Figure 3 (b-c), also was observed. It is seen that the XRD results are in agreement with the EDX results.
3. 3. FTIR Analysis
The FT-IR spectra of the activated carbon, activated carbon supported Co-Cr-B catalyst (15% Co-Cr-B loaded)
Wav en umber (cm"1}
Waveri um her (cm ')
Wavenumber (cm"1)
Figure 4: FTIR Results; a) activated carbon b) activated carbon-supported Co-Cr-B catalyst c) Co-Cr-B catalyst.
and Co-Cr-B catalyst are shown in Figure 4a, Figure 4b and Figure 4c, respectively.
As can be seen from Figure 4 (a), the activated carbon structure used as support material has; a peak at 3700 cm-1 due to hydroxyl (OH-) functional groups bound by hydrogen bonds, a peak at 2900 cm-1 is related to the functional groups of CH originating from methyl or methylene groups, a peak at 2380 cm-1 is associated with the -C = C functional groups, a peak at 2100 cm-1 is related to the -COOH functional groups and a peak at 1400 cm-1 gives the _C-CH3 functional groups. Figure 4 (b) reveals that after the Co-Cr-B catalyst is adsorbed on the activated carbon surface, some functional groups are weakened and others are becoming more visible. It is seen that the peak of OH- at 3700 cm-1 and the peak of -C-H at 2900 cm-1 in activated carbon structure shown in Figure (3b) are weakened. A large peak at 700 cm-1 was observed. The probable cause of this peak formation is due to the newly formed bond between the Co-Cr-B catalyst and activated carbon. BET surface areas of activated carbon, activated carbon supported Co-Cr-B catalyst (loaded with 15% Co-Cr-B) and Co-Cr-B catalyst used as support materials are given in Table 1.
Table 1: BET surface area results
Samples	BET surface area (m2/g)
Activated carbon	1084
Activated carbon supported Co-Cr-I	5 catalyst 666
Co-Cr-B catalyst	219
As can be seen from Table 1, the surface area of the activated carbon is observed to decrease very seriously by the adsorption of the Co-Cr-B catalyst. The probable cause of this situation is the placement of the Co-Cr-B catalyst in the activated carbon pores, as seen in the SEM images. TheBET surface areafor Co-Cr-B catalyst was obtained as 219 m2/g and this value is the same with result reported by Fernande et al.23.
3. 4. Effect of the Ratio Between Metal and Activated Carbon
Effect of Co-Cr-B catalyst / activated carbon ratio (5-20% Co-Cr-B loaded) was investigated in the presence of 2.5% NaBH4 + 2% NaOH at 30 °C and 100 mg of catalyst in 10 ml of the solution. The change in the rate of hydrogen with % Co-Cr-B is given in Figure 5a.
Figure 5a displays that the hydrogen production rate of Co-Cr-B catalyst produced without support in NaBH4 hydrolysis is 6.5 L g-1 min-1catalyst while the hydrogen production rate of 15% Co-Cr-B loaded on the activated carbon catalyst is 30.226 L g- 1 min-1 catalyst. This is probably due to the increase in the surface area of the Co-Cr-B cat-
alyst with activated carbon and the increase in active sites on the surface of the activated carbon. Baydaroglu et al.19 found that hydrogen production rate is 21.540 L g-1 min-1catalyst using carbon black supported CoB catalysts while it is 5.670 L g-1 min-1catalyst using an unsupported CoB catalysts. It can be seen from Figure 5 that the rate of hydrogen production increases as the Co-Cr-B / activated carbon percentage increases from 5% to 15% and the rate of hydrogen production decreases after the maximum value reaches 15%. The probable cause of this situation is that as the amount of Co-Cr-B increases, there are multilayers of catalyst layers on the surface of activated carbon and in the pores.
a)
b)
600 -
a p
to
—r— 20
~r~ no
50
time(min)
Figure 5: a) Change of hydrogen production rate by the amount of Co-Cr-B loaded on the activated carbon. b) Graph of the change in hydrogen content over time for different NaOH concentrations (V: 10 mL, 2.5% NaBH4, 100 mg of catalyst, 30 °C).
3. 5. Effect of NaOH
Since aqueous solutions of NaBH4 are not hydrolyz-ed at high pH values, NaOH is used to increase the pH value of the solution. In this part of the study, the effect of 10 ml of solution of 2.5% NaBH4, 100 mg (loaded with
15% Co-Cr-B) activated carbon supported catalyst and different NaOH concentrations at 30 °C on the hydrolysis of NaBH4 was investigated. The volume of hydrogen produced over time at different NaOH concentrations is given in Figure 5b.
As can be seen from Figure 5b, when the concentration of NaOH is increased from 1% to 2%, the rate of hydrogen production is increased whereas when the concentration of NaOH is more than 2%, the rate of hydrogen production is decreased. The probable cause of this behavior is that there are two different effects of OH ions in catalytic hydrolysis reactions. The first of these is the increase in the contact between NaBH4 and the catalyst that results in increased electrostatic interaction between the activated carbon and the Co-Cr-B catalyst in the reaction solution medium at low NaOH concentrations. Hence, when the NaOH concentration is increased from 1% to 2%, the hydrogen production rate rises. The second is that OH - (more than 2%) ions present in the medium in excess have an inhibitory effect on NaBH4 hydrolysis. Another possible cause of this situation is that NaOH, which is present in excess in the solution medium, reduces the aqueous solubility of NaBO2, a by-product of hydrolysis of NaBH4. Therefore, NaBO2 in solution will collapse and block the active sites of the catalyst, thereby reducing the hydrogen production rate. Kaya et al.20 found that the NaBO2 metastatic area narrows with increasing solution pH in the study of NaBO2 metastatic region. That is, if the concentration of NaOH is high, it accelerates NaBO2 precipitation. Ye et al.12 used Al2O3-supported CoB catalysts for hydrolysis of NaBH4 in the presence of different NaOH concentrations and found the same results. The optimum concentration of NaOH for hydrolysis of NaBH4 was determined as 2% and all subsequent runs were performed at a NaOH concentration of 2%.
3. 6. Effect of Concentration of NaBH4
Hydrolysis of NaBH4 is not only dependent on catalyst activity but also on factors such as NaBH4 concentration, NaOH concentration and temperature. NaBH4 hydrolysis was investigated at different concentrations in a 10 ml solution medium with 2% NaOH concentration, 100 mg activated carbon supported Co-Cr-B catalyst (loaded with 15% Co-Cr-B) and 30 °C temperature. The time-elut-ed hydrogen volume at different NaBH4 concentrations is given in Figure 6a. Hydrogen initial production rates versus different concentrations of NaBH4 is also given on the same figure.
As can be seen from Figure 6a, as the NaBH4 concentration increases, the initail rate of hydrogen decreases. Especially, when the NaBH4 concentration is 10%, there is a very serious decrease in the hydrogen production rate. The likely reason for this is that the solubility in water of the NaBO2 which is by-product in the hydrolysis of NaBH4,
is limited. Another reason for this is; The high concentrations of NaBH4 and NaBO2 presented in the medium increase the viscosity of the final solution, which slows the mass transfer to the catalyst surface from the NaBH4 present in the solution medium. Xu et al.21. found the same conclusion in their work.
a)
£500
=■ 2000 e
a 1500
o >
500-
0-
-—i—'—r
4 5
Time(min.)
b)
700 600 500' 400
300' 200' 100' 0'
'■ 25 mg AC-supported Co-Cr-B • 50 AC-supported Co-Cr-B
Artrtmit trfiilAlyil qnu
-I-
10
—r-
15
20
25
Time(m in.)
Figure 6: a)The graph of change in hydrogen content over time for different NaBH4 concentrations (V: 10 mL, 2% NaOH, 100 mg of catalyst, 30 °C). b) The graph of change in hydrogen content with time for different amounts of catalyst (V: 10 ml; 2.5% NaBH4; 2% NaOH; 30 °C).
3. 7. Effect of Amount of Catalyst
The hydrolysis of NaBH4 was studied in 10 ml of solution at a concentration of 2.5% NaBH4 + 2% NaOH, at 30 °C and in different amounts of catalyst. The volume of hydrogen produced with time for different amounts of catalyst is given in Figure 6b.
As shown in the Figure 6b, as the amount of catalyst increases, the hydrogen rate also increases. This suggests that the hydrolysis of NaBH4 is catalyst-controlled.
3. 8. Effect of Solution Temperature
The effect of the temperature on the hydrolysis of NaBH4 was investigated. The change in hydrogen volume of produced hydrogen at different temperatures is given in Figure 7a.
As can be seen from Figure 7a, there is a significant increase in the volume of hydrogen obtained in the hydrolysis of NaBH4 as the temperature increases. 2.5% NaBH4 hydrolysis takes place in 13 minutes at 20 °C, 1.75 minutes at 30 °C and 1 minute at 60 °C.
One of the most fundamental reasons for measuring the reaction time of any reaction at different temperatures is determining the reaction rate constant and determining the activation energy required for the reaction to take place accordingly. For this reason, first of all, a n-th reaction was used to determine the rate constants at different temperatures and the reaction rate constant for this reaction was determined by the equation given below.
Equation 2 was obtained if Equation 1 was set.
i
According to Equation 2, the slope of ^jpi versus t gives the reaction rate constant (k) for different temperatures.
However, when this equation was applied, the n values were selected in that form, until the regression coefficient was close to 1. After the most suitable n value was determined, k was obtained from the slope of the obtained curve. In this procedure, the graph of * ■ versus t is given in Figure 7b.
As you can see in Figure 7b, the selected n values in all temperatures are consistent and linear. Within the
above procedure, the optimum order of rate was found as 0.126. The rate constants at different temperatures are given in Table 2. Activation energy was determined by arhe-nius equation using these rate constants at different temperatures.
Table 2: The rate constants for different temperatures.
Temperatures	Rate constants, k	Order
(°C)	(ml g-1 min-1catalyst)	
20	0.0518	0.126
25	0.1157	0.126
30	0.4217	0.126
40	0.4919	0.126
50	0.6038	0.126
60	0.7619	0.126
k = Ae«T	(3)
When Equation 3 was linearized, Equation 4 was obtained.
According to Equation 4, when the slope of the graph of lnk versus 1/T (is shown in Figure 8) was used, the activation energy required for the hydrolysis of NaBH4 in the presence of activated carbon-supported Co-Cr-B catalyst was found as 16.27 kJ /mol. This value is very low and indicates that the activity of the catalyst is very high. The hydrogen production rate of activated carbon-supported Co-Cr-B catalyst in 2.5 ml of NaBH4 hydrolysis in 10 ml of solution at 30 °C was determined as 30.266 L g-1 min-1catalyst and the comparison with literature is given in Table 3.
a)
700-
600 -
E. 500-
<11
£
.2 400-
o >
S 300 -£ O
200100-
Figure 7: a) The graph of change in hydrogen content with time for different temperatures (V: 10 ml; 2.5% NaBH4; 2% NaOH; 100 mg of catalyst). b) The graph of 1/C versus t for different temperatures.
b)
J? 0,4
m
u
12
14
Time(min)
Time(Second)
Table 3: Hydrogen production rates and activation energies of different catalysts for hydrolysis of NaBH4 in the literature.
Catalyst
Hydrogen production rate (L g 1 min. 'cataiyst) Activation energ, E(kj/mol)
Reference
Carbon supported CoB Carbon supported CoB Clay supported CoB Co-Cr-B
Reduced Co-Cr-B in plasma medium Activated carbon supported Co-Cr-B
2.073
3.350 3.400 1.416 30.226
57,8 44,1 56,32 37
16.17 16.27
1 21 22
23
24
This study
Figurce 8: The graph of ln (k) versus 1/T.
4. Conclusions
In this study, activated carbon supported Co-Cr-B catalyst was prepared to use in the hydrolysis of NaBH4. The hydrogen production rate of synthesized activated carbon-supported Co-Cr-B catalyst was found as 30.226 L g-1 min-1cataiyst while the hydrogen production rate unsupported Co-Cr-B catalyst was found as 6.490 L g-1 min-1cat-alyst. It was determined that the activity of the Co-Cr-B catalyst on the activated carbon surface increases approximately 5-fold. The effect of activated carbon ratio, NaOH concentration, NaBH4 concentration, catalyst amount and temperature on the activated carbon-supported Co-Cr-B catalyst for the hydrolysis of NaBH4 was investigated. It was determined that the hydrogen production rate of the 15% Co-Cr-B loaded catalyst was the best when the NaOH concentration was 2%. The increase in the concentration of NaBH4 reduced the production rate of hydrogen while the increase in the amount of catalyst increased the hydrogen production rate. It was determined that the production rate of hydrogen significantly increased with increasing temperature. The inhibition of hydrolysis kinetic of NaBH4 and the activation energy in the presence of activated carbon-supported Co-Cr-B catalyst were found to as 0.126 and 16.27 kJ/mol, repectively. According to the re-
sults obtained, activated carbon-supported Co-Cr-B catalyst NaBH4 can be used in PEMFC mobile systems.
5. References
1.	J. Zhu, R. Li, W. Niu, Y. Wu, Gou X, J. Power. Sources, 2012, 211, 33. D01:10.1016/j.jpowsour.2012.03.051
2.	W. Luo, P.G. Campbell, L.N. Zakharov, Liu S, J. Am. Chem. Soc. 2011, 133(48), 19326-19329. D0I:10.1021/ja208834v
3.	C. Crisafulli, S. Scire', R. Zito, C. Bongiorno, Catalysis Letters,
2012,	142, 882-888. D0I:10.1007/s10562-012-0844-y
4.	M. Rakap, E.E. Kalu, S. Özkar, Journal of Alloys and Compounds, 2011, 509, 7016-7021. D0I:10.1016/j.jallcom.2011.04.023
5.	J. Lee, K. Y. Kong, C. R. Jung, E. Cho, S. P. Yoon, Catalysis Today, 2007, 120, 305-310. D0I:10.1016/j.cattod.2006.09.019
6.	Ö. §ahin, D. Karakas, M. Kaya, C. Saka, Journal of the Energy Institute, 2016, 90, 1-10.
7.	A. Ekinci, Ö. §ahin, C. Saka, T. Avci, Int. J. Hydrog. Energy,
2013,	38, 15295-15301. D0I:10.1016/j.ijhydene.2013.09.098
8.	M. S. Izgi, Ö. §ahin, C. Saka, Int. J. Hydrog. Energy, 2016, 41, 1600-1608. D0I:10.1016/j.ijhydene.2015.11.004
9.	C. Saka, A. Ekinci, Ö. §ahin, A. Balbay, Journal of the Energy Institute, 2016, 89, 190-198. D0I:10.1016/j.joei.2015.02.004
10.	Y. Huang, Y. Wang, R. Zhao., P. K. Shen, Z. Wei, Int. J. Hydrog. Energy, 2008, 33, 7110-7115. D0I:10.1016/j.ijhydene.2008.09.046
11.	D. Xu, P. Dai, Q. Guo, X. Yue, Int. J. Hydrog. Energy, 2008, 33, 7371-7377. D0I:10.1016/j.ijhydene.2008.09.065
12.	W. Ye, H. Zhang, D. Xu, L. Ma, B. Yi J. Power Sources, 2007, 164, 544-548. D0I:10.1016/j.jpowsour.2006.09.114
13.	C. Saka, Journal of Analytical and Applied Pyrolysis, 2012, 95: 21-24. D0I:10.1016/j.jaap.2011.12.020
14.	H. Dolas, Ö. Sahin, C. Saka, H. Demir, Chem. Eng. J., 2011, 166, 191-197. D0I:10.1016/j.cej.2010.10.061
15.	Ö. Sahin, C. Saka, Bioresource Technology, 2013, 136, 163168. D0I:10.1016/j.biortech.2013.02.074
16.	Ö. §ahin, C. Saka, A. A. Ceyhan, O. Baytar, Separation Science and Technology, 2015, 50, 886-891.
D01:10.1080/01496395.2014.966204
17.	Ö. §ahin, C. Saka, A. A. Ceyhan, O. Baytar, Energy Sources, Part A: Recovery Utilization And Environmental Effects, 2016, 38, 1756-1762. D0I:10.1080/15567036.2014.956195
18.	O. Baytar, Sel^uk University Institute of Science, 2015, 42.
19.	F. Baydaroglu, E. Özdemir, A. Hasimoglu, Int. J. Hydrog. Energy, 2014, 39, 1516-1522. D01:10.1016/j.ijhydene.2013.04.m
20.	M. Kaya, A. A. Ceyhan, Ö. §ahin, Russian Journal of Physical Chemisry., 2014, 88, 402-408. D0I:10.1134/S0036024414030182
21.	D. Xu, P. Dai, X. Liu, C. Cao, Q. Guo, J. Power Sources, 2008, 182, 616-620. D0I:10.1016/j.jpowsour.2008.04.018
22.	H. Tian, Q. Guo, D. Xu, J. Power Sources, 2010, 195, 21362142. D0I:10.1016/j.jpowsour.2009.10.006
23.	R. Fernandes, N. A. Patel, Applied Catalysis B: Environmental, 2009, 92, 68-74. D0I:10.1016/j.apcatb.2009.07.019
24.	F. Hansu, Journal of the Energy Institute, 2015, 88, 266-274. D0I:10.1016/j.joei.2014.09.004
Povzetek
V tem prispevku smo raziskovali katalizator Co-Cr-B na aktiviranem ogljiku, ki smo ga sintetizirali z metodo kemične impregnacije in precipitacije in njegovo uporabo pri katalitski hidrolizi natrijevega borhidrida (NaBH4). Material smo pripravili z različnimi razmerji Co-Cr-B / aktivnega oglja (5-20%). V procesu katalitske hidrolize NaBH4 smo preučevali učinke nekaterih parametrov, kot so koncentracija NaOH (0-5%), koncentracija NaBH4 (2,5-10%), količina katalizatorja (25-100 mg) in temperatura raztopine. Stopnja sproščenega vodika pri hidrolizi NaBH4 z uporabo katalizatorja Co-Cr-B brez nosilca je bila 6,5 Lg-1 min-1, medtem ko je bila stopnja nastajanja vodika na katalizatorju Co-Cr-B na aktiviranem ogljiku 30,2 Lg-1 min-1. V prisotnosti katalizatorja Co-Cr-B na aktiviranem ogljiku, sta bili stopnja katalize in aktivaci-jska energija hidrolize NaBH4 0,126 in 16,27 kJ/mol. Rezultati kažejo, da bi lahko katalizator Co-Cr-B na aktiviranem ogljiku uporabili za gorivne celice z membrano za izmenjavo protonov (PEMFC).
DOI: I0.i7344/acsi.20i8.4i59	Acta Chim. Slov. 2018, 65, 416-428	©commohs
Scientific paper
Copper(II) Schiff Base Complexes with Catalyst Property: Experimental, Theoretical, Thermodynamic and
Biological Studies
Sheida Esmaielzadeh1 and Elham Zarenezhad^*
1 Department of Chemistry, Darab branch, Islamic Azad University, Darab, I. R. Iran 2Non-communicable Diseases Research Center, School of Medicine, Fasa University of Medical Sciences, Fasa, Iran * Corresponding author: E-mail: el.zarenezhad.fums.@gmail.com Received: 02-01-2018
Abstract
Two novel copper(II) Schiff base complexes were synthesized and characterized by various physico-chemical and spectroscopic methods, revealing a distorted square planar geometry around the copper atom. The analytical data confirmed the 1:1 metal to ligand stoichiometry of the complexes. B3LYP/(LANL2DZ/6-311G**) density functional theory (DFT) were used to investigate structural and electronic properties of the synthesized compounds in gas phase. The computational results support the conclusion obtained by the experimental studies. Thermodynamic study of complex formation in solution was carried out spectrophotometrically at 25 °C. These compounds were also subjected to study in vitro antibacterial screening against some bacteria. Also, click reaction was investigated for its catalytic properties. The synthesized Schiff base copper complexes catalyzed 1,3-dipolar Huisgen cycloaddition of different functionalized p-azido alcohols and alkynes in the presence of ascorbic acid in a solution of THF/H2O (2:1, V/V) at room temperature.
Keywords: Copper complex; catalytic activity; antibacterial screening; formation constant; DFT calculations
1. Introduction
Schiff bases are an important class of compounds in inorganic chemistry. Research on these compounds has expanded very rapidly over the time and covered several applicative domains. Schiff base ligands and their metal complexes have been employed in areas that include analytical and bioinorganic chemistry, non-linear optics, fluorescence studies, agricultural, pharmaceutical and chemical industries and materials chemistry.1-5 Beside the broad range of applications of Schiff base compounds in different field, the metal complexes of Schiff bases are widely used as homogenous and heterogeneous catalyst in reaction.6-8 In recent years, the development of efficient new catalysts for several organic reactions like carbonylation, hydroformylation, reduction, oxidation, epoxidation, hydrolysis have received considerable attention as well as for the use as corrosion inhibitors.9-12 Among the transition metals, copper has proved to be particularly useful for catalytic applications. Schiff base copper complexes with various types of ligands have shown to possess effective catalytic ability.13-15
Based on the above catalytic activity importance of Schiff base complexes and in continuation of our recent
work16-19 on the Schiff base complexes, in the current investigation, two copper(II) complexes with NNOS coordination sphere have been synthesized and characterized. Catalytic potential have also been explored. The coordination behaviors of the ligands and their complexes, molecular parameter, spectral properties, relative energy and molecular orbital diagrams of all synthesized compounds have been calculated and interpreted with density functional theory (DFT). The antibacterial properties of the compounds against selected kinds of bacteria were also screened and discussed. The thermodynamic parameters of 1:1 complex formation in DMF solvent were determined spectrophotometrically at 25 °C. Due of our interest in the chemistry of azole derivatives20-22 we report a new catalyst system based on CuII and ascorbic acid as reducing agent for regioselective 1,3-dipolar Huisgen cycloaddition reaction to access diverse 1,2,3-triazole cores. 1,2,3-Triazole moieties are attractive compounds in medicinal chemistry because of their wide range of applications including use as HIV protease inhibitors, as well as anticancer, anti-tuberculosis, antifungal and antibacterial
agents.23
2. Experimental 2.1. Instruments and Starting Materials
All chemicals were purchased from Fluka and Merck and were used without further purification. Solvents were purified by standard procedures and stored over 3A molecular sieves. Reactions were followed by TLC using SILG/UV 254 silica-gel plates. Column chromatography was performed on silica gel 60 (0.063-0.200 mm, 70-230 mesh; ASTM).
The electronic absorption spectra were measured on Perkin Elmer (LAMBDA 2) double beam spectrophotometer in the range of 250-700 nm in DMF solution at room temperature. The infrared spectra were determined by using KBr pressed disc method on a Shimadzu FTIR 8300 FT-IR spectrophotometer in the 4000-350 cm-1 region. Melting points were recorded on open capillaries with electronic melting point and are uncorrected. The percentages of C, H, N and S in synthesized compounds were obtained with a Termo Fininngan-Flash-1200 microanalysis instrument. Mass spectrum performed with Perkin Elmer R MU-6E instrument. The magnetic susceptibilites of the copper complexes were carried out on Sherwood scientific magnetic susceptibility balance calibrated with Hg-Co(NCS)4. Diamagnetic corrections were calculated from Pascals constants. Molar conductance values (1 x 10-3 M) in DMF solution were determined by means of a Jenway 4310 conductivity meter and a diptype cell with a platinized electrode at room temperature. 1H and 13C NMR spectra were obtained using a Bruker Avance-DPX-400 spectrometer operating at 400/100 MHz, respectively.
2. 2. Synthesis of the Ligand
Methyl 2- ((1 -aminopropan- 2-yl) amino) cyclopent-1 -enedithioate and two Schiff base ligands methyl 2-((1-((2-hydroxy-5-methoxybenzylidene)amino)propan-2-yl) amino)cyclopent-1-enecarbodithioate, H2L1, and methyl 2-((1-((2-hydroxy-5-nitrobenzylidene)amino)propan-2-yl)amino)cyclopent-1-enecarbodithioate, H2L2, were synthesized according to the previously published proce-
dure.17
H2L1:Yield: 83%; m.p.: 152°C. 1H NMR (5, ppm, 400 MHz, CDCl3): 1.39 (3H, d, Me), 1.74 (2H, m, H4'), 2.56 (3H, s, SCH3), 2.68-2.72 (4H, m, H3',5'), 3.52-3.55 (3H, m, Hen), 3.77 (3H, s, OCH3), 6.73 (1H, s, H6), 6.86 (1H, d, H4), 7.24 (1H, d, H3), 8.28 (1H, s, CH=N), 12.37 (1H, br, NH) and 12.45 (1H, br, OH). MS Spectra: m/z (%) = 365 [M+H]+, 364 [M]+, 287, 186, 166, 150, 123, 97, 81, 57. Elemental Anal.: Found (Calc): C18H24N2O2S2 , C: 59.07 (59.31); H: 6.75 (6.64); N: 7.84 (7.69); S: 17.32 (17.59%).
H2L2: Yield: 93%; m.p.: 152°C. 1H NMR (5, ppm, 400 MHz, CDCl3): 1.43 (3H, d, Me), 1.79 (2H, m, H4'), 2.55 (3H, s, SCH3), 2.64 (2H, t, H3'), 2.68 (2H, t, H5'), 3.61-3.66 (3H, m, Hen), 6.99 (1H, d, H3), 8.20-8.23 (2H, m, H4,6), 8.46 (1H, s, CH=N), 12.30 (1H, br, NH) and 14.06 (1H, br,
OH). MS Spectra: m/z (%) = 380 [M+H]+, 379 [M]+, 368, 257, 236, 121, 111, 83, 58. Elemental Anal.: Found (Calc): C17H21N3O3S2, C: 53.98 (53.81); H: 5.41 (5.58); N: 11.03 (11.07); S: 16.71 (16.90%).
2. 3. Synthesis of the Copper(II) Complexes
The Cu(II) Schiff base complexes were synthesized by the addition of 10 mL of ethanolic solution of Cu(II) acetate (1 mmol) dropwise to 10 mL methanol/chloroform (1:2 v:v) of Schiff base ligand (1 mmol) in a round bottom flask. The mixture was stirred on ice bath for 2-3h. The complex was filtered and washed several times with distilled water. The obtained brown complexes were dried at room temperature. The purity was checked by thin layer chromatography. In spite of all the efforts, single crystal of these complexes could not be crystallized.
[CuL1]: Yield: 81%, m.p.: 209 °C. AM = (10-3M, in DMF, ohm-1 Cm2 mol-1): 8.26; ^eff: 1.76. MS Spectra: m/z (%) = 426 [M]+, 369, 312, 284, 250, 239, 199, 184, 130, 85, 55. Elemental Anal.: Found (Calc): C18H22N2O2S2Cu, C: 50.82 (50.74); H: 5.06 (5.20); N: 6.33 (6.58); S: 14.82 (15.05%).
[CuL2]: Yield: 96%, m.p.: 239 °C. AM = (10-3 M, in DMF, ohm-1 Cm2 mol-1): 7.94. ^eff: 1.75. MS Spectra: m/z (%) = 442 [M+H]+, 441 [M]+, 395, 380, 373, 290, 267, 159, 111, 69. Elemental Anal.: Found (Calc): C17H19N3O3S2Cu, C: 46.02 (46.30); H: 4.35 (4.34); N: 9.77 (9.53); S: 14.62 (14.54%).
2. 4. Catalytic Activity Interpretation
2. 4. 1. General Procedure for Synthesis of Propargyl aryl (2d, 2e)
For synthesis of propargyl aryl such as 2d, 2e24,25, a mixture of phenol or 4-bromophenol (1 mmol), KOH (1.2 mmol) and propargyl bromide (1 mmol) in acetone (10 mL) was heated in a round-bottomed flask for 4 h (TLC control). The solvent was then evaporated and dried to afford (ethynyloxy methyl benzene) and (1-bromo-4-(ethy-nyloxy methyl benzene)) compounds which was used in the next step without further purification.
2. 4. 2. General Procedure for Catalytic Test
1 mmol of a-haloketone or alkyl halide, alkyne (1 mmol), sodium azide (1.1 mmol), and water (1 mL)/THF (9 mL) were stirred under reflux for the required time according to Table 3 in the presence of the catalyst (1 mol%). The progress of the reaction was monitored by TLC («-hexane:ethyl acetate = 5:1), and after the completion of the reaction, the remaining suspension was dissolved in CHCl3 (100 mL) and subsequently washed with water (2 x 100 mL). The organic layer was dried (Na2SO4) and evaporated. The crude product was purified by column chro-matography on silica gel and eluted with proper solvents.
Characterization data of two new synthesized compounds (4m, 4n) are described below.
(4m): 1-(4-bromophenyl)-2-(4-(phenoxymethyl)-1H-1, 2,3-triazol-1-yl)ethanone
Column chromatography on silica gel (EtOAc/«-hexane = 2:1) afforded the product as a yellow product; yield: 89%. 1H NMR (S, ppm, 400 MHz, CDCl3): 5.15 (2H, s, CH2-N), 5.80 (2H, s, CH2-O), 6.71-8.03 (11H, m, arom, H-tri-azole). 13C NMR (S, ppm, 100 MHz, CDCl3): 115.6, 127.1, 127.7, 128.2, 129.8, 131.3, 132.8, 133.7, 156.2, 166.7, 189.0. IR (KBr, cm-1): 3069, 2860, 1725, 1341 (C=N), 1466, 1263. Elemental Anal.: Found (Calc): C17H14N3O2Br, C: 54.80 (54.86); H: 3.83 (3.79); N: 11.25 (11.29).
(4n): 2-(4-(phenoxymethyl)-1H-1,2,3-triazol-1-yl)-1-phenylethanone
Column chromatography on silica gel (EtOAc/«-hexane = 2:1) afforded the product as a yellow product; yield: 83%. 1H NMR (S, ppm, 400 MHz, CDCl3): 5.15 (2H, s, CH2-N), 5.80 (2H, s, CH2-O), 6.80-7.93 (11H, m, arom, H-tri-azole). 13C NMR (S, ppm, 100 MHz, CDCl3): 54.4, 61.1, 112.4, 115.6, 124.9, 127.1, 128.2, 131.3, 132.8, 133.7, 156.3, 168.4, 189.0. IR (KBr, cm-1): 3059, 2924, 1695, 1669, 1489, 1220. Elemental Anal.: Found (Calc): C17H15N3O2: C: 69.62 (69.61); H: 5.18 (5.16); N: 14.30 (14.33).
2. 5. Details of Calculations
The geometry optimization of the Schiff base ligands and their complexes were performed by using the gradient-corrected density functional theory (DFT) method with B3LYP functional.26 All elements except Cu were assigned 6-311G** basis set.27 LANL2DZ with effective core potential for Cu were used.28 The IR frequencies were calculated at the same level of theory with the key word freq
for the optimized structure in order to confirm structure minima without any imaginary. On the basis of calculations the structure properties, the relative stability, HOMO and LUMO energies and the chemical hardness, Mulliken atomic charges and UV data have been discussed in details. In addition, a comparison was made between the theoretical calculated IR and UV data and the experimental measured. The Gaussian 03 package29 with the aid of the Gauss View was employed to obtain the optimized the structures and all the calculations.
2. 6. Antibacterial Assay
The antibacterial activity of the Schiff base ligands and their Cu11 complexes against different the bacterial species such as Staphylococcus aureus (Gram positive bacteria) and Escherichia coli (Gram negative bacteria) were determined by reported disk diffusion method30,31 using nutrient agar as the medium. Tetracycline was used as standard reference. The stock solution of test compounds were dissolved in dry dimethylsulfuxide (DMSO exhibited no antibacterial activity against the test bacterial pathogens) to get concentration of 1.00 mg/mL. 100 ^L of test bacteria spore suspension was spread on nutrient agar plates. Appropriate well were impregnated be equal volume from the test solution of compounds and carefully placed on agar surface. The plates were incubated for 24 h at 37°C. The antibacterial activity was evaluated by measuring the clear zone surround of growth inhibition.
3. Result and Discussion
The chemical equations concerning the formation of the Schiff base complexes are schematically represented in Scheme 1.
3. 1. Experimental Results 3. 1. 1. Spectral Properties
The elemental analysis, IR and UV-Vis data and the physical properties such as melting points, yields, magnetic susceptibility of the ligands and their complexes were presented in the experimental section and in Tables 1 and
2.	These data showed that the complexes has stoichiometry of the type [ML] where M = Cu and L = Schiff base ligands. All synthesized compounds are stable at room temperature, but decompose on heating. All compounds are insoluble in water but they are readily soluble in DMF, acetoni-trile, DMSO and partially soluble in ethanol. The measured molar conductance values in DMF are too low indicating their nonelectrolytic nature of complexes.5,32
3.	1. 1. 1. The Characteristic IR Bands
The IR spectra of Schiff base ligands and their complexes were recorded and their comparative study provides meaningful information regarding the bonding sites of the ligands (see Table 1). The broad band at 3066 and 3413 cm-1 was assigned to the free v(OH) stretching modes in the spectra of Schiff ligands, but in their Cu(II) complexes this band were not observed, suggesting the chelation of the phenolic oxygen to the copper ion.33 The band present in the region 2920-2951 cm-1 is elated to aliphatic and aromatic C-H stretching vibrations.34 The ligands exhibit imine v(C=N) stretching around 1600 cm-1. Actually, this strong absorption band was shifted to lower wave numbers (bathochromic shift) in the complexes, indicating the participation of azomethine nitrogen in binding with metal ion.35,36 The band observed at around 1440 cm-1 corresponds to the aromatic C=C stretching vibration.37 Coordination of the Schiff base to the Cu(II) ion through the carbonyl oxygen atom is expected to decrease the electron density in the carbonyl group frequency. The band due to v(C-O) showed a modest decrease in the stretching frequency for the complexes and is shifted to lower frequencies after complexation, indicating the coordination of the carbonyl oxygen atom.38 A medium to strong intensity band located at 1157, 783 and 1099, 752 cm-1 in the H2L1 and H2L2 ligands are attributed to the stretching mode of the v(CS+CN) and (C=S), respectively.
Table 2. Experimental electronic spectral data and their assignment of the compounds in DMF
Compounds	X (nm)	Assignment
H2L1	314, 398	n ■ n*, n ■ n*
h2l2	313, 398	n ■ n*, n ■ n*
[CuL1]	328, 378	n ■ n*, LMCT
[CuL2]	332,370	n ■ n*, LMCT
These band was shifted to lower frequency after complexation, due to coordination with the sulfur atom of the C=S group for all the complexes.5,17,39 The assignments of bands in the far-IR region are useful as direct information about the metal-ligand coordination bond. The new weak intensity band in the spectra of the CuII complexes in the region 538-546 cm-1 and 443-459 cm-1 are attributed to v(Cu-O) and v(Cu-N) bonds, respectively.9,40,41 Furthermore, The IR spectra bands at 1332 and 1550 cm-1 observed in H2L2 compound are assigned to vs(NO2), vas(NO2) respectively, these absorption bands remained almost at the same position in the [CuL2] complex, indicating that nitro group is not involved in coordination.17,18
3. 1. 1. 2. Electronic Spectra
The electronic spectra of the synthesized compounds were investigated in DMF solvent (1 x 10-4 M) at room temperature. This technique also confirmed the formation of the ligand and its metal complexes. The Schiff base lig-ands exhibit a relatively intense intraligand absorption bands. The first intense absorption peak is centered at 395 and 398 nm for H2L1 and H2L2, respectively, and corresponds to the n — n* transition of imine chromofore, while the last peak in high energy (316 for H2L1 and 313 nm for H2L2) is attributed to the n — n* transition of the aromatic ring, respectively8,42,43 (See Table 2).
After complexation, a red shift is observed for n — n* transition. The n — n* transition disappeares in the spectrum of the complexes due to the coordination of the azomethine nitrogen atom (nitrogen lone pair donation) to the metal ion.33,44 The absorption maximum at 378 and 370 nm which could be assigned to ligand to metal charge
Table 1. Some selected experimental and computed IR vibrational modes (cm 1) of the Schiff base ligands and their copper complexes
compounds		u(Cu-N)	(Cu-O)	u(C=S)	u(C-S+ C-N)	u(C-O)	u(C=C)	u(C=N) u(C-H)		u(O-H)	v(NO2)
Experimental	H2L1	-	-	783	1157	1276	1481	1635	2920	3413	-
frequencies	H2L2	-	-	752	1099	1266	1477	1649	2938	3066	1332,1550
	[CuL1]	443	546	756	1145	1267	1461	1612	2947	-	-
	[CuL2]	459	538	740	1090	1220	1453	1610	2951	-	1335,1548
Calculated	H2L1	-	-	730	-	1260	1468	1653	3041	3410	
frequencies	H2L2	-	-	775	-	1283	1477	1668	2037	3455	1343, 1519
	[CuL1]	470	555	721	-	1277	1434	1636	3080	-	
	[CuL2]	472	581	743	-	1266	1460	1646	3102	-	1345,1540
transfer (S — Cu11 LMCT). The positions of these bands are similar to those observed for square planar copper(II) complexes.18,19,45
3. 1. 1. 3. Mass Spectra Study of the Synthesized Compounds
The mass spectrum of the Schiff base ligands and their copper(II) complexes were recorded. This technique provided strong evidence for the formation of compounds. These spectra show a molecular ion peaks M+ at m/z 364, 379, 426 and 441 which are in agreement with the empiri-
cal molecular formula C18H24N2O2S2,
C17H21N3O3S2>
C18H22N2O2S2Cu and C17H19N3O3S2Cu, respectively, suggested from elemental analysis.
3. 1. 1. 4. Magnetic Susceptibility Measurement
Magnetic moment was measured at room temperature for the CuII complexes. The complexes show the magnetic moment values at 1.75 and 1.76 B.M. corresponding to one unpaired electron with a very slight orbital contribution are quite close to 1.77 B.M. expected for a S = V as mostly seen for a d9 system, the magnetic moment values reveals that the titled complexes is monomeric in nature without any of metal-metal interaction.5,38 The proposed geometry of the copper(II) complexes is a distorted square
planar.45
The spectral data are very helpful in supporting the proposed tetradentate Schiff base complex structure and coordination pattern in this study.
3. 1. 2. Catalytic Study
The 'click' 1,3-dipolar Huisgen cycloaddition reaction has been reported in a wide variety of copper(II) complexes. In this work, the click reaction of a-haloketones or alkyl halides (1a-i), alkynes (2a-d), and sodium azide in water were performed in the presence of two different [CuL1] and [CuL2] catalysts (Scheme 2).
Using this methodology only one of possible regioiso-mers was formed (Table 3). Thirteen of the synthesized products 3a-n were known compounds and their identity was confirmed by a comparison of their melting point and their spectral properties with literature data (Table 3). Two products 3m and 3n are new, and they were characterized by IR, 1H NMR and 13C NMR spectral data and elemental analysis. The yield and reaction time of the synthesized compounds 3m and 3n are presented in Table 3. Based on the results, the reaction yields with [CuL2] catalyst is generally higher than [CuL1] catalyst. Also, the catalyst [CuL2] required shorter reaction times than catalyst [CuL1]. Various alkyl, benzyl and benzoyl halides with both electron-donating and -withdrawing substituents were subjected to the same reaction conditions as 3 to furnish the corresponding 1,2,3-triazole derivatives.
3. 1. 3. The Formation Constant Interpretation
Formation constants and thermodynamic parameters are very useful tools for the investigation of interactions between donor and acceptor species and equilibria in solution. In this work, we measured the formation constants of the complexation by UV-Vis spectrophotometric method through titration of a fixed concentration of the ligands (5 x 10-5 M) as a donor with one to ten-fold excess of copper acetate (10-4 - 10-5 M) as an acceptor at 25 °C in DMF. The absorption measurements were recorded in the range 250700 nm about 5 min after each addition. The formed complex exhibited different absorption from the free ligand, while the CuII ion solution showed no absorption at these wavelengths. As an example, the variation of the electronic spectra for H2L1 titrated with various concentration of CuII acetate is shown in Figure 1. By the addition of Cu11 solution to a solution of H2L1 ligand, the original band of H2L1 at Amax = 314 nm was weakened and a new intense band appeared at Amax = 376 nm) for the [CuL1] complex. Isosbestic points suggest that there are only two species in equilibrium.
Scheme 2. Synthetic route of Huisgen cycloaddition reaction by the new Cun complexes catalyst.
Table 3. The cycloaddition reaction with copper(II) Schiff base complexes catalyst.
Entry
Bromo keton or Alkyl Halid (1)
Acetylens (2)	Product (3)
Time/ (min) cat1 cat2
GC Yelid cat1 cat2
m.p. °C (lit) [ref]
O
V^Br
1a
2a
60
3a
80
81
90
113-115 (116) [25]
ch3i 1b

128
120
75
92
122-125 (125) [25]
Br
40
35
90
95 128-130 (129) [24]
Br

60
42
81
92
111-112 (110 [24]
CI
Me
Me
50
3e
33
78
82
155-157 (156) [24]
20
3f
10
84
92 171-172 (169) [25]
30
XJ 3a
20
80
89 155-157 (159) [25]
CI
55
)
32
86
92
105-108 (107) [25]
110-113 (115) [25]
182 [this work]
1
2
3
5
6
7
8
9
The complex formation constant were calculated using the SQUAD computer program,46 designed to calculate the best value for the formation constant by employing
a non-linear, least square approach. Also, the free energy change, AG°, for the formed complexes were determined by AG° = -.RTlnKf at 25 °C where Kf is the complex forma-
tion constant, R is the gas constant and T is the temperature in the Kelvin scale (Table 4). The electronic effect of the para substituted Schiff base ligand plays important role in stability and reactivity of their complexes. The methoxy group is an electron donating group (EDG) or electron releasing group (ERG) that donates some of its electron density into a conjugated n-system via resonance or inductive effects, thus making the Schiff base ligand H2L1 more nu-cleophilic, so the interaction of this ligand results in the formation of the charge transfer complex in which a negatively charged acceptor and positively charged donor interact electrostatically and increase the formation constants. On the other hand, NO2 substituent an electron withdrawing group (EWG) will have the opposite effect on nucleophilicity as an EDG, as it removed electron density from a n-system making the Schiff base ligand H2L2 more electrophilic. The acceptor property of the Schiff base li-gand is increased by decreasing the electron donating properties of the NO2 group and therefore leads to decrease the formation constants of the copper(II) complex. Therefore, the formation constant and the free energy data for [CuL1] are larger than those for [CuL2] (see Table 4).
Figure 1. The variation of the electronic spectra of H2L' with Cu(II) acetate in DMF.
Table 4. The result of formation constants and the free energy values for the complexes
Complexes	logKf	AG° (kJ mol1)
[CuL1]	5.88(0.10)a	-33.55(0.24)
[CuL2]	4.36(0.13)	-24.86(0.32)
a The numbers in parentheses are the standard deviations.
3. 1. 4. Antibacterial Activity
The results concerning in vitro antibacterial investigation of the Schiff base ligands and their copper(II) complexes (Table 5) show a remarkable inhibitor activity against pathogenic bacterial species of Gram positive and Gram negative bacteria. From comparison of observed data (Table 5), it is clear that the inhibition by the com-
plexes is higher than that of corresponding ligands. This may be explained by the chelation theory.47,48 On one hand, chelation will reduced the polarity of the metal center because of overlap of the ligand orbital and partial sharing of positive charge of the metal atoms with donor atom present on the ligand. This fact leads to the increase in n-electron delocalization over the whole chelating ring. On the other hand, the chelation will enhanced the lipo-philic character of the complexes. This, in turn, increase the diffusion of the complex through the lipid layer of the cell membranes and blocks the metal binding sites in the enzymes of bacteria.49,50
Inhibitory activity of the complexes is a follows [CuL2] > [CuL1]. The activity depends on the properties of OMe group as electron releasing group and NO2 as electron withdrawing group on phenyl ring. This can be explained on basis of n-electron delocalization in chelating group as discussed above.
Table 5. Antibacterial screening results
compounds	E. coli	S. aureus
	Diameter of inhibition zone (mm)	
H2L1	20	21
H2L2	18	20
[CuL1]	29	26
[CuL2]	25	23
tetracycline	32	34
3. 2. Computational Results
3. 2. 1. Description of the Optimized Structures
Molecular structure and atom notation of the compounds with selected bond distances and angles are shown in Figure 2 and Table 6. The Schiff base ligands are coordinated to the metal core through the amine nitrogen (N1), azomethine nitrogen atom (N2), phenolic oxygen atom (O1) and thio sulfur atom (S2). The Cu1-N2, Cu1-N1, Cu1-O1 and Cu1-S2 bond distance in [CuL1] and [CuL2] are 1.966, 1.960, 1.908, 2.346 A and 1.958, 1.968, 1.926, 2.332 A, respectively. All bond distances are in good agreement with those reported in other similar tetradentate Schiff base complexes.18,51 The calculated C10-N1 and C3-N2 bond length in the complexes are close to the value for a double bond, like in similar Schiff base complexes.16 Compared with the ligand, most of bonds show elongation upon complexation with the metal ion. C10-N1, C3-N2, C15-S2 and C6-O1 bond lengths become longer in both complexes in qualitative agreement with expectation. This finding is due to the formation of Cu1-N1, Cu1-N2, Cu1-O1 and Cu1-S2 bonds which make the C10-N1, C3-N2, C6-O1 and C15-S2 bonds weaker.52 The high negative atom charge of imine nitrogen atoms (N1, N2), the phenolic oxygen atome (O1) and thio sulfur (S2) is: -0.456,
-0.441, -0.688, -0.179 for H^1 and -0.455, -0.436, -0.659, -0.171 for H2L2, respectively. These data suggest that the O1 atom donates more electron density to the copper ion leading to strong Cu1-O1 bonding. This idea corroborated by the short Cu1-O1 bond length in comparison to those of Cu1-N1, Cu1-N2 and Cu1-S2.53
According to calculated results, the angles around the metal center for [CuL1] and [CuL2] N1-Cu1-O1 (172.74°, 172.94°), N2-Cu1-S2 (171.85°, 171.68°), N1-Cu1-S2
(90.78°, 91.33°) and N2-Cu1-O1 (90.71°, 91.43°) suggest distorted square planar geometry of the complexes. The dihedral angle between the phenyl and chelated ring is in the range 2.9-4.5° (see Table 6) which indicates the resonance between phenyl groups with the n-electron system of the chelating ring.
There is a good agreement between the bond distance, bond angles and dihedral angles of the solid structure in similar compounds19,51 and gas phase calculated values. It
Figure 2. DFT optimized geometry of the (a) H2L\ (b) H2L2, (c) [CuL1], (d) [CuL2] with labeling atoms (hydrogen atoms in both complexes have been omitted for clarity).
Table 6. Some selected optimized bond lengths and bond angles of the Schiff base ligands and its complexes
		Band length (Â)				Bond	angle (o)	
	Ligands			Complexes		Complexes		
	h2L'	H2L2		CuL1	CuL2		CuL1	CuL2
N2-C3	1.283	1.281	N2-C3	1.305	1.300	N1-Cu-N2	86.508	86.587
N1-C10	1.325	1.326	N1-C10	1.339	1.340	N1-Cu-O1	172.947	172.744
C6-O1	1.327	1.311	C6-O1	1.392	1.376	N1-Cu-S2	90.781	91.330
C15-S2	1.741	1.740	C15-S2	1.762	1.764	N2-Cu-O1	91.432	90.713
C7-O2	1.396	-	C7-O2	1.404	-	N2-Cu-S2	171.692	171.851
C7-N3	-	1.457	C7-N3	-	1.446	O1-Cu-S2	87.211	87.258
O1-H8	0.973	0.974	Cu1-N1	1.966	1.968	O1-C6-C4-C3	0.24046	0.36152
N1-H15	1.024	1.024	Cu1-N2	1.960	1.958	N2-C3-C4-C6	1.18439	1.25585
			Cu1-O1	1.908	1.916	N1-C10-C11-C15	4.27604	4.35552
			Cu1-S2	2.346	2.332	S2-C15-C11-C10	3.04373	2.91583
should be noted that some differences are due to the X-ray crystal diffraction being applied in the solid phase, while theoretical calculations were carried out in the gas phase.10,54
Careful analysis of the bond lengths and bond angles data leads to the conclusion that Cu complex has a distorted square planar coordination around the Cu11 center.
3. 2. 2. Details of Frontier Molecular Orbital Analysis
The HOMO and LUMO molecular orbitals which are called the frontier orbitals and energy level of all mentioned compounds in this study was done using B3LYP/ (LANL2DZ/6-311G**) methods. 3D plots of the frontier orbital shapes and their corresponding energy levels are depicted in Figure 3 and Table 7. The EHOMo and ELUMO for all compounds are negative indicating molecules are stable. The plots of HOMO and LUMO orbitals of the ligands show the HOMO surface is mainly located on the cyclo-
pentene ring whereas the LUMO surface is mostly composed on the phenolic aromatic ring.55 This LUMO surface is overlapped with C15-S2 and C3-N2 group.
The computed frontier gap (EHOMo - ELUMO) is very useful indicator in presenting the factors influencing the stability of these compounds. Taking this fact into the consideration, the energy gap levels for the compounds were computed (Table 7). The calculated Eg for the ligands is smaller than their complexes, indicating that the ligands are reactive and kinetically unstable. Since the ligand is more polarized the amount of electron charge transfer from the ligands to the metal increase, i.e. the ligand is soft molecule and easily offer electrons to an acceptor metal centers.53,56 For [CuL2] complex, the HOMO orbital includes n(L) (87%) character from ligand heteroatom along with minor contribution of dn(Cu) orbital (13%). This orbital has n-bonding nature which is concentrated on the chelated ligand. The LUMO orbital has 68% n*(L) character and significant contribution (32%) of dn(Cu) orbital. The analysis of molecular orbitals for [CuL2] complex is
a)
b)
c)
d)

a
&
w
* * •
f-4. phC
«4 •
j *
v ^


to*.
j¿fr
%tU.
%
m* •
1*9
V
* y \

Figure 3. The HOMO (left) and LUMO (right) frontier orbitals views of (a) H2L\ (b) H2L2, (c) [CuL1], (d) [CuL2]
more or less the same as for [CuL1] complex. The calculated Eg level for the complexe show the Eg [CuL1] complex is larger than that [CuL2] complex indicating the chemical reactivity of the [CuL1] decrease and the complex is more stable. This results support the experimental formation constant.
3. 2. 4. Theoretical Study of Hardness, Mulliken Charges and Dipole Moment
To rationalize the relative stability and reactivity of chemical compounds the chemical hardness is useful parameter. The hardness q was calculated from - EA) equation, where IE and EA are the ionization energy and
Table 7. Some of calculated structural parameters for the Schiff base ligand and their Cu(II) complexes
Complexes	HOMO/eV	LUMO/eV	gap/eV	Hardness (n)	Dipole/Debye	HF energy (a.u.)
H2L1	-5.417	-3.298	2.119	1.059	3.169	-1756.632
H2L2	-5.526	-3.264	2.262	1.131	3.182	-1846.602
[CuL1]	-5.281	-1.633	3.648	1.824	5.865	-3395.988
[CuL2]	-5.852	-2.613	3.239	1.615	5.860	-3485.966
3. 2. 3. Theoretical Study of Vibration Mode
Vibrational frequency calculations were performed on the optimized structures of the complexes to search for the imaginary frequency and obtain the vibrational frequencies of compounds in gas phase. Table 1 shows selected experimental and calculated IR band assignments of studied Schiff base ligands and their Cu(II) complexes. The broad band related to O-H stretching vibration of the phenolic group appears at 3410 and 3455 cm-1 in the free ligands spectrum. In the complexes, the O-H peak disappear which indicates coordination of phenolic oxygen atom to central atom.
The multiple bands at around 3000 cm-1 in the ligands and their complexes are assigned to C-H stretching vibration.
The strong bands at 1653 and 1668 cm-1 in the IR spectra of the Schiff base ligands assigned to the v(C=N) are changed by 17-22 cm-1 in the spectra of the complexes, indicating coordination of Schiff base through azome-thine nitrogen atom.
The intense band in the 1400 cm-1 region is due to the skeleton vibration mode of C=C in the free ligands and their copper(II) complexes.
The v(C-O) vibrations were found at 1260 cm-1 and 1283 cm-1 in the spectrum of the free ligands. These bands are shifted to lower or higher frequencies after complexa-tion suggesting that this group takes part in coordination. The Schiff base ligand coordination to the copper ion is substantiated by two medium intensity bands at 470 and 472 cm-1 for [CuL1] and [CuL2], respectively, attributed to v(M-N) and also at 555 and 581 cm-1 for [CuL1] and [CuL2], respectively, for v(M-O) stretching frequencies.41,57
Ssmall differences between the theoretical and experimental vibrational frequencies can be related to (i) the environmental condition (gas phase and solid state) and (ii) from the fact that the experimental values are anhar-monic frequencies while the calculated values are harmon-
electron affinity, respectively. The ionization energy and the electron affinity can be equalized through frontier orbital energies (EA = -EHOMO and IE = -ELUMO) according to the Koopman theorem.59 Therefore, for the calculation of hardness the following equation q = %(EHOMO - ELUMO) was used for all titled compounds.60 As can be seen in Table 7, the H2L2 ligand and [CuL1] complex have a higher hardness and lower chemical reactivity and higher stability than the other compounds.
Dipole moment is fundamental characteristics to explain the polarization of compounds. The experimental measurements of dipole moment are not always feasible, so we were using the density functional theory to calculate this parameter. On the basis of magnitude of dipole moments (Table 7) all studied compounds are polar. The [CuL2] complex has the smallest dipole moment; that in part explains the instability of the [CuL2] and the decrease the formation constant.
The values of the computed Mulliken net charge on non-hydrogen atoms (active centers) were investigated. Electronegativity plays important role on atomic charge distributions of the non-hydrogen atom. When two atoms are connected together, the atom having higher electronegativity will carry negative charges, while the atom having smaller electronegativity will carry positive charges. As summarized in Table 8, when the carbon is bonded to N1, N2, O1 and S2 atoms, the carbon atomic charges are positive and the most negative atomic charges are attributed to N1, N2, O1 and S2 which have higher electronegativity than the carbon. On the other hand, the results show that the most negative centers in the ligand are bonded to metal ions which carry the positive charge value (Table 8). After complexation, the charge density decrease on the donating atom indicating that the metal ions received the electron density from their surrounding donating sites with high negative charge centers of the ligand. The calculated net charge of the complexes were compared with that free Schiff base ligand in order to show the donating sites in the ligand involved in the chelation and support one of our original ideas of the synthesis.
Table 8. Selected values for the Mulliken charge distributions for non-hydrogen atoms
Compounds Charge	H2L1	H2L2	[CuL1]	[CuL2]
Cu1	-	-	1.15996	1.15719
N1	-0.45654	-0.45576	-0.39787	-0.30551
N2	-0.44166	-0.43669	-0.43459	-0.42802
S2	-0.17963	-0.17113	-0.14996	-0.13995
O1	-0.68843	-0.65924	-0.37940	-0.36719
C1	0.19197	0.08296	0.12969	0.13045
C2	0.14316	0.19723	0.17083	0.17661
C3	0.20375	0.03683	0.17469	0.18212
C6	0.27879	0.29780	0.38667	0.41059
C7	0.24649	0.26943	0.21392	0.23924
C10	0.45997	0.46642	0.37940	0.38437
C11	0.22702	0.22699	0.24055	0.24050
C15	0.48696	0.61489	0.49136	0.49244
4. Conclusion
The present study describes the synthesis and characterization of some Schiff base ligands and their Cu11 complexes. From the IR and UV-Vis spectra it may be concluded the Schiff base ligand acts as a chelating to the metal ion and bind through nitrogen atoms of the azomethine and amine groups, phenolic oxygen atom and sulfur atom of the C=S group. The stability constant and Gibbs free energy calculations show that the [CuL1] complex is more stable than [CuL2] complex. The present computational study allows us to obtain optimized structure, molecular parameters, highest occupied molecular orbital energy, lowest unoccupied molecular orbital energy, HOMO-LUMO band gap, IR vibrational frequencies, characteristics of all synthesized compounds. In general a good agreement was found between the theoretical and experimental data. The titled compounds in this study were tasted against two pathogenic bacteria in order to assess their antibacterial properties. The results revealed that the complexes possess higher antibacterial activity as free Schiff base ligands. Both complexes are effective catalysts for the cyclization reactions. The percentage product of reactions show [CuL2] complex being more active then [CuL1] complex.
5. Acknowledgements
We are grateful to Islamic Azad University, Darab branch Council for their financial support.
6. References
1. Y. W. Dong, R. Q. Fan, W. Chen, H. J. Zhang, Y. Song, X. Du, P. Wang, L. G. Wei, Y. L. Yong. Dalton Trans. 2017, 46, 1266-
1276. DOI:10.1039/C6DT04159K
2.	J. Kumar, A. Rai, V. Raj, Org. Med. Chem. Int. J. 2017, 1, 1-15.
3.	M. L. Low, L. Maigre, M. I. M. Tahir, E. R. T. Tiekink, P. Dor-let, R. Guillot, T. B. Ravoof, R. Rosli, J. M. Pages, C. Policar, N. Delsuc, K. A. Crouse, Eur. J. Med. Chem. 2016, 120, 1-12. DOI:10.1016/j.ejmech.2016.04.027
4.	A. B. Gündüzalp, 1. Özsen, H. Alyar, S. Alyar, N. Özbek, J. Mol. Struct. 2016, 20, 259-266.
DOI: 10.1016/j.molstruc.2016.05.002
5.	H. G. Sogukömerogullari, T. Taskin Tok, F. Yilmaz, L. Berber, M. Sonmez, Turk. J. Chem. 2015, 39, 497-509. DOI:10.3906/kim-1412-81
6.	Y. Mei Yu, K. Li, Y. Wang, Z. J. Yao, Polymers 2017, 9, 105-115. DOI:10.3390/polym9030105
7.	A. Ourari, D. Aggoun, L. Ouahab, Inorg. Chem. Commun. 2013, 33, 118-124. DOI:10.1016/j.inoche.2013.04.002
8.	A. Kareem, M. Arshad, Sh. A. A. Nami, N. Nishat, J. Photo-chem. Photobiol. Biol. 2016, 160, 163-171.
DOI: 10.1016/j.jphotobiol.2016.03.030
9.	I. R. Parrey, A. A. Hashmi, Canadian. Chem. Trans. 2015, 3, 65-71.
10.	Z. Asgharpour, F. Farzaneh, A. Abbasi, M. Ghiasi, Polyhedron 2015, 101, 282-289. DOI:10.1016/j.poly.2015.09.030
11.	K. H. Yang, Acta. Chim. Slov. 2014, 61, 629-639.
12.	M. Mishra, K. Tiwari, P. Mourya, M. M. Singh. V. P. Singh, Polyhedron 2015, 89, 29-38. DOI:10.1016/j.poly.2015.01.003
13.	P. Pattanayak, J. L. Pratihar, D. Patra, P. Brandäo, V. Felix, Inorg. Chim. Acta 2014, 418, 171-179. DOI:10.1016/j.ica.2014.04.021
14.	P. Drabina, J. Svoboda, M. Sedlak, Molecules 2017, 22, 865883. DOI:10.3390/molecules22060865
15.	A. Bhattacharjee, Sh. Halder, K. Ghosh, C. Rizzoli, P. Roy, New. J. Chem. 2017, 41, 5696-5706.
DOI: 10.1039/C7NJ00846E
16.	S. Esmaielzadeh, L. Azimian, Kh. Shekoohi, H. Esfandiari, M. Asadi, Z. Zare, A. Rahmani nejad, K. Mohammadi, Inorg. Chim. Acta 2013, 405, 155-162. DOI:10.1016/j.ica.2013.05.001
17.	M. Asadi, K. Mohammadi, S. Esmaielzadeh, B. Etemadi, H. K. Fun, Polyhedron 2009, 28, 1409-1418. DOI:10.1016/j.poly.2009.03.018
18.	M. Asadi, K. Mohammadi, S. Esmaielzadeh, B. Etemadi, H. K. Fun, Inorg. Chim. Acta 2009, 362, 4913-4920. DOI:10.1016/j.ica.2009.07.025
19.	S. Esmaielzadeh, L. Azimian, K. Shekoohi, K. Mohammadi, Spectrochim. Acta Part A: Mol. Biomole. Spect. 2014, 133, 579-590. DOI:10.1016/j.saa.2014.05.095
20.	S. Behrouz, M. N. Rad, S. Rostami, M. Behrouz, E. Zarehn-ezhad, A. Zarehnezhad, Mol. Divers. 2014, 18, 797-808. DOI:10.1007/s11030-014-9539-1
21.	M. N. Rad, S. Behrouz, M. Behrouz, A. Sami, M. Mardkhosh-nood, A. Zarenezhad, E. Zarenezhad, Mol. Divers. 2016, 20, 705-718. DOI:10.1007/s11030-016-9678-7
22.	E. Zarenezhad, M. N. Rad, S. Behrouz, S. Esmaielzadeh, M. Farjam, J. Iran. Chem. Soc. 2017, 14, 509-519. DOI:10.1007/s13738-016-0999-3
23.	S. G. Agalave, S. R. Maujan, V. S. Pore, Chem. Asian J. 2011, 6, 2696-2718. DOI:10.1002/asia.201100432
24.	H. Sharghi, R. Khalifeh, M. M. Doroodmand, Adv. Synth. Catal. 2009, 351, 207-218. DOI:10.1002/adsc.200800612
25.	E. Hashemi, Y. S. Beheshtiha, S. Ahmadi, M. M. Heravi, Trans. Met. Chem. 2014, 5, 593-601. DOI:10.1007/s11243-014-9838-5
26.	A. D. Becke, J. Chem. Phys. 1993, 98, 5648-5652. DOI: 10.1063/1.464913
27.	C. Lee, W. Yang, R. G. Parr, Phy. Rev. 1988, B 37, 785-789.
28.	P. J. Hay, W. R. Wadt, J. Chem. Phys. 1985, 82, 270-283. DOI: 10.1063/1.448799
29.	M. J. Frisch, G. W. Trucks, H. B. Schlegel, G. E. Scuseria, M. A. Robb, J. R. Cheeseman, J. A. Montgomery, J. T. Vreven, K. N. Kudin, J. C. Burant, J. M. Millam, S. S. Iyengar, J. Tomasi, V. Barone, B. Mennucci, M. Cossi, G. Scalmani, N. Rega, G. A. Petersson, H. Nakatsuji, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M. Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai, M. Klene, X. Li, J. E. Knox, H. P. Hratchian, J. B. Cross, C. Adamo, J. Jaramillo, R. Gomperts, R. E. Strat-mann, O. Yazyev, A. J. Austin, R. Cammi, C. Pomelli, J. W. Ochterski, P. Y. Ayala, K. Morokuma, G. A. Voth, P. Salvador, J. J. Dannenberg, V. G. Zakrzewski, S. Dapprich, A. D. Daniels, M. C. Strain, O. Farkas, D. K. Malick, A. D. Rabuck, K. Raghavachari, J. B. Foresman, J. V. Ortiz, Q. Cui, A. G. Baboul, S. Clifford, J. Cioslowski, B. B. Stefanov, G. Liu, A. Liashenko, P. Piskorz, I. Komaromi, R. L. Martin, D. J. Fox, T. Keith, M. A. Al-Laham, C.Y. Peng, A. Nanayakkara, M. Challacombe, P. M. W. Gill, B. Johnson, W. Chen, M. W. Wong, C. Gonzalez, J. A. Pople, Gaussian 03, Computer program for computational chemistry, Gaussian Inc., Pittsburgh PA, USA; 2004.
30.	A. W. Bauer, W. M. Kirby, J. C. Sherris, M. Turck, Am. J. Clin. Pathol. 1966, 45, 493-496. DOI:10.1093/ajcp/45.4_ts.493
31.	R. D. Walker, J. F. Prescott, J. D. Baggot. Antimicrobial susceptibility testing and interpretation of results, Iowa state university press, USA, 2000, pp. 12-26.
32.	D. M. Abd El-Aziz, S. E. H. Etaiw, E. A. Ali, J. Mol. Struct. 2013, 1048, 487-499. DOI:10.1016/j.molstruc.2013.05.051
33.	M. Slehi, F. Rahimifar, M. Kubicki, A. Asadi, Inorg. Chim. Acta 2016, 443, 28-35. DOI:10.1016/j.ica.2015.12.016
34.	K. Ghosh, S. Roy, A. Ghosh, A. Banerjee, A. Bauza, A. Frontera, S. Chattopadhyay, Polyhedron 2016, 112, 6-17.
DOI: 10.1016/j.poly.2016.02.035
35.	X. M. Hu, L. W. Xue, G. Q. Zhao, W. C. Yang, Bull. Chem. Soc. Ethiop. 2015, 29, 407-413. DOI:10.4314/bcse.v29i3.8
36.	A. Akbari, Z. Alinia, Turk. J. Chem. 2013, 37, 867-878. DOI:10.3906/kim-1207-74
37.	D. Sakthilatha, R. Rajavel, J. Chem. Pharm. Res. 2013, 5, 5763.
38.	A. Z. El-Sonbati, M. A. Diab, M. I. Abou-Dobara, H. A. Seyam, J. Mol. Liq. 2016, 218, 434-456. DOI:10.1016/j.molliq.2016.02.072
39.	S. Chandra, A. Rathi, J. Saudi, Chem. Soc. 2001, 5, 175-182.
40.	R. B. Sumathi, M. B. Halli, Bioinorg. Chem. App. 2014, 2014, 1-11.
41.	M. Kudrat, E. Zahan, M. S. Islam, Russ. J. Gen. Chem. 2015, 85, 979-983. DOI:10.1134/S1070363215040350
42.	Z. Asadi, M. Asadi, F. Dehghani Firuzabadi, R. Yousefi, M. Jamshidi, J. Iran. Chem. Soc. 2014, 11, 423-429. DOI:10.1007/s13738-013-0314-5
43.	D. F. Back, G. M. de Oliveira, L. A. Fontana, B. F. Romäo, D. Roman, B. A. Iylesias, J. Mol. Struct. 2015, 1100, 264-271. DOI:10.1016/j.molstruc.2015.07.050
44.	M. Asadi, Z. Asadi, N. Savaripoor, M. Dusek, V. Eigner, M. Ranjkesh, M. Sedaghat, Spectrochim. Acta Part A: Mol. Biomole. Spect. 2015, 136, 625-634. DOI:10.1016/j.saa.2014.09.076
45.	S. Basak, S. Sen, S. Mitra, C. Marschner, W. S. Sheldrick, Struct. Chem. 2008, 19, 115-121.
DOI: 10.1007/s11224-007-9260-0
46.	K. Singh, Y. Kumar, P. Puri, M. Kumar, C. Sharma, Eur. J. Med. Chem. 2012, 52, 313-321. DOI:10.1016/j.ejmech.2012.02.053
47.	D. L. Leggett. Computational Methods for the Determination of Formatioin Constant, Plenum Press, New York; 1985. DOI: 10.1007/978-1-4684-4934-1
48.	L. Dawara, R. V. Singh, Appl. Organomet. Chem. 2011, 25, 643-652.
49.	B. G. Tweedy, Phytopathology 1946, 55, 910-917.
50.	N. Batra, N. Malhotra, S. Assija, J. Chem. Pharma. Res. 2014, 6, 194-200.
51.	N. Kumar Chaudhary, P. Mishra, Am. J. Appl. Chem. 2014, 2, 19-26. DOI:10.11648/j.ajac.20140201.15
52.	G. Grivani, S. Husseinzadeh Baghan, M. Vakili, A. Dehno Khalaji, V. Tahmasebi, V. Eigner, M. Dušek, J. Mol. Struct. 2015, 1082, 91-96. DOI:10.1016/j.molstruc.2014.10.058
53.	O. A. El-Gammal, Spectrochim. Acta Part A: Mol. Biomole. Spect. 2010, 75, 533-542. DOI:10.1016/j.saa.2009.11.007
54.	A. A. Khandar, C. Cardin, S. A. Hosseini-Yazdi, J. McGrady, M. Abedi, S. A. Zarei, Y. Gan, Inorg. Chim. Acta 2010, 363, 4080-4087. DOI:10.1016/j.ica.2010.08.019
55.	Z. G. Niu, L. R. He, L. Li, W. F. Cheng, X. Y. Li, H. H. Chen, G. N. Li, Acta Chim. Slov. 2014, 61, 786-791.
56.	O. A. El-Gammal, Inorg. Chim. Acta 2015, 435, 73-81. DOI:10.1016/j.ica.2015.06.009
57.	A. Akbari, M. Jalili Rasti, Comput. Res. 2013, 1, 27-33.
58.	M. Amirnasr, M. Bagheri, H. Farrokhpour, K. J. Schenk, K. Mereiter, P. C. Ford, Polyhedron 2014, 71, 1-7. DOI:10.1016/j.poly.2013.12.040
59.	T. Koopmans, Physica 1934, 1, 104-113. DOI:10.1016/S0031-8914(34)90011-2
60.	S. Esmaielzadeh, L. Azimian, Z. Zare, Acta Chim. Slov. 2016, 63, 351-362. DOI:10.17344/acsi.2016.2335
Povzetek
Sintetizirali smo dva nova bakrova(II) kompleksa s Schiffovimi bazami in ju okarakterizirali z različnimi fizikalno-kem-ijskimi in spektroskopskimi metodami, ki razkrivajo popačeno kvadratno planarno geometrijo okoli bakrovega atoma. Analizni podatki potrjujejo stehiometrijo kovina: ligand 1:1. S teorijo gostotnostnega funkcionala (DFT) na B3LYP/ (LANL2DZ/6-311G**) nivoju smo proučili strukturne in elektronske lastnosti pripravljenih spojin v vakuumu. Kvant-no-mehanski rezultati potrjujejo zaključke dobljene na podlagi eksperimentalnih podatkov. Študij termodinamskih lastnosti tvorbe kompleksov smo izvedli spektrofotometrično pri 25°C. Pri obeh spojinah smo testirali in vitro anti-bakterijsko aktivnost. Proučili smo tudi katalitične lastnosti na primeru klik reakcij. Sintetizirana bakrova kompleksa s Schiffovimi bazami katalizirata 1,3-dipolar Huisgenovo cikloadicijo različno funkcionaliziranih p-azido alkoholov in alkinov v prisotnosti askorbinske kisline v raztopini THF/H2O (2:1, V/V) pri sobni temperaturi.
Scientific paper
Solvothermal Synthesis and Photocatalytic Activity of BiOBr Microspheres with Hierarchical Morphologies
Adriana C. Mera,1, 2* Carlos A. Rodríguez,1, 2 Héctor Valdés,3 Andres F. Jaramillo,4 David Rojas4 and Manuel F. Meléndrez4
1 Instituto de Investigación Multidisplinario en Ciencia y Tecnología, Universidad de La Serena, Benavente 980,
La Serena, Chile.
2 Laboratorio de Química Analítica e Investigación en Fotoquímica y Productos Naturales, Departamento de Química, Facultad de Ciencias, Universidad de La Serena, La Serena, Chile.
3 Universidad Católica de la Santísima Concepción, Facultad de Ingeniería, Laboratorio de Tecnologías Limpias,
Concepción, Chile.
4 Advanced Nanocomposites Research Group (GINA). Hybrid Materials Laboratory (HML). Department of Materials Engineering (DIMAT), Faculty of Engineering, University of Concepcion, 270 Edmundo Larenas, Box 160-C,
Concepcion, Chile 4070409.
* Corresponding author: E-mail: adrymera@hotmail.com, amera@userena.cl Phone: +56-51-2334881
Received: 10-01-2018
Abstract
BiOBr microspheres with hierarchical morphologies (BiOBr-MicSphe) has potential application in heterogeneous pho-tocatalysis for decontamination of water and air. For this reason, the synthesis, characterization an evaluation of photo-catalytic activity of these materials become important. In this article, BiOBr-MicSphe were synthesized using different ranges of reaction temperature (120-200 °C) and reaction time (12 h - 24 h). Samples grown at 145 °C and 18 h showed the higher photocatalytic activity on gallic acid degradation. Morphological properties, chemical composition and structural analysis revealed that sample with higher photocatalytic activity exhibited a microspherical morphology with pure BiOBr tetragonal phase. Besides, adsorption-desorption analysis showed a smaller pore diameter for sample grown at 145 °C and 18 hrs. The results showed that the reaction temperature has a strong influence on the different properties of the material, affecting the photocatalytic activity.
Keywords: BiOBr MicSphe; solvothermal; properties; photocatalytic activity
1. Introduction
Currently, wastewater treatment using new technologies such as advanced oxidation processes (AOP's) for toxic organic removal is under continuous study. The heterogeneous photocatalysis is found among the most promising and efficient AOPs to control environmental pollution, due to its demonstrated efficiency in the degradation and mineralization of a wide range of organic compounds. Heterogeneous photocatalysis is a process based on the utilization of light energy to activate a semiconductor, which modifies the rate of a chemical reaction without being involved itself. The semiconductor can be activated using artificial radiation or solar radiation.1,2 The most used semiconductor in the industry today is titanium di-
oxide (TiO2) Evonik P-25. It offers the benefits of being inert, inexpensive, stable and non-toxic.3 However, due to its wide band gap of 3.2 eV, this material can only absorb light energy in the UV region, which is only around a 5% of the solar spectrum. This makes TiO2 relatively unattractive for wastewater treatment, since it cannot be activated by natural solar radiation.4-6 TiO2 has been modified to be efficient under visible light using different strategies; however, the increases in photocatalytic efficiency is minimum.7-9 Therefore, nowadays most of research that is conducted in the field of photocatalysis, has moved to the development of new materials that are active under visible light.10,11
Recently, the family of bismuth oxyhalides (BiOX, X=Cl, Br, I) has been investigated for their photocatalytic
properties under visible radiation with favorable results.12 Among them, bismuth oxybromide (BiOBr) has shown promising results.13,15 BiOBr has exhibited greater photo-catalytic activity than the commercialized Evonik P25 under UV radiation.16
BiOBr have been previously synthetized by several methods, such as hydrolysis, hydrothermal, solvothermal, microwave, microemulsion and ionothermal.17-23 However, among all available procedures, the solvothermal method appears as one of the most promising, due to the higher photocatalytic activity of the obtained materials.24
In recent years, several authors have reported the synthesis of BiOBr microspheres by solvothermal method. In 2008 J. Zang et. al.25 grew BiOBr micropheres at 170 °C and 6 h. Samples showed a visible light induced photocat-alytic activity for the degradation of methyl orange (MO). In 2011 J. Xu et. al.,26 using solvothermal method at 180 °C and 12 h, synthesized BiOBr microspheres. The prepared BiOBr catalysts exhibited of pure tetragonal phase, which removed nearly 100 % of RhB from solution after 60 min under simulated solar light irradiation. The high photoac-tivity was attributed to its relatively large specific surface area and efficient absorption of visible light. Finally, in 2012, Y. Huo et. al.,25 reported the synthesize of BiOBr mi-crospheres at 160 °C and 12 h. The authors determine that the high photo catalytic activity of BiOBr material for rhodamine B (RhB) degradation under visible-light irradiations could be ascribed to the strong light absorbance with the light multi-reflection, the efficient separation of photo-generated electron-hole pairs, the high crystallization and the large surface area.
All these works reported the obtainment of BiOBr microspheres under single conditions; however, the influence of using different temperatures in the solvothermal synthesis on the properties and photocatalytic activity of these materials has not been reported yet. Besides, considering the high photocatalytic activity of BiOBr, it is necessary to standardize the experimental conditions (reaction temperature and reaction time) of solvothermal synthesis, to obtain a reproducible method which enables to extend the synthesis and application to an industrial scale. The interest in using this material is also because it can be obtained in the form of spheres with Hierarchical structures. These structures allow the increase of the surface area of the material, increasing the efficiency of the photocatalytic system. In this work, it is further shown that these can be obtained using temperatures below 150 °C.
The aim of this work is to determine the optimum values of temperature and reaction time for the solvother-mal synthesis of BiOBr microspheres with Hierarchical structures, to obtain the highest photocatalytic activity. The standardization of conditions (temperature and reaction time) were developed using response surface methodology (RSM).27-32 In addition, the obtained materials from standard conditions were characterized to understand the influence of the temperature and time of solvothermal
synthesis, on gallic acid photocatalytic degradation. Gallic acid (model compound) was selected as a representative phenol structure present in agro-industry wastes such as winery wastewaters.33, 34 This compound is responsible for the inhibitory effects on microbial activity in biological treatment systems, generally used for the treatment of these wastewaters. 35,36
2. Experimental
2. 1. Preparation of BiOBr Materials
BiOBr Microspheres (BiOBr-MicSphe) were obtained by solvothermal synthesis. The synthesis of materials was performed using a solution of ethylene glycol (Merck 99.5%) with concentration 0.1 M of KBr (99.0% Merck), was added to a solution of ethylene glycol with concertation 0.1 M of bismuth nitrate pentahydrate (Bi(NO3)3 x 5H2O (99.0%, Sigma-Aldrich). The mixture was stirred at room temperature and then poured into to an autoclave reactor. The reactor was heated using the experimental design displayed in Table 1. After the reaction times has elapsed, the reactor is cooled down at room temperature, for each experiment. The solids were separated by gravity filtration and washed with distilled absolute eth-anol and water. The BiOBr materials obtained were dried at 60 °C for 24 hours.
2. 2. Response Surface Modeling
The solvothermal synthesis of BiOBr was carried out with the response surface methodology (RSM) using the software MODDE 7.37-40 The multivariate analysis was a composed central circumscribed design (CCC) which is based on a factorial design of two level with 3 central points and 4-star points.27-32 The central point was coded as zero and determined in triplicate to statistically validate the determinations assuming homoscedasticity of variance.
The variables evaluated simultaneously were the temperature (ranging from 120 to 200 °C) and reaction time (from 12 to 24 hours). This procedure allows standardization of the experimental conditions (reaction time and reaction temperature) for the synthesis of BiOBr mi-crospheres by solvothermal process. The statistical validation was performed by ANOVA test with a confidence level of 95%.
2. 3. Characterization
The materials that exhibited the higher and lower photocatalytic efficiency were selected for characterization further. The morphologies of materials were observed by scanning electron microscopy (SEM, JEOL JSM-6380). Additionally, transmission electron microscopy (TEM) using a JEOL JEM 1200 EX-II. The particles size were determined by using a laser diffraction particle size analyzer
(Microtrac Model S3500). Chemical composition of the samples was measured by means of energy dispersive X-ray spectroscopy (EDS). Micromeritis TriStar II porosity analyzer measured the specific surface area (BET) and the pore size distribution of the materials. The composition of products was examined by means of X-ray diffraction (XRD) in a diffractometer Bruker D4 with X-ray source of Cu Ka (À = 1.5406 A). Thermogravimetric meas-
Figure 1. Experimental system used during the photocatalytic assays.
urement (TGA) were determined with a thermobalance model TG209 F1 Iris. Fourier transform infrared (FTIR) spectra were obtained using a Nicolet Nexeus spectrometer. UV-visible diffuse reflectance absorbance (DRS) was determined with a Perkin Elmer Precisely Lambda 35 UV/ Vis spectrophotometer.
2. 4. Photocatalytic Efficiency Measurements
The photocatalytic efficiency was evaluated on gallic acid degradation under simulated solar radiation using a xenon lamp (VIPHID 6000 k, 12 W) with spectral range between 380-900 nm.41 The tests were made in the system of Figure 1, the photocatalytic assays were done in 250 mL of acid gallic aqueous solution (20 mg L-1) adding 0.025 g of the photocatalyst. The reaction mixture was maintained at room temperature and the pH was fixed at 4.5. Before the light was turned on, the solution was kept in dark for 40 min to reach the absorption-desorption equilibrium. Subsequently, solution was irradiated during 60 min and sampling was done every 5 min until 20 min, then every 10 min to complete the 60 min of photocatalytic reaction.31 Remaining gallic acid was determined by absorption measurements at 264.5 nm by means of UV-vis spectrophotometry (Shimadzu UV-1601PC). From the photocat-alytic activity measurements samples that exhibited the higher and lower activity were selected for further characterization.
Figure 2. SEM and TEM images of BiOBr obtained for 18 h and 145 °C
3. Results and Discussion 3. 1. Characterization of (BiOBr-MicSphe)
The SEM and TEM analyzes of the BiOBr-MicSphe are shown in Figure 2. The spheres shown correspond to those obtained at a lower temperature (145 °C). The synthesis method used to obtain this type of material is efficient and does not produce another type of morphology different to the spherical one, as shown in the microscopy of Fig. 2a and Fig.2b. BiOBr-MicSphe diameter varied from 7.0 to 1.5 ^m (Fig. 2f) and its consistency in the interior is completely porous (Fig. 2a). It is important to mention that, a smaller particle size promotes separation and migration of the photogenerated electron-hole pairs, improving the photocatalytic activity.42
All the synthesized spheres presented hierarchical structures composed of sheets that are interlaced in inside, generating a structure highly porous and with greater surface area in comparison to smooth structures. On the other hand, an analysis of SEAD (selected area electron diffraction) of the sphere shown in Fig. 2d was performed. The diffraction pattern (Fig. 2c) showed the following crystalline planes (101), (202) and (303), characteristic to phases corresponding to BiOBr. Other phases were not found in the analyzes so it is concluded that all the spheres are constituted BiOBr tetragonal type. The above argument is reinforced with the XRD analyzes (Fig. 3) where the phases found for the spheres obtained at 145 °C correspond to tetragonal BiOBr.
The XRD pattern of the BiOBr-MicSphe synthetized at 145 °C and 217 °C, are shown in las Fig. 3a and Fig. 3b, respectively. BiOBr synthetized at 145 °C, exhibited tetragonal structure according to the reference JCPDS Card 01078-0348. No impurity peaks or presences of other phases were observed. In contrast, BiOBr-MicSphe synthesized at 217 °C shows a mixture of two phases. The first one corresponding to the tetragonal BiOBr (JCPDS Card: 01-0780348), and the second one ascribed to the cubic phase of Bi2O3 (JCPDS Card: 01-077-0374). From the XRD pattern, the average size of crystallite (D) can be estimated by using the Scherrer's equation as follows:43
(1)
where À is the wavelength of X-ray radiation (À = 0.15406 nm, for copper), K is the Scherrer's constant (K = 0.94), 9 is the Bragg angle, fi is the half width full maximum of the peak.42 The average crystal size for samples grown at 145 °C and 217 °C were 14.2 nm and 40.7 nm, respectively. The observed difference in the crystallite sizes, is a consequence of the different applied temperature during the growth process, since it is well-known that higher temperatures result in bigger crystal size.
The presence of Bi2O3 can be a consequence of the increased temperature during the BiOBr fabrication process. The solvent of the reactants is ethylene glycol which is
PJ C
S
b)

jUj-jaLjl^
JCPDS 01-078-0348
10
20
30
40 SO 2-Theta
60
70
30
Figure 3. XRD patterns and BiOBr obtained for 18 h at a) 145 °C and b) 217 °C.
a coordinator agent that prevents premature hydrolysis of bismuth nitrate in nitric acid in the solvothermal synthesis of BiOBr (Eq. 2).30
2Bi(N%)3-5H2CW-3HOCH2CH2OH Bij (0CH2CH20) 3+6HNÛ3+10H2 O
(2)
At low temperature, reacts slowly with water and bromide, forming the BiOBr and releasing the ethylene glycol (Eq. 3).
Bi2(0CH2CH20)3+H20+KBr B i OBr+HOCHj CH2 OH
(3)
whenever the temperature increases in autoclave conditions, nitric acid dissociates and acts as a strong oxidizing agent, consuming halides, and transforming the Br-1 in Br2 (Eqs. 4 and 5):
4HNOi ->• 2 H2 O+4NO +3 02
8hf+2N03~+6Br" ->• 3Br,+2N0+4H20
(4)
(5)
Equation 3, shows that the reaction releases H+ ions, whereas that in Eqs. 4 and 5 the reactions consume H+. Some works have reported that under acid condition the synthesis of BiOBr is favorable, whereas to basic pH BiOBr materials are poor in halogen.44 Thus, as the temperature rises the pH increases favoring the formation of Br2 and leading to less bromide ions (Br-) ions available. In this way, once bromide ions are consumed, Bi3+ reacts with O2 to form Bi2O3.This information is supported by the qualitative analysis of chemical composition by EDS (supplementary material (Fig.Sl)).
On the other hand, Figure 4 shows the thermograms of BiOBr obtained at 145 °C and 217 °C of the materials that
shown the higher and the lower photo catalytic activity, respectively. It can be clearly seen a loss of weight in a multistage process, where the decomposed products are not stable intermediates for both cases. Both thermograms show that the materials suffer weight loss during the analysis. Between 40 to 300 °C, no significant decrease in weight is observed (about 5%), which is associated with the loss of water of hydration.
It can be seen from the curve corresponding to BiOBr obtained at 145 °C (Fig. 4a), that close to 600 °C the material has a first significant weight loss, which may be generated by the thermal decomposition of the micro-spheres monoxide bismuth (BIO) and Br2 (Eq. 6)
The second and last significant weight loss of this material occurs at 900 °C, which may be ascribed to the decomposition of BiO in Bi2O3 and metallic bismuth (Eq. 7). A total reduction of 46% of weight is observed from 300 °C to 900 °C.46-50
2BiOBr	2BiO + Br,
3BiO — BbOi + Bi
(6) (7)
In the case of sample obtained at 217 °C (Fig. 4b), weight loss starts at 400 °C and only a 35% of weight re-
a) '0B 100
b)
100 2q0 300 40 d 500 600 700 800 soo 1000
Temperature (°C)
100 200 300 400 500 600 700 b00 900 1000
Temperature (°C)
Figure 4. TGA-DTA profile of BiOBr obtained for 18 h at a) 145 °C and b) 217 °C.
duction is observed at 900 °C. These results show that BiOBr synthesized at 217 °C could be more thermally stable than the material synthesized at 145 °C. This higher thermal stability exhibited by BiOBr synthesized at 217 °C is a consequence of the presence of Bi2O3, which is known to be more stable for a wide range of temperatures.46,47
The BJH isotherm of the materials synthesized at 145 °C and 217 °C are shown in Fig. 5. The sample obtained at 145 °C exhibit irreversible type IV adsorption isotherms with an H3 hysteresis loop confirming the mesopore structure.48 In addition, pore size distribution is around 14 nm, as shown in Fig. 5a (inset). In contrast, the material synthesized at 217 °C exhibits a type II isotherm characteristic of a non-porous material, this material does not exhibit a porous morphology (Fig. 5b).
tn
"O <
	
11	b)
I	
1 \	
\	3)
	.------
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.3 0.9 1.0 1.1 Relative pressure (P^P0>
Figure 5. adsorption-desorption isotherms of BiOBr obtained for 18 h at a) 145 °C and b) 217 °C.
Table 1 shows the average values of textural properties of the synthesized materials obtained at different reaction temperatures, determined by nitrogen adsorption at 77 K. The higher value of surface is in relation with the high catalytic activity showed by BiOBr material with mi-crospheres morphology, since it is known that higher surface area favors the catalytic activity.49
Table 1: Values of textural properties of BiOBr materials prepared at 18 h reaction using 145 °C and 217 °C, respectively.
Temperature	BET	Pore diameter	Pore Volume
°C	m2/g	(nm)	(cm3/g)
145	19	14	0,05
217	3	60	0,05
Figures 6a and 6b show the FTIR spectra of BiO-Br-MicSphe synthesized at 145 °C and 217 °C, respectively. Spectrum of pure BiOBr microspheres (material obtained at 145 °C), exhibits two bands around 3500 and 1600 cm-1, which are attributed to OH symmetrical stretching and
scissoring vibrations, due to adsorbed water.50,51 The absorption bands located at 512 cm-1 and 770 cm-1 are ascribed to the stretching vibrations of Bi-O (Fig. 5a). Signals registered in the infrared middle and far away from the BiOX, are in accordance with those reported in the literature for this type of materials.52 However, from spectrum corresponding of material synthesized at 217 °C, no peaks in the region between 3500 and 1600 cm-1 are observed (Fig. 5b). Is possible that the OH bonds suffer rupture such as consequence of high temperature.
Figure 6. FTIR spectra of BiOBr obtained for 18 h at a) 145 °C and b) 217°C.
The optical properties of the BiOBr-MicSphe synthe-tized at 145 °C and 217 °C were studied using diffuse reflectance spectroscopy (DRS) in the UV-vis range. Fig. 7 shows the DRS curves of the BiOBr obtained to different temperatures, from which the band gap were determined.
wavelength (nm)
Figure 7. UV-Vis diffuse reflectance spectra (DRS) of BiOBr obtained for 18 h at a) 145 °C and b) 217 °C
The Eg of the materials were calculated by the Tauc representation, using the Eq. 8.
«(hv)=A(hv-Eg)n/2	(8)
Where a is the absorption coefficient, h is the Planck constant, v is the light frequency, Eg is the band gap energy, and n is related to semiconductor transition (n = 4 for BiOBr.53-54 The inset in Fig. 7 allows the determination of the band gap directly from extrapolation in the Tauc plot. The values found were 2.88 ± 0.01 eV and 2.48 ± 0.01 eV for materials obtained at 145 °C and 217 °C, respectively. These values are in good agreement with those reported previously by several authors for BiOBr microspheres.54-55 The lower band gap of the sample grown at 217 °C could be a consequence of the increased crystal size of BiOBr.56
In addition, the band-edge position of BiOBr can be estimated by using the following empirical equations.43,51
Evl3=X-Ee+0.5xEg	(9)
Where EVB is the valence band potential (VB) edge, Ecb is the conduction band potential (CB) edge, X is the electronegativity of the semiconductor (6.17 eV for BiOBr,53 Ee is the energy of free electron on the hydrogen scale (about 4.5 eV), and Eg is the band gap energy of the semiconductor. Accordingly, EVB and ECB were calculated to be 3.11 ± 0.01 eV and 0.23 ± 0.02 eV for BiOBr grown at 145 °C, and 2.91 ± 0.01 eV and 0.43 ± 0.02 eV for BiOBr synthesized at 217 °C. These values agree with those reported by other authors.57-58 These parameters are very important to identify the reactive species in the photocatalytic reac-
tion.59
3. 2. Photocatalytic Efficiency
The 11 experiments performed to obtain the different BiOBr-MicSphe samples by simultaneously varying the temperature and the reaction times in the autoclave reactor are shown in Table 2.
The rate constants were used as response factor (Y); these constants are shown in Table 3 and were calculated considering that reaction kinetics gallic acid degradation follows a pseudo first-order reaction model as expressed in Eq. 11.60-61 The reaction order is assumed in catalytic processes when the initial pollutant concentration is low.62
Where C0 and Ct are the concentration of gallic acid in solution at time 0 and t, respectively, and k is the apparent first-order rate constant.
The polynomial shown in the Eq. 2 obtained by linear regression, represents the weight of the variables, reac-
Table 1: Experimental design and results of the rate constants calculated for each trial.
Experiment	Time hours	Temperature °C	Y exp. k (s-1)	Y calc. k (s-1)	% Degradation Experimental
1	12 (-1)	120 (-1)	4,30 x 10-5	4,53 x 10-5	37,7
2	24 (1)	120 (-1)	4,00 x 10-5	4,33 x 10-5	43,2
3	12 (-1)	200 (1)	3,70 x 10-5	3,34 x 10-5	32,5
4	24 (1)	200 (1)	3,10 x 10-5	3,15 x 10-5	37,6
5	9,52 (-V 2)	160 (0)	4,00 x 10-5	4,13 x 10-5	39,2
6	24,5 (V 2)	160 (0)	4,10 x 10-5	4,41 x 10-5	32,8
7	18 (0)	103,4 (-V 2)	4,90 x 10-5	4,53 x 10-5	27,9
8	18 (0)	216,6 (V 2)	2,60 x 10-5	2,84 x 10-5	14,7
9	18 (0)	160 (0)	4,80 x 10-5	5,27 x 10-5	43,9
10	18 (0)	160 (0)	5,10 x 10-5	5,27 x 10-5	42,5
11	18 (0)	160 (0)	5,90 x 10-5	5,27 x 10-5	44,6
Table 3: Photocatalytic activity of synthesized BiOBr materials prepared at 18 h reaction using 145 °C and 217 °C, respectively.
Temperature	Yield a	experimental	Gallic acidb
°C	(%)	k [s-1]	degradation (%)
145	50	6,00 x 10-5	48,2
217	20	2,84 x 10-5	14,7
a Calculated considering the theoretical yield b After 60 min irradiation
tion time (t) and temperature (T) on the gallic acid degradation pseudo first order constant (Y). The validation of the model was performed using the ANOVA test. The values in parentheses in the response polynomial represent the standard deviation of each encoded coefficient. The model proposed in this study has an adequate correlation coefficient (R2 = 0.859) and cross validation correlation coefficient (Q2 = 0.618), values which validated the proposed model.29
Y(k BiOBr)= 5.27 x 10-5 (± 2.60 x 10-6) - 9.48 x 10-7(t) (± 1.59 x 10-6) - 5.94 x 10-6 (T) (± 1.59 x 10-6)- 6.39 x 10-6 (t)2 (± 1.90 x 10-6) - 7.90 x 10-6 (T)2 (± 1.90 x 10-6)
(12)
The Eq. 12 clearly shows that the most important variable in the solvothermal synthesis of BiOBr microspheres is the temperature, which normally exhibits a negative influence on the photocatalytic activity of the materials when it increases. Meanwhile, the reaction time has weak positive influence. A 3-D representation of response surface of the polynomial is shown in Fig. 8, where a noticeable maximum in the temperature axis is observed, indicating the optimum value of this variable to get the more active catalyst. In this case, the best conditions to obtain the most active catalyst are temperature of 145 °C and 18 h of reaction time.
Fig. 9, shows the correlation of photocatalytic degradation percentages on gallic acid with experimental conditions. Table 2 shown the results of the higher and lower
Figure 8. 3-D representation of response surface of the polynomial response.
Figure 9. Correlation of photocatalytic degradation percentages on gallic acid with experimental conditions of table 2.
photocatalytic efficiency, measured as first order rate constant of gallic acid degradation and degradation percentages.
4. Conclusions
In this work, BiOBr microspheres were synthesized by solvothermal process under standardized conditions by controlling the reaction temperature and reaction time. The reaction temperature of 145 °C and time 18 hours, were established as the more appropriate values to obtain BiOBr with microspheres morphology and higher photo-catalytic activity on degradation of gallic acid.
In addition, it was determined that the crystalline phase, chemistry composition, morphology, surface area, and size particle of these materials are strongly influenced by the reaction temperature variable, affecting thus directly the photo catalytic activity of these materials. Finally, from the characterization it is possible to conclude that BiOBr samples synthetized using the reported conditions here, are an appropriate material as a photocatalyst for gallic acid degradation under visible light.
5. Acknowledgements
This study was funded by Institutional Improvement Plan in Energy Efficiency and Environmental Sustainabili-ty (Plan de Mejoramiento Institucional en Eficiencia Energética y Sustentabilidad Ambiental) - Project Grant # PMI ULS 1401 of Universidad de La Serena.
6. References
1.	F. Arsac, D. Bianchi, J. Chovelon, P. Conchon, C. Ferronato, A. Lair, M. Sleiman, Mater. Sci. Eng. C. 2008, 28,722-725. DOI:10.1016/j.msec.2007.10.053
2.	J. Herrmann, Catalysis Today.1990, 53,115-129. DOI:10.1016/S0920-5861(99)00107-8
3.	U. Gaya, A. Abdullah, J. Photochem. Photobiol C. 2008, 9, 1-12. DOI:10.1016/j.jphotochemrev.2007.12.003
4.	A. Alinsafia, E. Abdulkarima, M.Ponsa , O. Zahraa, A. Ben-hammou, A. Yaacoubi, A. Nejmeddine, Dyes Pigm. 2017, 74, 439-445. DOI:10.1016/j.dyepig.2006.02.024
5.	Y. Lan, Y. Lu, Z. Ren, Nano Energy. 2013, 2, 1031-1045. DOI:10.1016/j.nanoen.2013.04.002
6.	M. Henderson, Surface Science Report. 2011, 66, 185-297. DOI:10.1016/j.surfrep.2011.01.001
7.	S. Malato, M. Maldonado, J. Blanco, W. Gernjak, Catalysis Today. 2009, 147, 1-59. DOI:10.1016/j.cattod.2009.06.018
8.	Z. Wang, W. Ma, J. Zao: Sensitization of Titania Semiconductor: A Promising Strategy to Utilize Visible Light, en: Phtoca-talysis and Water Purification from Fundamentals to Recent Applications, Wiley-VCH, Germany, 2018, pp.199-231.
9.	M. Pelaez, N. Nolan, S. Pillai, M. Seery, P. Falaras, A. Kontos, P. Dunlop, J. Hamilton, J. Byrne, K. O'Shea, M. Entezari, D. Dionysiou D, Applied Catalysis B. 2012, 125, 331-349. DOI:10.1016/j.apcatb.2012.05.036
10. A. Di Paola, E. Garcia, G. Marci, L. Palmisano, J. Hazard. Ma-
ter. 2012, 211-212, 3-29.
DOI: 10.1016/j.jhazmat.2011.11.050
11.	C. Li , Z. Qiang , L. Wenhua, Y. Shuangfeng, Prog Chem. 2010, 22, 2282-2289.
12.	S. R. Zhu, M. K. Wu, W. N. Zhao, F.-Y Yi, K. Tao, L. Han, J. Solid State Chem. 2017, 255, 17-26. DOI:10.1016/j.jssc.2017.07.038
13.	H. An, Y. Du, T. Wang, C. Wang, W. Hao, J. Zhang, Rare Metals. 2017, 27,243-251. DOI:10.1016/S1001-0521(08)60123-0
14.	X. Zhang, Z. Ai, F. Jia, L. Zhang, Journal Phys. Chem. C. 2008, 112, 747-753. DOI:10.1021/jp077471t
15.	S. R. Zhu, Q. Qi, W. N Zhao, M. K. Wu, Y. Fang, K. Tao, F .Y. Yi, L. Han, Dalton Trans. 2017, 46, 11451-11458. DOI:10.1039/C7DT01581J
16.	J. Zhang, F. Shi, J. Lin, D. Chen, J. Gao, Z. Huang, X. Ding, C. Tang C, Chem. Mater. 2008, 20, 2937-2941. DOI:10.1021/cm7031898
17.	Z. Jiang, F. Yang, G. vYang, L. Kong, M. O. Jones, T. Xiao, P. P. Edwards, J. Photochem. Photobiol. A. 2010, 212, 8 -13. DOI:10.1016/j.jphotochem.2010.03.004
18.	H. Deng, J. Wang, Q. Peng, X. Wang, Y. Li, Chem. Eur. J. 2005, 11, 6519-6524. DOI:10.1002/chem.200500540
19.	M. Shang, W. Wang, L. Zhang, J. Hazard. Mater. 2009, 167, 803-809. DOI:10.1016/j.jhazmat.2009.01.053
20.	L. Zhang, X. Cao, X. Chen, Z. Xue, J. Colloid Interf. Sci. 2011, 354,630 -636. DOI:10.1016/j.jcis.2010.11.042
21.	S. R. Zhu, M. K Wu, W. N. Zhao, P. F. Liu, F. Yi, G. Li, K. Tao, L. Han, Cryst. Growth Des. 2017, 17, 2309-2313. DOI:10.1021/acs.cgd.6b01811
22.	J. Wang, Y. Li, Chem. Commun. 2003, 18, 2320-2321. DOI:10.1039/b306189b
23.	Y. Chen, M. Wen, Q. Wu, Cryst. Eng. Comm. 2011, 13, 30353039. DOI:10.1039/c0ce00955e
24.	H. Cheng, B. Huang, Z. Wang, X. Qin, Chem. Eur. J. 2011, 17, 8039 - 8043. DOI:10.1002/chem.201100564
25.	J. Zhang, F. Shi, J. Lin, D. Chen, J. Gao, Z. Huang, X. Ding, C. Tang, Chem. Mater. 2008, 20, 2937-2941. DOI:10.1021/cm7031898
26.	J. Xu, W. Meng, Y. Zhang, L. Li, C. Guo, Applied Catalysis B. 2011, 107, 355- 362. DOI:10.1016/j.apcatb.2011.07.036
27.	Y. Huo, J. Zhang, M. Miao, Y. Jin, Applied Catalysis B. 2012, 111-112, 334-341.
28.	Z. Šumic, A. Vakula, A. Tepic, J. Čakarevic, J. Vitas, B. Pavlic, Food Chemistry. 2016, 203, 465-475. DOI:10.1016/j.foodchem.2016.02.109
29.	Contreras D, Freer J, Rodríguez, J, Inter. Biodeter. Biodegr. 2006, 57, 63-68.
30.	D. Contreras, Y. Moreno, Y. Salgado, G. Cardenas, R. Baggio, O. Peña, J. Pivan, New J. Chem. 2017, 31, 1751-1754. DOI:10.1039/b703592f
31.	T. Lundstedt, E. Seifert, L. Abramo, B. Thelin, A. Nyström, J. Pettersen, R. Bergman, Chemometrics Intell. Lab. Syst. 1989, 42, 3-40. DOI:10.1016/S0169-7439(98)00065-3
32.	A. Mera, C. Rodríguez, M.F. Meléndrez, H. Valdés, J. Mater. Sci. 2017, 52, 944-954. DOI:10.1007/s10853-016-0390-x
33.	A. Mera, D. Contreras, N. Escalona, H. Mansilla, J. Photo-
chem. Photobiol. A. 2016, 318,71-76. DOI:10.1016/j.jphotochem.2015.12.005
34.	F. Beltrán, O. Gimeno, F. Rivas, M. Carbajo, J. Chem. Tech. Biotechnol. 2006, 81, 1787-1796. DOI:10.1002/jctb.1605
35.	M. Arienzo, E. Christen, W. Quayle W, J. Hazard. Mater. 2009, 169, 94-9. DOI:10.1016/j.jhazmat.2009.03.069
36.	M. Petruccioli, J. Duarte, F. Federici, J. Biosci. Bioengineering. 2002, 90,381-386. DOI:10.1016/S1389-1723(01)80005-0
37.	M. Akassou, A. Kaanane, A. Crolla, C. Kinsley, Water Sci. Technol. 2010, 62,475-83. DOI:10.2166/wst.2010.235
38.	J. Fernández, J. kiwi, C. Lizama, J. Freer, J. Baeza, H. Mansilla, J. Photochem. Photobiol. A Chem. 2012, 151, 213-219. DOI:10.1016/S1010-6030(02)00153-3
39.	C. Lizama, J. Freer, J. Baeza , H. Mansilla H, Catalysis Today. 2002, 76, 235-246. DOI:10.1016/S0920-5861(02)00222-5
40.	F. Torrades, M. Pérez, H. Mansilla, J. Peral, Chemosphere. 2013, 53,1211-1220. DOI:10.1016/S0045-6535(03)00579-4
41.	M. Pérez, M. Graells, L. J. Del Valle, E. Centelles, H. Mansilla, Catalysis Today. 2017, 124,163-171. DOI:10.1016/j.cattod.2007.03.034
42.	B. Leckner, Sol. Energy. 1978, 20, 143-150. DOI:10.1016/0038-092X(78)90187-1
43.	A. Mera, Y. Moreno, J. Pivan, O. Peña, H. Mansilla, J. Photochem. Photobiol. A Chem. 2014, 289, 7-13. DOI:10.1016/j.jphotochem.2014.05.015
44.	D. Smilgies, J. Appl. Crystallogr. 2009, 42, 1030-1034. DOI:10.1107/S0021889809040126
45.	Y. Guan, H. Qian, J. Guo J, Yang S, Wang X, Wang S, Fu Y, Appl. Clay Sci. 2015, 114,124-132. DOI:10.1016/j.clay.2015.05.017
46.	X. Xiao, R. Hu, C. Liu, C. Xing, X. Zuo, J. Nan, L. Wang, Chem. Eng. J. 2013, 225,790-797. DOI:10.1016/j.cej.2013.03.103
47.	J. Song, C. Mao, H. Niu, Y. Shen, S. Zhang, Cryst. Eng. Comm. 2010, 12, 3875-3881. DOI:10.1039/c003497p
48.	J. Tóth, Colloids Surf. 1990, 49,57-69. DOI: 10.1016/0166-6622(90)80092-1
49.	C. Yu, W. Zhou, H. Liu, Y. Li, D. Dionysiou, Chem. Eng. J. 2016. 287,117-129. DOI:10.1016/j.cej.2015.10.112
50.	Z. Liu, X. Xu, J. Fang, X. Zhu, J. Chu, B. Li, Appl. Surf. Sci. 2012, 258, 3771-3778. DOI:10.1016/j.apsusc.2011.12.025
51.	Z. Liu, B. Wu, Y. Zhu, D. Yin, L. Wang, Catal. Lett. 2012, 142, 1489-1497. DOI:10.1007/s10562-012-0899-9
52.	J. Cao, X. Li, H. Lin, S. Chen, X. Fu, J. Hazard. Mater. 2012, 239-240, 316-324. DOI:10.1016/j.jhazmat.2012.08.078
53.	Z. Liu, X. Xua, J. Fang, X. Zhua, J. Chua, B. Li, Appl. Surf. Sci. 2012, 258, 3771-3778. DOI:10.1016/j.apsusc.2011.12.025
54.	J. Tauc, R. Grigorovici, A. Vancu, Phys. Stat. Solid B. 1966, 15,627. DOI:10.1002/pssb.19660150224
55.	D. Wood D, J. Tauc, Phys. Rev. B. 1972, 5, 3144.
56.	X. Xion, L. Ding, Q. Wang, Y. Li, Q. Jiang, J. Hu, Appl. Catalysis B. 2016, 188,283-291. DOI:10.1016/j.apcatb.2016.02.018
57.	C. Rodríguez, M. Sandoval, G. Cabello, M. Flores, H. Fernández, C. Carrasco C, Mater. Res. Bul. 2014. 60, 313-321. DOI:10.1016/j.materresbull.2014.08.047
58.	P. Wang, P. Yang, Y. Bai, T. Chen, X. Shi, Y. Ye, X. Zhang, J. Taiwan Ins. Chem. Eng. 2016, 68, 295-300. DOI:10.1016/j.jtice.2016.09.013
59.	J. Luo, X. Zhou, L. Ma, X. Xu, J. Molecular Catalysis A Chem. 2015, 410, 168-176. DOI:10.1016/j.molcata.2015.09.019
60.	A. Kontos, I. Arabatzis, D. Tsoukleris, M. Bernard, D. Pe-trakis, P. Falaras, Catalysis Today. 2015, 101, 275-281. DOI:10.1016/j.cattod.2005.03.003
61.	J. Herrmann, Catalysis Today. 1999, 53, 115-129. DOI:10.1016/S0920-5861(99)00107-8
62.	H. Pardue. Anal. Chim. Acta. 1989, 216, 69-107. DOI:10.1016/S0003-2670(00)82005-X
Povzetek
Mikrosfere BiOBr s hierarhično morfologijo (BiOBr-MicSphe) imajo potencialno uporabo v heterogeni fotokatalizi v procesih dekontaminacije vode in zraka. Zaradi tega je sinteza, karakterizacija in vrednotenje fotokatalitske aktivnosti teh materialov postala pomembna. V članku poročamo o sintezi mikrosfer BiOBr pri kateri smo uporabljali različne razpone reakcijskih temperatur (120-200 °C) in reakcijskega časa (12 h - 24 h). Vzorci, pripravljeni pri 145 °C in 18 h, so pokazali višjo fotokatalitsko aktivnost pri degradaciji galske kisline. Morfološke lastnosti, kemična sestava in strukturna analiza so pokazali, da je imel vzorec z višjo fotokatalitsko aktivnostjo mikrosferično morfologijo s čisto BiOBr tetragonalno fazo. Poleg tega je adsorpcijsko-desorpcijska analiza pokazala manjši premer por v vzorcu, pripravljenem pri 145 °C v 18 urah. Reakcijska temperatura močno vpliva na različne lastnosti materiala, ki posledično vplivajo na fotokatalitsko aktivnost.
DOI: 10.17344/acsi.2018.4200	Acta Chim. Slov. 2018, 65, 438-447	©commohs
Scientific paper
Recovery of Antioxidant Compounds from Aronia Filter Tea Factory by -Product: Novel Versus Conventional
Extraction Approaches
Aleksandra Gavaric, Milica Ramic, Jelena Vladic, Branimir Pavlic, Robert Radosavljevic and Senka Vidovic*
Faculty of Technology, University of Novi Sad, 21000, Bulevar cara Lazara 1, Novi Sad, Serbia
* Corresponding author: E-mail: senka.curcin@yahoo.com +381 21 485 3731
Received: 19-01-2018
Abstract
Black chokeberry (Aronia melanocarpa L.) by-product from filter tea factory underwent subcritical water extraction (SWE) in order to recover polyphenolics and determine its antioxidant potential. In the current study Box-Behnken design was applied for optimization. Independent variables used in experimental design were temperature (T, 120-200 °C), extraction time (t, 15-35 min) and hydrochloride concentration (c, 0-1.5%). Experimental results were fitted to a second-order polynomial model where multiple regression analysis and analysis of variance were used to determine fitness of the model and optimal conditions. The optimized SWE conditions for maximum responses of total phenols (TP), total flavonoids (TF) and monomeric anthocyanins (MA) contents, and minimum response of IC50 were temperature of 120.4 °C, extraction time of 15.2 min and absence of acidifier. The predicted values of TP, TF, MA and IC50 at these conditions were: 32.8863 mg GAE/g, 23.5164 mg CE/g, 0.5124 mg C3G/g and 0.0055 mg/mL, respectively.
Keywords: Aronia melanocarpa L.; subcritical water extraction; antioxidants; response surface methodology; optimization
1. Introduction
Aronia melanocarpa L. (commonly known as black chokeberry) is a perennial shrub which originates from North America.1 Aronia berries are one of the richest plant sources of anthocyanins, mainly containing cyanidin glycosides,2 which constitutes 25% of the total polyphenols.3 This member of Rosaceae family is also recognizable for possessing the highest in vitro antioxidant capacity among berries.4 Besides anthocyanins, chokeberries are abundant in proanthocyanidins and hydroxycinamic acid.5 Dominant proanthocyanidins are epicatechin oligomers, which have share of 66% in aronia fruit polyphenols.3 There is a growing interest in utilization of anthocyanins and proan-thocyanidins, due to their antioxidant potential and positive correlation between their consumption and prevention of colon cancer, cardiovascular disease,1 diabetes mellitus type II and hepatoprotective effect.6 Beside use of aronia berries in medical purposes it is widely exploited in the food industry, either on its own, or mixed with other
fruits (e.g. in juices, syrups, jams, wine production, food colouring, dietary supplements).7,8
Today, biowaste streams e.g. low volume agro-food waste streams like leaves, stems, bulbs, flowers and exhausted cakes pose environmental risks while being an important potential feedstock resource for producing a wide range of novel bioproducts. Their utilization is limited by the lack of technologies able to process heterogeneous mixtures beyond existing technologies, that fully break down the valuable complexity of components, or specific extraction and separation technologies, which are excessively costly. In the production of aronia juice, after extraction step, many phenolic compounds including anthocya-nins are still present in the cake and could be valorized by adequate extraction process. Therefore, solids left after production of aronia juice in fruit factory are used as a raw material for the production of fruit filter tea.
Dry aronia cake underwent several processes: cutting, grinding, milling, sifting and fractionating. After these technological processes approximately 20% of input batch is of particle size lower than the particle size of pores
of filter tea bag. Since this fraction cannot be packed into filter bags it represents by-product also known as fruit dust. As this material has particle size lower than 0.315 mm, it could be successfully used for extraction as plant particles with low particle size represent a convenient crude material for extraction. The main reason for that is increased mass transfer of bioactives from powdered plant material to liquid phase.9
Solvent extractions are the most common extraction methods for phenolic compounds. Solvents such as etha-nol, methanol, acetone, ethyl acetate, as well as their combination and mixture in different proportion with water are the most often used solvents in classical extractions.10 Classical methods of extraction, apart from using solvents with negative environmental impact, very often exert low selectivity and efficiency of extraction as well as long extraction time. Additionally, further processing of obtained liquid extracts is necessary in order to removal of the solvents. Subcritical water extraction (SWE) is a green solvent extraction technique which uses water at temperatures between 100 and 374 °C and pressure high enough to keep it in the liquid state.11 Water on room temperature is an inadequate extraction solvent for phenolic compounds, due to high dielectric constant. However, variations of temperature allow modification of dielectric constant of water in that way altering its selectivity. At elevated temperature, the initial value of dielectric constant of 80 at 25 °C decreases to 27 at 250 °C which falls between those of ethanol (e = 24) and methanol (e = 33) at 25 °C.12 Therefore, subcritical water is successfully employed for phenols extraction from different sources.13-18 In a great deal of studies its advantage considering extraction efficiency comparing to classical technologies has been confirmed.14,16,19 Furthermore, SWE reduces energy consumption by 3-5 folds when compared to traditional solvent extraction.20 However, long exposure of material to high temperatures can cause oxidization of phenolic compounds. Hence, it is necessary to select the most appropriate extraction method and optimize the process in order to achieve maximal extraction efficiency and highest quality of obtained extracts.10
The main purpose of this study was to investigate the advantages of green extraction technology, subcritical water extraction, over conventional extraction technique in attempt to valorize aronia fruit dust as alternative source of dietary antioxidants. Another reason for choosing aronia filter tea by-product for this investigation is due to its convenient chemical profile regarding polyphenols, mostly anthocyanins and procyanidins responsible for positive effects on human health.
2. Materials and Methods 2. 1. Plant Material and Chemicals
The chokeberry fruit dust was purchased from Fruc-tus (Backa Palanka, Serbia), a local filter tea factory, and
stored in paper bags at a room temperature until analysis. Fraction with particle size lower than filter tea bag, i.e. herbal dust, was used as a raw material for the production of chokeberry fruit filter-tea. Moisture content of dried chokeberry powder was 8.66%.
Folin-Ciocalteu reagent, (±)-catechin and 1,1-diphe-nyl-2-picryl-hydrazyl-hydrate (DPPH) were purchased from Sigma (Sigma-Aldrich GmbH, Steinheim, Germany). Gallic acid was purchased from Sigma (St. Louis, MO, USA). All other chemicals used were of analytical reagent grade.
2. 2. Maceration
Traditional extraction procedure was performed by maceration of 10.0 g of chokeberry fruit dust with 30, 50 and 70% ethanol (1:10; m/v) at room temperature (25 °C) for 24 h. Extraction was performed in shaker with temperature control (KS 4000i, IKA, Germany), and shaking (150 rpm) was used in order to agitate extraction. After extraction, extracts were immediately filtered through filter paper under vacuum (V-700, Buchi, Switzerland). Extracts were collected into glass flasks and stored at 4 °C until the analysis.
2. 3. SWE Procedure
SWE was performed in batch-type high-pressure extractor (Parr Instrument Company, USA) with internal volume 450 mL, and maximum temperature 200 °C, connected with temperature controller (4838, Parr Instrument Company, USA). Extraction procedure was described elsewhere.21 Temperature (T, 120-200 °C), extraction time (t, 15-35 min) and HCl concentration (c, 0-1.5%) were independent variables. Operating pressure of 30 bar was kept constant. This pressure was slightly in excess of that required (20 bar) to prevent the formation of steam within the extraction cell. During extraction period, temperature was held constant (stationary phase) for different extraction time depending on experimental run. After the extraction, extractor was cooled in ice-bath during approximately 5 min to reach room temperature. After extraction, extracts were immediately filtered through filter paper under vacuum, collected into glass flasks and stored at 4 °C until the analysis.
2. 4. Total Phenols (TP) and Flavonoids Content (TP)
TP content in obtained liquid extracts was determined using Folin-Ciocalteu procedure.22 Content of phenolic compounds was expressed as mg of gallic acid equivalents (GAE) per g dry weight (DW). Total flavonoids content was determined using aluminum chloride colori-metric assay.23 All experiments were performed in triplicate, and results are expressed as mean values.
2. 5. Determination of Monomeric Anthocyanins Content (MA)
MA content in the samples was estimated using a VIS-spectrophotometer by the pH differential method reported by Abu Bakar et al. 24 with slight modifications.25 Two buffer systems, potassium chloride buffer, pH 1.0 (0.0025 M) and sodium acetate buffer, pH 4.5 (0.4 M), were used. Briefly, 400 ^L of sample (diluted liquid extract) was added in 3.6 mL of corresponding buffer solutions and absorbance was measured against a blank probe at 510 and 700 nm. Absorbance (A) was calculated as:
Anthocyanin concentration in the extract was calculated and expressed as cyanidin-3-glycoside equivalent (C3G):
MA = {A ■ MW ■ DF ■ 1000)/Ma
(2)
where is difference in absorbance, is a molecular weight for cyanidin-3-glucoside (449.2 g/mol), is the dilution factor of the samples and is the molar absorptivity of cyani-din-3-glucoside (26.900 M/cm). Results were expressed as mg of cyanidin-3-glucoside equivalents per g DW.
2. 6. DPPH Assay
Free radical scavenging activity of samples was determined using DPPH assay, previously described by Espin et al.26 A certain volume of diluted sample was mixed with 95% methanol and 90 ^M 1,1-diphenyl-2-picryl-hy-drazyl (DPPH) in order to obtain different final concentrations. After incubation on room temperature for 60 min, the absorbance was measured at 515 nm and result was expressed as radical scavenging capacity (RSC, %) which was calculated using following equation:
(3)
where Asample is the absorbance of sample solution and Ablank is the absorbance of blank probe. Antioxidant activity was further expressed as inhibition concentration at 50% of RSC value (IC50). IC50 represents the concentration of plant extract required to obtain 50% of radical scavenging capacity, expressed as mg per mL. All experiments were performed in triplicate, and results are expressed as mean values.
2. 7. Box-Behnken Design and Statistical Analysis
The extraction efficiency of subcritical chokeberry extract can be influenced by variety of factors such as pressure, temperature, extraction time, pH and volume of the
solvent and time of the static extraction. In the current study RSM coupled with Box-Behnken design (BBD) was applied in order to optimize SWE process. Design consisted of fifteen randomized runs with three replicates at the central point. Independent variables used in experimental design were temperature (T, 120-200 °C), extraction time (t, 15-35 min) and hydrochloride concentration (c, 0-1.5%). In order to normalize parameters, each of the coded variables was forced to range from -1 to 1, so that they all affect the response more evenly, and so the units of the parameters are irrelevant.27 The natural and coded values of independent variables used in BBD are presented in Table 1.
Table 1. Experimental domain with natural and coded values of independent variables used in BBD
Independent variable	Factor levels		
	-1	0	1
Temperature [°C]	120	160	200
Extraction time [min]	15	25	35
c (HCl) [%]	0	0.75	1.5
The response variables were fitted to the following second-order polynomial model (Eq. (4)) which is generally able to describe relationship between the responses and the independent variables:
(4)
where Y represents the response variable, X; and Xj are the independent variables affecting the response, and and pij are the regression coefficients for intercept, linear, quadratic and interaction terms, respectively. Optimal extraction conditions were determined considering total phenolic and total flavonoid content, and antioxidant activity simultaneously as responses. Treatment of multiple responses and selection of optimal conditions were based on desirability function D.28 The experimental design and multiple linear regression analysis were performed using Design-Expert v.7 Trial (Stat-Ease, Minneapolis, Minnesota, USA). The fitness of the polynomial model equation was expressed by the coefficient of determination (R2) and its statistical significance was confirmed by F-test at a probability (p) of 0.05.
3. Results and Discussion 3. 1. Extraction Solvent
Extraction is the first and important step in isolation and purification of bioactive compounds from herbal mate-
rial. Maceration, traditional extraction method, is influenced by several factors such as type and concentration of solvent, solid/liquid ratio, temperature, extraction time, particle size of solute, pH, etc. Ethanol is considered a suitable solvent for extraction of phenols from various sourc-es.29,30 This is due to the wide range of phenols that the aqueous ethanol mixtures can dissolve. For dried chokeber-ry dust, a wide range of ethanol concentration was tested with the result of 50% ethanol being superior regarding yields of TP, TF and MA.31 Also in our study, selection of the most appropriate ethanol concentration was based on the yields of TP, TF and MA. Extraction yield for each group of compounds is presented in Fig. 1, from where it could be seen that 50% ethanol provided highest yields of TP and TF and MA. Several authors also reported that the use of medium concentration of ethanol (50%) resulted in higher TP yields compared with other ethanol/water ratios.32,33
Previous studies reported that binary solvent system, containing hydro-organic solvents, was superior comparing to mono-component solvent system in the extraction of phenolic compounds.34,35 Water is responsible for swelling of plant material, while ethanol plays a key role in disrupting the bonding between the solutes and plant matrix thus enabling improved mass transfer of the compounds. Cujic et al.33 investigated effects of extraction time (15, 30, 60 and 90 min) on total phenolic and total anthocyanins contents of aronia dried fruit and concluded that extraction time was not relevant regarding yields of TP and MA. In present study, duration of maceration was fixed (24 h).
Figure 1. Extraction yields of desirable groups of compounds obtained with different concentration (30, 50 and 70%) of ethanol for 24 h
3.2. Effects of Extraction Parameters on Total Phenolics Content
It is known that processing of aronia berries into juice can significantly affect its polyphenol composition. However, due to their astringent taste and storage issue,
most of the bioavailability tests and clinical trials are conducted with juices instead of berries.36 TP obtained in chokeberry subcritical extracts varied from 13.1579 to
A)
I
a.
C HO M<K*ntr»bon
B E itTKbon 5m«
B)
i a
(3 o> £
C: HCl concentration
A: Temperature
C)
? £

B Eitrtcwntm*
A Twpffltuf«
Figure 2. Response surface plots showing combined effects of process variables: (A) HCl concentration and extraction time, (B) HCl concentration and temperature and (C) extraction time and temperature on total phenolics content
Table 2. Box-Behnken design of the three-level and three-variables and observed responses under different experimental conditions
Independent variables	Investigated responses
Run	X ! Temperature [°C]	X2 Time [min]	X3 c (HCl) [%]	TP [mg GAE/g]	TF [mg CE/g]	IC50 [mg/ml] MA [mg C3G	
1	160 (0)	15 (-1)	1.5 (1)	17.8520	4.1595	0.1140	0.0401
2	120 (-1)	25 (0)	0 (-1)	29.5536	22.1000	0.0361	0.3473
3	120 (-1)	15 (-1)	0.75 (0)	24.9044	14.8682	0.0664	0.2672
4	160 (0)	25 (0)	0.75 (0)	17.9643	4.9700	0.0822	0.0508
5	160 (0)	25 (0)	0.75 (0)	18.3911	5.3776	0.1125	0.0574
6	200 (1)	15 (-1)	0.75 (0)	21.8050	11.2604	0.0827	0.0628
7	200 (1)	35 (1)	0.75 (0)	20.6595	6.2840	0.0746	0.0908
8	160 (0)	25 (0)	0.75 (0)	18.8627	5.8600	0.1296	0.0735
9	200 (1)	25 (0)	0 (-1)	22.3665	14.9685	0.0062	0.3300
10	200 (1)	25 (0)	1.5 (1)	22.1419	9.4655	0.0726	0.0521
11	160 (0)	35 (1)	0 (-1)	21.3558	11.2568	0.0214	0.1015
12	160 (0)	15 (-1)	0 (-1)	24.1857	13.1915	0.0291	0.4622
13	120 (-1)	25 (0)	1.5 (1)	13.1579	8.3000	0.1333	0.3348
14	160 (0)	35 (1)	1.5 (1)	17.1333	5.1340	0.1128	0.0414
15	120 (-1)	35 (1)	0.75 (0)	18.7504	10.9809	0.0900	0.3256
Table 3. Estimated coefficients of the fitted second-order polynomial model for TP, TF, IC50 and MA, and analysis of variance (ANOVA) for the investigated systems
Term		Regression coefficient		
	TP [mg GAE/g]	TF [mg CE/g]	IC50 [mg/ml]	MA [mg C3G/g]
Po	18.4060	5.4025	0.1081	0.0606
Linear				
Pi	0.0758	-1.7838*	-0.0112	-0.0924*
P2	-1.3560*	-1.2280**	8.2500E-004	-0.0341
P3	-3.3971*	-4.3072*	0.0425*	-0.0966*
Cross product				
P12	1.2521	-0.2723	-7.9425E-003	-7.5980E-003
Pi3	4.0428*	2.0743*	-7.6975E-003	-0.0663
P23	0.5278	0.7273	1.6225E-003	0.0905**
Quadratic				
P11	2.3985*	5.3594*	-0.0185	0.1154*
P22	0.7253	0.0864	-0.0112	0.0107
P33	1.0004	2.9465*	-0.0276**	0.0901**
R2a	0.9629	0.9682	0.8970	0.8959
CVb	6.0900	15.0400	27.6200	45.6000
pm -Valuec	<0.0050	<0.0050	<0.0500	<0.0500
plf -Valued	0.0759	0.0535	0.6490	0.01270
* Significant at 5%; "Significant at 10%; a Coefficient of multiple determination; b Coefficient of variance [%]; c Probability of F value for the model; d Probability of F value for the lack of fit
29.5536 mg GAE/g, while TP obtained by maceration with 30, 50 and 70% ethanol provided notably higher values, 306.1392; 351.0761 and 273.3627 mg GAE/g, respectively. The lowest yield for investigated response was obtained at temperature of 120 °C, extraction time of 25 min and added 1.5% HCl, while TP (29.5536 mg GAE/g) was found to be the highest at temperature of 120 °C, extraction time of 25 min and absence of acidifier. This indicates
weak influence of both temperature and extraction time on TP yield. Ju and Howard37 observed 31% decrease of total phenolics in red grape skin subcritical extracts, when temperature increased from 100 to 160 °C.37 Grunovaite et al.38 reported TP yield (182.89 mg GAE/g extract) of chokeberry pomace subcritical extract obtained at 130 °C. Combined influence of SWE parameters on the TP is presented in Fig. 2.
According to regression coefficients (Table 3), except for linear terms of extraction time and HCl concentration, all other effects of parameters were positive on TP content in SWE extracts. According to p-values for the regression coefficients, linear term of time, interaction term between temperature and HCl concentration and quadratic term of temperature exhibited significant influence (p < 0.05). The most influental was linear term of HCl concentration (p < 0.0006). Coefficient of multiple regression for this model (p<0.0045) indicates excellent correlation between experimental and predicted values which was further supported by CV (6.09%) and R2 (0.9629).
3. 3. Effects of Extraction Parameters on Total Flavonoids Content
Significant losses of flavonol glycosides occurred during the pressing operation, with 39-49% of the compounds being retained in the cake. The less polar quercetin hexosides (galactoside and glucoside) were retained to a greater extent in the cake than the more polar quercetin diglycosides. According to Wilkes et al.,36 the majority of the non-polar quercetin aglycone was retained in the cake, while only 27% was expressed into the juice.
Experimental values of TF obtained under different SWE conditions are presented in Table 2. TF recovered in chokeberry subcritical extracts varied from 4.1595 to 22.1000 mg CE/g while TF obtained by maceration with 30, 50 and 70% ethanol provided significantly higher values, 194.4607; 213.1274 and 176.1847, respectively. The highest value (22.1000 mg CE/g) of investigated response was obtained under temperature of 120 °C, extraction time of 25 min and absence of acidifier, the same conditions as it was the case with TP content. This is consistent with previous findings, where total fla-vonol content increased 3.7-fold from 100 to 120 °C in red grape skin subcritical extracts. However, the lowest TF content was observed under temperature of 160 °C, extraction time of 15 min and with added 1.5% HCl. This is in accordance with literature, where total flavo-nol content of subcritical extracts declined 30% when temperature increased from 120 to 160 °C.37 Combined influence of SWE parameters on the TF is presented in Fig. 3.
Statistical coefficients (R2 = 0.9682, CV = 15.04%) indicated that this model represented satisfying fit to the experimental results. All three linear terms exhibited negative effect on TF content. According to p-values for the regression coefficients, linear terms showed significant influence while HCl concentration was the most influental (p < 0.0004) parameter, as it was the case with TP content. Interaction term between temperature and HCl concentration showed highly significant (p < 0.05) influence on TF content. Also, quadratic terms of temperature and HCl concentration exhibited highly significant (p < 0.05) influence.
3. 4. Effects of Extraction Parameters on Monomeric Anthocyanins
Wilkes et al.36 reported that anthocyanins were more susceptible to losses during processing than flavo-
A)
Figure 3 Response surface plots showing combined effects of process variables: (A) HCl concentration and extraction time, (B) HCl concentration and temperature and (C) extraction time and temperature on total flavonoids content
nols, total proanthocyanidins, and hydroxycinnamic acids as a result of thermal degradation, proven by increased levels of protocatechuic acid and phloroglucinaldehyde. The juice pressing step resulted in losses of all polyphenols due to physical removal of skins, while anthocyanins
A)
B)
C HCl M**irttr«bwi	A T*mp*f*tufe
C)
9 EitTKMntnw

Figure 4 Response surface plots showing combined effects of process variables: (A) HCl concentration and extraction time, (B) HCl concentration and temperature and (C) extraction time and temperature on monomeric anthocyanins yield
and total proanthocyanidins were retained in the cake to a greater extent than hydroxycinnamic acids and flavo-nols. The cake contained 52, 51, 54 and 54% of the levels of cyanidin 3-galactoside, cyanidin 3-glucoside, cyanidin 3-arabinoside and cyanidin 3-xyloside found in the enzyme treated mash, respectively.36 The importance of anthocyanins remaining within the cakes is quite significant, as Kalt et al.39 claimed that antioxidant capacity in blueberries is mainly due to anthocyanins, although other phenolics also contribute to its antioxidant activities.39 As aronia cake is mainly composed of fruit skins, which are high in pigment, rapid mass transport of the anthocy-anins from the substrate using subcritical water facilitates fast and effective extraction process.40 Experimentally obtained yields for monomeric anthocyanins under different SWE conditions are presented in Table 2, while regression coefficients and statistical analysis of investigated response are presented in Table 3. Extraction parameters demonstrated similar influence to TF and MA (r = 0.702), which was rather expected due to anthocyanins being a class of flavonoids. In order to improve understanding of multiple influences of all independent variables, response surface plots were created according to Eq. (2) (Fig.4).
In contrast to the results obtained by Ju and Howard,37 where acidified water used as solvent provided maximum extraction of total anthocyanins (3-glucosides of delphinidin, cyanidin, petunidin, peonidin and malvi-din) at 80-100 °C,38 the highest MA yield (0.0462 mg C3G/mL) in our case was observed at temperature of 160 °C, extraction time of 15 min and absence of acidifier. The highest MA yield (1.6590 mg C3G/mL) obtained by maceration with 50% ethanol was above 35-fold higher than the highest MA yield acquired with SWE. The lowest MA yield (0.0040 mg C3G/mL) was obtained at temperature of 160 °C, extraction time of 15 min and addition of 1.5% HCl. Above 414-fold difference between the lowest and the highest MA yields suggests that absence/presence of acidifier has a crucial role in MA yield. Most extraction procedures use acidified solutions of ethanol, methanol, acetone, water, and acetone/methanol/water mixtures, which denature cellular membranes and facilitate solubi-lization of anthocyanins.33 Regarding TP, TF and MA yields, the lowest responses were obtained when 1.5% HCl was added, while the highest responses were observed when acidifier was absent. Although hydrochloric acid (<1.0%) is recommended for anthocyanin extraction, addition of excess acid can lead to hydrolysis of labile, acyl and sugar residues.42 Ramic et al. reported highest MA yield (2.26 mg C3G/mL) obtained by ultrasound assisted extraction (UAE) of black chokeberry at temperature of 70 °C and extraction time of 60 min.31 The highest MA yield obtained by UAE was more than 48-fold higher than the highest MA yield in subcritical chokeber-ry extract at temperature of 160 °C and extraction time of 15 min. Total anthocyanins were degraded at tempera-
tures >100 °C (especially at 140 °C), indicating that 100 °C was the optimum SWE temperature for isolating an-thocyanins using acidified water.37 Therefore, elevated temperature (160 °C) could be responsible for notably lower MA yield obtained by SWE in comparison with UAE and maceration.
According to regression coefficients, the effects of linear terms of SWE parameters were all negative on MA content in subcritical extracts. Linear terms of temperature and HCl concentration showed highly significant influence (p < 0.05) as well as quadratic term of temperature. The total anthocyanin content of subcritical extracts obtained from red grape skin declined 40% from 110 to 160 °C,37 indicating that elevated extraction temperature could cause rapid degradation and even discoloration of antho-cyanins in some cases.42 The thermal degradation of an-thocyanins follows 1st order reaction kinetics,43 hence high-temperature short-time processing is recommended for maximizing the retention of anthocyanins in foods41. Therefore, SWE was conducted over the temperature range of 120 to 200 °C in 40 °C increments for a short time (1535 min) ensuring high superficial fluid velocity through the extraction cell. Interaction term between extraction time and HCl concentration together with quadratic term of HCl concentration exhibited moderately significant influence (p < 0.1).
3. 5. Effects of Extraction Parameters on Antioxidant Activity
Increasing temperature from 100 to 160 °C resulted in a linear increase in ORAC values in subcritical extracts derived from red grape skin. The ORAC value of extract obtained by conventional methanol extraction was greater than the ORAC values obtained by SWE from 100 to 140 °C, but less than ORAC values obtained by SWE from 140 to 160 °C. The ORAC values showed negative correlation with total anthocyanins in subcritical extracts, suggesting that anthocyanins are not responsible for antioxidant ca-
pacity.37
In this study, antioxidant capacity expressed as IC50 value ranged from 0.0062 to 0.1333 mg/mL. The highest antioxidant activity (0.0062 mg/mL) was observed at temperature of 200 °C, extraction time of 25 min and absence of acidifier, while the lowest activity (0.1333 mg/mL) was obtained at 120 °C, 25 min and with added 1.5% HCl. These results suggest that temperature and absence/presence of acidifier are the most influence parameters affecting antioxidant capacity. Response surface plots which visualize influence of SWE parameters on antioxidant activity are presented in Fig. 5.
In the case of IC50, as it was the case with anthocyanins, linear term of HCl concentration showed highly significant (p < 0.05) influence, while quadratic term of HCl concentration showed moderately significant (p < 0.1) influence.
A)
B)
C MO COftCtntrtbCfl
8 Eftricbon tm*
I ?
C MO WK4i4/ltWfl	A T|(flp#f<ui|
C)
e ErtTKWnl««
A T«mp«r»tur»
Figure 5 Response surface plots showing combined effects of process variables: (A) HCl concentration and extraction time, (B) HCl concentration and temperature and (C) extraction time and temperature on IC50 value
3. 6. Optimization of SWE Parameters for Maximizing Yields of Polyphenolics
One of the main goals of this investigation was to maximize extraction yields for TP, TF and MA, and to
minimize IC50 value within the range of each extraction parameter. Determination of optimal conditions and predicted values was based on desirability function which was 1, the most desirable response.27 The optimized SWE conditions for maximum response of TP, TF and MA, and minimum response of IC50 were temperature of 120.4 °C, extraction time of 15.2 min and absence of acidifier. Results of this work were in accordance with previous studies where temperature of 120 °C was detected as optimal for SWE of anthocyanins from different berry pomaces and seeds.37,40 The predicted values of TP, TF, MA and IC50 value at optimal conditions were 32.8863 mg GAE/g, 23.5164 mg CE/g, 0.5124 mg C3G/g and 0.0055 mg/mL, respectively.
According to particularly high values of coefficients of multiple determination (R2) for TP and TF (0.9629 and 0.9682), excellent fit between experimental and values predicted by the model is indicated. Although R2 was relatively high in case of IC50 (0.8970) and MA (0.8959), it was still significantly lower comparing to other responses. However, for all four responses, mathematical models were statistically acceptable due to significant regression (pm < 0.05) and non-significant lack of fit (pf > 0.05), except for MA where lack of fit was significant (pf = 0.0127). Furthermore, coefficient of variance, which represents dispersion degree of the data, is rather low (CV < 15%) in all models and supports good fitness of the model providing better reproducibility except in the case of MA and IC50.
4. Conclusions
Previously published data on antioxidant capacity indicators of chokeberry cake are rather scarce. Although aronia pomace is by far the richest source of total pheno-lics, aronia cake may serve as an alternative low-cost raw material for extraction of dietary antioxidants. The major drawbacks of conventional extraction techniques in general are long time, excessive cost, use of large quantity of organic solvent, poor extraction selectivity and generation of toxic organic waste. These obstacles could be overcome by employing SWE.
The second-order polynomial model has proven to be adequate for mathematical description of SWE of several groups of polyphenolic compounds. Therefore, optimization of extraction conditions in order to simultaneously provide maximum yields for TP, TF and MA and, minimum IC50 value was successfully performed using RSM coupled with BBD. Since statistical and graphical analysis showed that HCl concentration was the most influential factor for all four responses, absence of acidifier was determined as optimal for extraction of polyphenolic compounds. The optimized SWE conditions, for maximum response of TP, TF and MA, and minimum response of IC50, were temperature of 120.4 °C, extraction time of 15.2 min and absence of acidifier. The predicted values of TP,
TF, MA and IC50 at these conditions were: 32.8863 mg GAE/g, 23.5164 mg CE/g, 0.5124 mg C3G/g and 0.0055 mg/mL, respectively.
Recognizing the obtained results it can beob concluded that aronia fruit dust, discharged as by-product from filter tea factory, can serve as a valuable source of polyphenols when SWE is applied. Although high-temperature short-time processing is suitable for maximizing the retention of anthocyanins in plant matrices, SWE is not the optimal technology for recovery of monomeric anthocyanins from aronia fruit dust providing notably lower yields in comparison with UAE and maceration.
5. References
1.	S. E. Kulling, H. M. Rawel, Planta Med. 2008, 74, 1625-1634. DOI:10.1055/s-0028-1088306
2.	L. Jakobek, M. Seruga, M. Medvidovic-Kosanovic, I. Novak, Dtsch. Lebensmitt. Rundsch. 2007, 103, 58-64.
3.	J. Oszmianski, A. Wojdylo, Eur. Food Res. Technol. 2005, 221, 809-813. DOI:10.1007/s00217-005-0002-5
4.	M. P. Kähkönen, A. I. Hopia, H. J. Vuorela, J. P. Rauha, K. Pihlaja, T. S. Kujala, M. Heinonen, J. Agric. Food Chem. 1999, 47, 3954-3962. DOI:10.1021/jf990146l
5.	P. N. Denev, C. G. Kratchanov, M. Ciz, A. Lojek, M. G. Kratch-anova, Compr. Rev. Food Sci. Food Saf. 2012, 11, 471-489. DOI:10.1111/j.1541-4337.2012.00198.x
6.	A. Kokotkiewicz, Z. Jaremicz, M. Luczkiewicz, J. Med. Food. 2010, 13, 255-269. DOI:10.1089/jmf.2009.0062
7.X.	L. Wu, L. W. Gu, R. L. Prior, S. McKay, J. Agric. Food Chem. 2004, 52, 7846-56 DOI:10.1021/jf0486850
8.	A. Nawirska, M. Kwasniewska, Food Chem. 2005, 91, 221-5 DOI:10.1016/j.foodchem.2003.10.005
9.	S. Vidovic, D. Cvetkovic, M. Ramic, M. Dunjic, R. Malbasa, A. Tepic, Z. Sumic, A. Velicanski, S. Jokic, Ind. Crops Prod. 2013, 50, 338-345. DOI:10.1016/j.indcrop.2013.08.005
10.	Dai, J., & Mumper, R. J. Molecules. 2010, 15(10), 7313-7352. DOI:10.3390/molecules15107313
11.	R. S. Ayala, M. L. De Castro, Food Chem. 2001, 75(1), 109113. DOI:10.1016/S0308-8146(01)00212-6
12.	C. C. Teo, S. N. Tan, J. W. Yong, C. S. Hew, E. S. Ong, J. Chro-matogr. A. 2010, 1217(16), 2484-2494. DOI:10.1016/j.chroma.2009.12.050
13.	S. Er^an, O. G. Üstündag, R. Carle, R. M. Schweiggert, Food Chem. 2018, 253, 46-54. DOI:10.1016/j.foodchem.2018.01.116
14.	J. Vladic, O. Canli, B. Pavlic, Z. Zekovic, S. Vidovic, M. Kaplan, J. Supercrit. Fluids. 2017, 120, 86-94. DOI:10.1016/j.supflu.2016.10.016
15.	P. P. Singh, M. D. Saldana, Food Res. Int. 2011, 44(8), 24522458. DOI:10.1016/j.foodres.2011.02.006
16.	B. Aliakbarian, A. Fathi, P. Perego, F. Dehghani, J. Supercrit. Fluids. 2012, 65, 18-24. DOI:10.1016/j.supflu.2012.02.022
17.	P. Budrat, A. Shotipruk, Sep. Purif. Technol. 2009, 66(1), 125129. DOI:10.1016/j.seppur.2008.11.014
18.	P. Rangsriwong, N. Rangkadilok, J. Satayavivad, M. Goto, A. Shotipruk, Sep. Purif. Technol. 2009, 66(1), 51-56. D01:10.1016/j.seppur.2008.11.023
19.	M. J. Ko, C. I. Cheigh, S. W. Cho, M. S. Chung, J. Food Eng. 2011, 102(4), 327-333. D0I:10.1016/j.jfoodeng.2010.09.008
20.	S. Ponnusamy. H. K. Reddy, T. Muppaneni. C. M. Downes, S. Deng, Bioresour. Technol. 2014, 170. 454-461. D0I:10.1016/j.biortech.2014.07.072
21.	Z. Zekovic, S. Vidovic, J. Vladic, R. Radosavljevic, A. Cvejin, M. A. Elgndi, B. Pavlic, J. Supercri. Fluids. 2014, 95, 560-566.
22.	V. L. Singleton, J. A. Rossi, Am. J. Enology Vitic. 1965, 16, 144-158.
23.	Harborne, J. B. (1989). Methods in Plant Biochemistry, Plant Phenolics, vol. 1, Academic Press Ltd., London.
24.	M. F. Abu Bakar, M. Mohamed, A. Rahmat, J. Fry, Food Chem. 2009, 113, 479-483. DOI:10.1016/j.foodchem.2008.07.081
25.	P. Dzomba, Afr. J. Agric. Res. 2013, 25, 3330-3333.
26.	J. C. Espin, C. Soler-Rivas, H. J. Wichers, C. Garcia-Viguera, J. Agric. Food Chem. 2000, 48, 1588-1592. DOI:10.1021/jf9911390
27.	D. Ba§, I. H. Boyaci, J. Food Eng. 2007, 78(3), 836-845. DOI:10.1016/j.jfoodeng.2005.11.024
28.	R. H. Myers, D. C. Montgomery, C. M. Anderson-Cook, Response Surface Methodology: Process and Product Optimization Using Designed Experiments, third ed., Wiley, New Jersey, 2009.
29.	T. Bahorun, A. Luximon-Ramma, A. Crozier, O. I. Aruoma, J. Sci. Food Agric. 2004, 84(12), 1553-1561. DOI:10.1002/jsfa.1820
30.	N. E. Durling, O. J. Catchpole, J. B. Grey, R. F. Webby, K. A. Mitchell, L. Y. Foo, N. B. Perry, Food Chem. 2007, 101(4), 1417-1424. DOI:10.1016/j.foodchem.2006.03.050
31.	M. Ramie, S. Vidovic, Z. Zekovic, J. Vladic, A. Cvejin, B. Pavlic, Ultrason. Sonochem. 2015, 23, 360-368. DOI:10.1016/j.ultsonch.2014.10.002
32.	L. G. d'Alessandro, K. Kriaa, I. Nikov, K. Dimitrov, Sep. Purif. Technol. 2012, 93, 42-47. DOI:10.1016/j.seppur.2012.03.024
33.	N. Cujie, K. Savikin, T. Jankovie, D. Pljevljakusie, G. Zdunie, S. Ibrie, Food Chem. 2016, 194, 135-142. DOI:10.1016/j.foodchem.2015.08.008
34.	Z. S. Zhang, D. Li, L. J. Wang, N. Ozkan, X. D. Chen, Z. H. Mao, Sep. Purif. Technol. 2007, 57, 17-24. DOI:10.1016/j.seppur.2007.03.006
35.	J. E. Cacace, G. Mazza, J. Food Sci. 2003, 68, 240-248. DOI:10.1111/j.1365-2621.2003.tb14146.x
36.	K. Wilkes, L. R. Howard, C. Brownmiller, R. L. Prior, J. Agric. Food Chem. 2013, 62(18), 4018-4025. DOI:10.1021/jf404281n
37.	Z. Y. Ju, L. R. Howard, J. Agric. Food Chem. 2003, 51, 5207-13. DOI:10.1021/jf0302106
38.	L. Grunovaite, M. Pukalskiene, A. Pukalskas, P. R. Vensku-tonis, J. Funct. Foods. 2016, 24, 85-96. DOI:10.1016/j.jff.2016.03.018
39.	W. Kalt, J. E. H. McDonald, Donner, J. Food Sci. 2000, 65(3), 390-393. DOI: 10.1111/j.1365-2621.2000.tb16013.x
40.	J. W. King, R. D. Grabiel, J. D. Wightman, In Proceedings of the 6th Intl. Symposium on Supercritical Fluids (Vol. 1, pp. 28-30), 2003.
41.	R. L. Jackman, J. L. Smith, Anthocyanins and betalains. In: Hendry GAF, Houghton JD, editors. Natural food colorants. 2nd ed. Glasgow, U.K.: Blacklie Academic & Professional, 1996, 244-309. DOI:10.1007/978-1-4615-2155-6_8
42.	H. Wang, G. Cao, R. L. Prior, J. Agric. Food Chem. 1997, 45, 304-309. DOI:10.1021/jf960421t
43.	B. Cemeroglu, S. Velioglu, S. Isik, J. Food Sci. 1994, 59, 12167. DOI: 10.1111/j.1365-2621.1994.tb14680.x
Povzetek
Odpadne produkte aronije (Aronia melanocarpa L.), ki nastajajo pri proizvodnji čaja v filtrnih vrečkah, smo podvrgli subkritični vodni ekstrakciji (SWE) z namenom izolacije polifenolov in določitve njihovih antioksidativnih lastnosti. Za optimizacijo pogojev smo uporabili Box-Behnken-ovo metodo načrtovanja eksperimentov. Neodvisni parametri so bili temperatura (T, 120-200 °C), čas ekstrakcije (t, 15-35 min) in koncentracija hidroklorida (c, 0-1.5 %). Eksperimentalnim podatkom smo prilagodili polinom 2. stopnje ter s pomočjo multiple regresijske in analize variance določili njegovo ustreznost kot tudi optimalne pogoje. Optimizirani SWE pogoji, pri katerih so bile dosežene maksimalne koncentracije skupnih fenolov (TP), skupnih flavonoidov (TF) in monomernih antocianinov (MA) ob minimalni vrednosti IC50, so bili: temperatura 120.4 °C, čas ekstrakcije 15.2 min in odsotnost hidroklorida. Predvidene vrednosti TP, TF, MA in IC50 pri teh pogojih so: 32.8863 mg GAE/g, 23.5164 mg CE/g, 0.5124 mg C3G/g in 0.0055 mg/mL.
DOI: 10.17344/acsi.2018.4224	Acta Chim. Slov. 2018, 65, 448-461	©commohs
Scientific paper
Hydrothermal Synthesis of Novel Magnetic Plate-Like Bi2O2CO3/CoFe2O4 Hybrid Nanostructures and Their Catalytic Performance for the Reduction of Some Aromatic Nitrocompounds
Parisa Zarringhadam and Saeed Farhadi*
Department of Chemistry, Lorestan University, Khoramabad 68151-44316, Iran
* Corresponding author: E-mail: sfarhadi1348@yahoo.com Tel: +986633120611, fax: +986633120618
Received: 27-01-2018
Abstract
Novel magnetically separable Bi2O2CO3/CoFe2O4 nanocomposites were fabricated by a feasible hydrothermal route. Fourier transform infrared (FT-IR) spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy (DRS), vibrating sample magnetometer (VSM), and N2 adsorption-desorption analysis were employed to examine the structure, morphology, particle size, phase composition, optical and magnetic properties of the as-synthesized nanocomposites. The results of the findings showed demonstrated the successful coupling of spherical CoFe2O4 nanoparticles and plate-like Bi2O2CO3 nanostructures. The catalytic performance of magnetic Bi2O2CO3/CoFe2O4 nanocamposites was evaluated in the reduction of some aromatic nitrocompounds such as nitrophenols and nitroanilines by using sodium borohydride (NaBH4) aqueous solution at room temperature. The Bi2O-2CO3/CoFe2O4 nanocamposite with 30 %wt. CoFe2O4 exhibited the best performance in the reduction of aromatic nitrocompounds with 100% conversion into the corresponding amino compounds within 15-30 min with rate constant of 0.10-0.24 min-1. The effect of catalyst dosage was also investigated on the efficiency of reduction process. Furthermore, magnetic Bi2O2CO3/CoFe2O4 nanocomposite could be easily removed by an external magnet from the reaction system.
Keywords: Plate-like Bi2O2CO3; bismuth-based nanomaterials; cobalt ferrite, magnetic nanocomposite; catalytic reduction; nitrophenols
1. Introduction
Nitrophenols are one of the most organic pollutants in industrial and agricultural waste waters.1,2 Nitrophenols and their derivatives are significant by-products produced from pesticides, herbicides and synthetic dyes.3-5 Among them, 4-nitrophenol (4-NP) is well known to cause damage to the central nervous system, liver, kidney and both animal and human blood. Hence its removal from the environment is a crucial task.6-10 On the other hand, the reduction of 4-NP to 4-aminophenol (4-AP) is essential in pharmaceutical industries for the manufacture of analgesic, antipyretic and other drugs, in photographic developer, corrosion inhibitor, anticorrosion lubricant, etc.11,12 Over the past few decades, the catalytic reduction of nitropho-nols using NaBH4 as reducing agent in aqueous medium has received considerable attention as a relatively simple and clean method.13 Many reports are available on the ap-
plication of metal and metal oxides nanocatalysts for the reduction of nitrophenols in the presence of NaBH4.14-22 However, the separation of them from the reaction mixture is an important issue. In order to solve these problems, the magnetic separable nanocomposites such as Au/Fe3O4,23 Ag@Pd satellites/Fe3O4,24 Pt/Fe3O4/CNTs,25 and Fe3O4/ SiO2/Ag26 have been exploited for the catalytic reduction of nitrophenols in aqueous media. In such approaches, although nanocomposites showed improved recyclability but they suffered from one or more drawbacks such as the usage of expensive noble metals and the multi-step preparation procedures. Hence, the development of an alternative inexpensive, facile and easy-removal magnetic catalyst for the reduction of nitrophenols is highly desirable in the context of environmental and industrial concerns.
During the recent years, bismuth-based nanostructured materials, such as Bi2O3,27 BiVO4,28 Bi2WO6,29 Bi2MoO6,30,31
BiOX (X = Cl, Br, I), and so on,32-34 have received a great deal of attention due to their unique catalytic and photo catalytic activities. Among these compounds, some studies have focused on the fabrication ofbismuth subcarbonate (Bi2O2CO3) and its composites.35 Up to now, many kinds of Bi2O-2CO3-based hybrid composites such as Bi2O2CO3/^-Bi2O3,36 Bi2O2CO3/MoS2,37 Bi2O2CO3/BiOX (X= Cl, Br and I),38-40 Bi2O2CO3/Bi2WO6,41 Bi2O2CO3/Bi2S3,42 Bi2O2CO3/CdS,43 Bi2O2CO3/BiPO4,44 g-C3N4/Bi2O2CO3,45 Ag2O/Bi2O2CO3,46 Ag/AgBr/Bi2O2CO3,47 Ag3PO4/Bi2O2CO3,48 Ag2CO3/Bi2O-2CO349 and MWCNTs/Bi2O2CO350 have been successfully synthesized, which showed enhanced catalytic or photocata-lytic stability and activity than Bi2O2CO3 alone. But most of these composites are difficult to separate and recycle, seriously limiting their extensive application. Therefore, fabrication of well-defined and easy separated Bi2O2CO3-based catalysts from the suspended reaction system via a simple process remains to be a great challenge. To overcome this shortfall, coupling Bi2O2CO3 with magnetic materials is highly desirable. In this regard, spinel-type metal ferrites (MFe2O4) are known to have high magnetic performance as well as excellent chemical stability.51 Among them, CoFe2O4 nanoparticles have a higher strong magnetic property, and therefore, CoFe2O4 based composites can be magnetically separable in a suspension by virtue of their own magnetic properties without any introduction of additional magnetic particles. Based on the previous studies, it can be expected that the modification of Bi2O2CO3 with CoFe2O4 to form Bi2O2CO3/CoFe2O4 nanocomposites may improve the catalytic activity and recyclability. Furthermore, their magnetic nature makes composites magnetically separable from the reaction mixture in a convenient manner. As far as we know, there is no report about CoFe2O4-modified Bi2O2 CO3 until now.
In this work, novel magnetically separable Bi2O2CO3 / CoFe2O4 nanocomposits with high catalytic performance were synthesized via loading various amounts of CoFe2O4 nanoparticles on the surface of plate-like Bi2O2CO3 nanos-trucures by a hydrothermal method at 180 °C for 24 h. The structure, morphology, and optical properties of the obtained nanomaterials were characterized in detail. Then, the excellent catalytic activity of the as-prepared Bi2O2CO3/ CoFe2O4 composite nanomaterials was evaluated by the reduction of 4-nitrophenol in the presence of aqueous NaBH4 solution under ambient conditions. In addition, the possible reaction mechanism was proposed based on the experimental results. This study provides a promising candidate for efficient removal of nitrophenols from water by an environment-friendly and economical approach.
2. Experimental
2. 1. Materials
Bismuth nitrate pentahydrate (Bi(NO3)3 5H2O, 98%), citric acid (98.5%), cobalt(II) nitrate hexahydrate (Co(NO3)2 6H2O, 98%), iron(III) nitrat nanohydrate
(Fe(NO3)3 9H2O, 98%), sodium borohydride (NaBH4, 98.5%), 2-nitrophenol (2-NP, 99%), 4-nitrophenol (4-NP, 98%), 2-nitroaniline (2-NA, 99%) and 4-nitroaniline (4-NA, 99%) were obtained from Merck chemical company and used as received without further purification. All other chemicals were of analytical grade, commercially available and used without further purification.
2. 2. Methods of Characterization
FT-IR spectra were recorded on a Schimadzu system FT-IR 8400S spectrophotometer in transmission mode from 4000 to 400 cm-1 using KBr pellets. the XRD patterns of the samples were obtained on an X-ray dif-fractometer (Rigaku D-max C III) using Ni-filtered Cu Ka radiation (X = 1.5406 A) UV-vis diffuse reflection spectroscopy (DRS) was performed on a Snico S4100 spectrophotometer over the spectral range 200-1000 nm by using BaSO4 as the reference. The shapes and morphologies of samples were observed by a MIRA3 TES-CAN field emission scanning electron microscope (FES-EM) equipped with a link energy-dispersive X-ray (EDX) analyzer. The particle size was determined by a CM120 transmission electron microscope (TEM) at an accelerating voltage of 80 kV. TEM samples were prepared by dropping the ethanol dispersion on a carbon coated copper grid. A PHS-1020 PHSCHINA instrument was used to measure the Brunauer-Emmett-Teller (BET) surface areas of the samples at liquid nitrogen temperature (77 K). Specific surface area calculations were made using Brunauer-Emmett-Teller (BET) method at the relative pressure (p/p0) between 0.05 and 0.35. Magnetic measurements were carried out at room temperature using a vibrating sample magnetometer (VSM, Magnetic Dane-shpajoh Kashan Co., Iran) with a maximum magnetic field of 10 kOe. X-ray photoelectron spectroscopy (XPS) was conducted using a thermo Scientifi, ESCALAB 250Xi, Mg X-ray resource instrument. UV-vis spectra of nitro compounds during the reduction reaction in aqueous solutions were analyzed using a Cary 100 double beam spectrophotometer operated at a resolution of 2 nm with quartz cells with path length of 1 cm in the wavelength range of 200 to 600 nm.
2. 3. Preparation of CoFe2O4 Nanoparticles
CoFe2O4 nanoparticles were prepared by hydrothermal process. Fe(NO3)3 9H2O (1.72 g) and Co(NO3)2 6H2O (0.62 g) were dissolved in 25 mL distilled water (Co/Fe mole ratio of 1:2), and then the solution was adjusted to a pH of 12 with NaOH (6 M). After stirring for 60 min, the mixture was transferred to a 50 mL Teflon-lined stainless steel autoclave and maintained at 180 °C for 12 h before being cooled down in air. The resulting precipitate was filtered, washed with deionized water and ethanol, and dried at 60 °C for 6 h.
2. 4. Preparation of Plate-Like Bi2O2CO3 Nanoparticles
To obtain plate-Like Bi2O2CO3 nanoparticles, 2.0 mmol of bismuth nitrate pentahydrate [Bi (NO3)3 5H2O] was dissolved in 20 mL of HNO3 aqueous solution (1 M), and then 1.5 mmol of citric acid (C6H8O7) was added under magnetic stirring. The pH of the solution was adjusted to 6 by adding NaOH aqueous solution (2 M) under magnetic stirring. Finally, the white-colored precursor suspension was transferred into a 50 mL Teflon-lined stainless steel autoclave and heated for 24 h at 180 °C. After hydrothermal treatment, the autoclave was cooled down to room temperature naturally. The resulting precipitate was collected by centrifugation, washed with deionized water several times, and dried at 60 °C for 6 h.
2. 5. Preparation of Bi2O2CO3/CoFe2O4 Nanocomposites
To synthesize Bi2O2CO3/CoFe2O4 nanocomposites, 2.0 mmol of Bi(NO3)3 5H2O was dissolved in 20 mL of HNO3 (1 M), and then 1.5 mmol of citric acid (C6H8O7) was added under magnetic stirring. The pH of the solution was adjusted to 6 by adding NaOH aqueous solution (2 M) under magnetic stirring. Then, the required amount of CoFe2O4 nanoparticles (30 and 45 wt%) was added to the Bi2O2CO3 precursor suspension. After sonication for 30 min, the homogenized suspension was transferred into a 50 ml Teflon-lined stainless steel autoclave, sealed and maintained at 180 °C for 24 h. Then, the autoclave was naturally cooled down to room temperature and the resulting precipitate was separated by a magnet, washed with deion-ized water several times, dried at 60 °C and used for further characterization. The obtained samples with 30 and 45 wt% CoFe2O4 nanoparticles were denoted as Bi2O2CO3/CoFe2O430% and Bi2O2CO3/CoFe2O445%, respectively.
2. 6. Catalytic Tests
The catalytic performance of the synthesized Bi2O2CO3/CoFe2O4 nanocomposites in the reduction of 4-nitrophenol (4-NP) to 4-amiophenol (4-AP) was evaluated by excess aqueous NaBH4 solution at room temperature. In a typical catalytic reaction, 2 mL of aqueous solution of 4-NP (0.2 mM) and 0.5 mL of freshly prepared aqueous solution of NaBH4 (20 mM) were mixed together in a standard quartz cell, having 1 cm path length. The solution color turned to bright yellow rapidly. Then, 5 mg of the Bi2O2CO3/CoFe2O4 nanocomposite was added and stirred at room temperature. The solution was quickly subjected to UV-Vis measurements; Afterward, the absorb-ance of the solution was in situ measured every several minutes (2 min) in the scanning range of 200-500 nm to obtain the successive change about the reaction. In order
to optimized the catalyst amount, similar experiments have been carried out in the presence of various amount of the catalyst (2.5, 5, 10, 15, and 20 mg in 2.5 mL aqueous solutions) on the reduction of 4-NP. The reduction of 2-ni-trophenol (2-NP) and 2-nitroaniline (2-NA) and 4-ni-troaniline (4-NA) was also carried out under the same conditions. For comparison, similar experiment was performed in the presence of the pure Bi2O2CO3 (5 mg) and CoFe2O4 (5 mg) catalysts. For recycling experiments, the Bi2O2CO3/CoFe2O4 catalyst was recovered from the solution by an external magnet after completion of the reaction. The magnetically recovered catalyst was washed repeatedly with deionized water, dried at 60 °C and then employed for a new run.
3. Results and Discussion 3. 1. Characterization of Bi2O2CO3/CoFe2O4 Nanocomposites
FT-IR spectra of the as-prepared Bi2O2CO3, CoFe2O4 and Bi2O2CO3/CoFe2O4 samples are indicated in Figure 1. For pure Bi2O2CO3 sample in Figure 1(a), the sharp peaks at ca. 1400 and 845 cm-1 are the characteristic stretching
Figure 1. FT-IR spectra of (a) Bi2O2CO3, (b) CoFe2O4 (c) Bi2O2CO3/CoFe2O43G%, and (d Bi2O2CO3/CoFe2O445%.
and bending vibrations of CO32- groups, respectively.52 Meanwhile, the intensive peak at about 550 cm-1 was attributed to the stretching vibration of the Bi-O, suggesting the formation of Bi2O2CO3.53 In the case of CoFe2O4 (Figure 1(b)), the two peaks appeared at 603 and 458 cm-1 are related to the stretching vibrations of M-O bonds in the tetrahedral and octahedral sites of spinel-type oxide, respectively.54,55 FT-IR spectra of the Bi2O2CO3/CoFe2O4 nanocomposites in Figures 1(c) and (d) show the stretching and bending vibrations correspond to the carbonate group (CO32-) in Bi2O2CO3 at 1400 and 844 cm-1, besides strong bands of CoFe2O4 in the 400-600 cm-1 range. This finding demonstrates the coexistence of Bi2O2CO3 and CoFe2O4 in the nanocomposites.
The crystal structure of samples was further characterized using XRD. Figure 2 shows the XRD patterns of the Bi2O2CO3, CoFe2O4 and Bi2O2CO3/CoFe2O4 nanocom-posites with different contents of CoFe2O4. The patterns of Figures 2(a) and (b) are well consistent with the tetragonal Bi2O2CO3 phase (jCPDS no. 41-1488) and the spinel-type CoFe2O4 phase (JCPDS no. 01-1121). As shown in Figures 2(c) and (d), all the Bi2O2CO3/CoFe2O4 samples exhibit a coexistence of both Bi2O2CO3 and CoFe2O4 phases without any impurity phase, indicating successful synthesis of
composites. In addition, the intensity of characteristic CoFe2O4 peaks at 20 = 35.76 and 63.13 in nanocomposite increased with increasing CoFe2O4 amount. Besides, the diffraction peaks of Bi2O2CO3/CoFe2O4 nanocomposites exhibited sharp and intense state, indicating a promising crystalline nature which was beneficial for the following catalytic activity.
The shape and morphology of the as-synthesized CoFe2O4, Bi2O2CO3 and Bi2O2CO3/CoFe2O4 samples were investigated by FE-SEM. The SEM images of CoFe2O4 sample in Figures 3(a) and (b) show a large quantity of nearly uniform monodispersed spheres with an average diameter of about 15 nm. The SEM images in Figures 3(c) and (d) show that the bare Bi2O2CO3 sample was formed from plate-like particles which were loosely aggregated. As can be observed, the porous structure was formed by self-assembly of these nanoplates. SEM images of the Bi2O2CO3/CoFe2O4 nanocomposites containing 30% and 45% of CoFe2O4 are shown in Figures 3(e) and (f), respectively. It is evident that the shape and morphology of Bi2O2CO3/CoFe2O4 nanocomposits are similar to those of the pure Bi2O2CO3, but many spherical CoFe2O4 nanopar-ticles are seen on the surface of plate-like Bi2O2CO3 nano-structures. From images, it can be clearly seen that a lot of
Figure 2. XRD patterns of (a) Bi2O2CO3, (b) CoFe2O4, (c) Bi2O2CO3/CoFe2O430%, and (d) Bi2O2CO3/CoFe2O445%.
Figure 3. SEM images of (a and b) CoFe2O4, (c and d) Bi2O2CO3, (e) Bi2O2CO3/CoFe2O43Q% (f) Bi2O2CO3/CoFe2O445% samples.
spherical CoFe2O4 nanoparticles with a size of about 1520 nm were well deposited on the Bi2O2CO3 nanoplates.
The size and microstructure of the as-prepared Bi2O2CO3/CoFe2O4 samples were further investigated by TEM. The sample powder was sonicated in ethanol for 30 min and a drop of the suspension was dried on a carbon-coated microgrid for TEM measurements. The TEM images in Figure 4(a)-(c) show that the obtained Bi2O2CO3/CoFe2O430% nanocomposite was formed mainly from plate-like particles with a weak agglomeration. Also, from the TEM images in Figure 4(d), it is clear that the Bi2O2CO3/CoFe2O445% consists of plate-like structure with the lengths of 15-40 nm and thicknesses of several nanometers while CoFe2O4 nanoparticles show sphere-like shapes. It is obvious from the TEM images that the nanoplates exhibit mostly square-like shapes, although some are rectangular. As can be observed on all images, many spherical CoFe2O4 dark-color particles are observed to be deposited on the surface of bright plates of the Bi2O-2CO3. The average size of CoFe2O4 particles was calculated to be 15 nm from the measurements on the TEM micrographs which is in close agreement with the size obtained from XRD analysis. It is clear from the images, the morphology of the Bi2O2CO3/CoFe2O4 composites from TEM images agreed with the SEM results.
The energy dispersive X-ray spectroscopy (EDX) was used to characterize the elemental composition of the as-prepared samples. The EDX spectra of CoFe2O4, Bi2O-2CO3 and Bi2O2CO3/CoFe2O430% are shown in Figure 5. The EDX spectrum of CoFe2O4 in Figure 5(a) shows the existence of Co, Fe and O elements as well as the EDX spectrum of Bi2O2CO3 (Figure 5(b)) shows the existence of Bi, C and O elements. In addition, the constituents of Bi2O2CO3/CoFe2O430% were studied by EDX method. As
frT?m	1 *•■*	* '
shown in Figure 5(c), the EDX elemental spectrum of the nanocomposite sample exhibits elemental peaks corresponding to both CoFe2O4 and Bi2O2CO3 and no other impure peaks can be observed, indicating that the composite sample is consisted of CoFe2O4 and Bi2O2CO3. In all samples, the presence of Au peak at 2.2 KeV is due to SEM-EDX sample holder.
Figure 4. TEM images of (a)-(c) Bi2O2CO3/CoFe2O430%, and (d) Bi2O2CO3/CoFe2O445% samples.
Figure 5. EDX spectra of (a) CoFe2O4, (b) Bi2O2CO3 and (c) Bi2O2CO3/CoFe2O430% nanocomposite.
To further determine the composition and element distributions of Bi2O2CO3/CoFe2O430% composite, EDX mapping measurements were also carried out. Figure 6 shows a representative SEM image of the nanocomposite with corresponding EDX elemental mappings. From the maps in Figure 6(b)-(f), can be observed that the Bi, C, O, Co and Fe elements are uniformly distributed over the sample, confirming the homogeneity of the nanocomposite. The EDX elemental mappings of the Bi2O2CO3/ CoFe2O430% composite (Figures 6(e) and (f)) display that the elements of Co and Fe from CoFe2O4 phase are distributed on the surface of the Bi2O2CO3. The EDX mappings results further indicate that the Bi2O2CO3/CoFe2O4 nano-composites have been successfully synthesized.
The optical properties of the as-prepared Bi2O2CO3, CoFe2O4 and Bi2O2CO3/CoFe2O4 composites were investigated by the diffuse reflectance UV-vis spectra (DRS) absorption spectroscopy (Figure 7). Figure 7(a) displays the UV-vis diffuse reflectance spectra of the bare Bi2O2CO3 (curve i), Bi2O2CO3/CoFe2O430% composite (curve ii) and CoFe2O4 (curve iii). Bare Bi2O2CO3 shows absorption edge at ~400 nm whereas pure CoFe2O4 shows good ab-sorbance in the visible light region up to 490 nm. As can be
Figure 6. SEM image and the corresponding elemental mapping images of Bi2O2CO3/CoFe2O430%.
seen in curve ii of Figure 7(a), the UV-vis band of Bi2O2 CO3/CoFe2O4 nanocomposite indicates an enhancement in absorption intensity in the visible region together with a red shift, compared to that of the pure Bi2O2CO3 due to the coupling with CoFe2O4 phase. The band gaps (Egs) of these three samples were calculated by the following formula based on the DRS results:57
(ahv)1/2 =B(hv-Eg)
(1)
Where a, h, v and B are absorption coefficient, plank constant, light frequency, and a constant, respectively. Therefore, Eg value of the samples can be estimated from a
plot (ahv)1/2 versus photon energy (hv). The intercept of the tangent to the x axis would give an approximation of the band-gap energy of the samples (Figure 7(b)). As shown in Figure 7(b) (curves i-iii), the Eg values of pure Bi2O2CO3, Bi2O2CO3/CoFe2O430% nanocomposite and pure CoFe2O4 were found to be 3.49, 2.89 and 2.79 eV, respectively. It is clear that the Bi2O2CO3/CoFe2O430% composite shows a band gaps at 2.89 eV with a red shift compared to that of the pure Bi2O2CO3 (3.49 eV), indicating formation of hybrid heterostructures.
The elemental composition and oxidation states of Bi2O2CO3/CoFe2O430% sample were carefully analyzed by XPS. The full XPS spectrum in Figure 8(a) shows that the
20
15
S10 .c ö
(b)	
	SI I \v (iii)// / l Um 1
	III)
1.1 1.6 2.1 2.6 3.1 3.6 4.1 hv(eV>
Figure 7. (a) UV-vis diffuse reflectance spectra and (b) (ahv)2 versus hv curves of (i) pure Bi2O2CO3 (ii) Bi2O2CO3/CoFe2O430% and (iii) CoFe2O4.
Figure 8. (a) XPS survey spectrum of the Bi2O2CO3/CoFe2O430% nanocomposite. High-resolution XPS spectra of (b) Bi 4f, (c) C 1s, (d) O 1s, (e) Co 2p and (f) Fe 2p.
sample consists of Bi, O, C, Co and Fe elements, in consistent with the EDX results. In order to further investigate the chemical state of each element, the high-resolution XPS spectra of Bi 4f, C 1s, O 1s, Co 2p and Fe 2p for the as-prepared Bi2O2CO3/CoFe2O430% are separately shown in Figure 8(b)-(e). As shown in Figure 8(b), the peaks located at binding energies of 159.08 and 164.39 eV are attributed to Bi 4f7/2 and Bi 4f5/2, respectively, indicating the existence of Bi3+ ions in the sample.58 In Figure 8(c), the peak at 284.78 eV is attributed to carbon reference, while the peak at 288.73 eV corresponds to the carbon of carbonate ion (CO32-) in Bi2O2CO3.58 For the oxygen element (Figure 8(d)), the O 1s peaks are well fitted into three different peaks at 529.73 eV, 530.68eV and 532 eV. According to the experiment results, the peak located at 529.73 eV is arisen from Bi-O in Bi2O2CO3 while that at 530.63 eV is from CO32- species and CoFe2O4.59 Other small peak at higher binding energy of 532 eV can be attributed to the presence of surface-chemisorbed adsorbed H2O.60 As shown in Figure 8(e), the peaks at 979.91 eV and 795.67 eV could be assigned to Co 2p3/2 and Co 2p1/2, respectively, shouldering with satellite peaks at 785.29 eV and 802.27 eV. Figure 8(f) shows Fe 2p peaks at binding energies of 710.35 eV (Fe 2p3/2) and 724.24 eV (Fe 2p1/2) with weak satellite peaks at 718.50 eV and 733.04 eV. The observed Co 2p and Fe 2p photoelectron peaks are consistent with those reported for Co2+ and Fe3+ in CoFe2O4.61 The above results
can powerfully support the presence of CoFe2O4 in the as-prepared Bi2O2CO3/CoFe2O4 sample, implying the formation of heterojunction between CoFe2O4 and Bi2O2CO3 in the resulted composite.
The BET surface area and porous structure of the Bi2O2CO3/CoFe2O4 composite were investigated based on nitrogen adsorption-desorption. Figure 9 gives the adsorption-desorption isotherms and the corresponding pore size distribution curve of the Bi2O2CO3/CoFe2O430% sample. As observed in Figure 9, the sample shows a typeIII isotherm according to the IUPAC classification.62 The isotherm shows a distinct H3 hysteresis loop in the relatively high pressure range (p/p0 = 0.8-1). Generally, it is believed that the H3 hysteresis loop is related to the mes-opores through the aggregates of plate-like particles which were further observed from the corresponding pore size distribution curve in the inset of Figure 9.63 The obtained BET specific surface area of the Bi2O2CO3/ CoFe2O430% sample is 88.09 m2 g-1, whereas that of the Bi2O2CO3 sample is 8.7 m2 g-1.63 Accordingly, it is clear that the BET surface area of the Bi2O2CO3/CoFe2O430% catalyst is much larger (about 10 times) than that of pure Bi2O2CO3. The increased surface area may be also beneficial for the increase of active sites and catalytic activities. The total pore volume is 0.297 cm3/g and the average pore size of this sample is 1.27 nm, which is estimated using the Barrett-Joyner-Halenda (BJH) method from the ad-
160
0-i-1-1-1-1-1-1-1-1-1-
0.0 0.1 0.2 0.3 0.4 O.S 0.6 0.7 0.8 0.9 1.0 Relative pressure (p/poi
Figure 9. N2 adsorption-desorption isotherm of the Bi2O2CO3/ CoFe2O430% sample. The inset is the pore size distribution curve.
sorption branch of the N2 isotherm as shown in the inset of Figure 9.
Figure 10 shows the magnetization measurement for the as-prepared Bi2O2CO3/CoFe2O4 nanocomposites and pure CoFe2O4, using a vibrating sample magnetometer (VSM) at room temperature. The magnetization curves of the nanocomposites undoubtedly indicate ferromagne-tism orders due to the presence of ferromagnetic CoFe2O4 nanoparticles. The saturation magnetization values of Bi2O2CO3/CoFe2O430%, Bi2O2CO3/CoFe2O445% and pure CoFe2O4 were found to be 17.15, 28.68 and 63.36 emu/g, respectively. The saturation magnetizations of the magnetic nanocomposites decrease compared with that of pure CoFe2O4, which can be attributed to the nano-mag-netic Bi2O2CO3 component. As demonstrated in the inset
so-H—i—i—i—i—i—i—i——i—]—i—i—i—i—i—r
-10000 -7500 -5000 -2500 0 2500 5000 7500 10000 Magnetic feild (Oe)
Figure 10. Magnetization curves of (a) pure CoFe2O4, (b) Bi2O-2CO3/CoFe2O445% and (c) Bi2O2CO3/CoFe2O430%, The photo inset shows magnetic separation of the nanocomposite catalyst before and after the reduction of 4-NP by NaBH4.
of Figure 10, complete separation of the catalyst colloids from the solution can be achieved under an external magnetic field. The rapid and easy magnetically separation of hybrid from water will assure the effective collection of the used catalysts and avoid the loss of nanoparticles for environmental risks.
3. 2. Catalytic Reduction of 4-Nitrophenol
To investigate the catalytic activity of Bi2O2CO3/ CoFe2O4 nanostructures with different contents of CoFe2O4, the reduction of 4-nitrophenol (4-NP) to 4-ami-ophenol (4-AP) by excess NaBH4 in aqueous solution was used as the model reaction (Figure. 11). Usually, 4-NP solution exhibits a strong absorption peak at 317 nm and a weak shoulder peak at 400 nm in the region of 250-550 nm.64 After alkali NaBH4 is added into 4-NP solution, the absorption peak at 317 nm disappears; only the one at 400 nm exists and markedly increases, which should be attributed to the production of the intermediate state, 4-nitro-phenolate ion.65 The intermediate can stably exist for a couple of day still a catalyst is introduced into the above system. Here, the peak at 400 nm gradually decreases, and concomitantly, a new peak at 305 nm appears due to the production of 4-AP.66,67 Figure 11(a) exhibits the UV-vis absorption spectra of the 4-NP-NaBH4-H2O system after reacting for various durations in the presence of 5 mg pure Bi2O2CO3 nanostructures. One can easily find that the peak intensity at 400 nm markedly decreases with the prolonging of the reaction time and disappeared after 32 min. However, Bi2O2CO3 nanostructures with different contents of CoFe2O4 exhibit different catalytic activities for the reduction of 4-NP. As shown in Figure 11(b), it merely took 20 min to completely convert 4-NP to 4-AP in the presence of Bi2O2CO3/CoFe2O430% nanocomposite. After the same amount of Bi2O2CO3/CoFe2O445% was used as the catalyst, it took 60 min to complete the reaction (Figure 11(c)). Namely, among various samples, Bi2O2CO3/ CoFe2O430% bears the strongest catalytic activity. Introduction of CoFe2O4 in the composite significantly improves the catalytic activities of Bi2O2CO3. However, an excess addition of CoFe2O4 showed decrease in catalytic efficiencies. In the present work, the reduction reaction of 4-NP to 4-AP could be reasonably assumed as a pseudo-first-order kinetics with regard to 4-NP owing to the presence of excess NaBH4. This pseudo-first-order kinetics equation can be described as lnC0/Ct = kt. Here, C0 and Ct represent the initial and instantaneous concentrations of 4-NP, respectively; and k and t stand for the apparent rate constant and the reaction time in turn. The apparent rate constant values were calculated from the slope of plot of ln (C0/Ct) versus reaction time (Figure 11(d)). The apparent rate constant (k) value for the Bi2O2CO3/CoFe2O430% sample (0.20 min-1) was estimated which is higher than Bi2O2CO3/CoFe2O445% (0.04 min-1) and pure Bi2O2CO3 (0.13 min-1) samples. From the observed results, it was ev-
Figure 11. UV-vis spectral changes during the reduction of4-NP with NaBH4 over different catalysts: (a) pure Bi2O2CO3, (b) Bi2O2CO3/CoFe2O430%, (c) Bi2O2CO3/CoFe2O445% and (d) Plot of ln(C0/Ct) against the reaction time (the inset is the apparent rate constant values). Conditions: 4-NP (2 mL, 0.2 mM), catalyst (5.0 mg), NaBH4 (0.5 mL, 20 mM), at 25 °C.
ident that the catalytic activity deteriorates with increasing CoFe2O4 content, showing that the loading percentage and intimate contact between two materials play an important role in determining catalytic efficiency. This means that with higher content of CoFe2O4 the number of the active catalytic reaction sites decreases and cause a negative influence on the catalytic processes. Excessive amount of
Figure 12 (a) Plot of ln (C0/C) against the reaction time in the presence of different amounts of Bi2O2CO3/CoFe2O430% catalyst, and (b) the apparent rate constant values). Conditions: nitro compounds (2 mL, 0.2 mM) and NaBH4 (0.5 mL, 20 mM), at 25 °C were used in all reactions.
CoFe2O4 may cover the active sites at the surface of Bi2O-2CO3 and also could hinder the contact with 4-NP. The highest catalytic performance of Bi2O2CO3/CoFe2O430% composite can be attributed to intimate contact between Bi2O2CO3 and CoFe2O4 which facilitates the electron transfer. Moreover, the existence of CoFe2O4 in composites makes them magnetically separable during catalytic reactions.
The effect of the catalyst amount on the catalytic efficiency was investigated as well. Figure 12(a) shows linear relationships between ln(C0/Ct) and the reaction time in the presence of different amounts of Bi2O2CO3/ CoFe2O430% nanostructure. As shown in Figure 12(b), the rate constants (kapp) of 4-NP reduction reaction were calculated to be 0.04, 0.20, 0.51, 0.63 and 0.66 min-1 from the slope of the straight with various amount of Bi2O2CO3/ CoFe2O430% catalyst. The kapp increased as the amount of Bi2O2CO3/CoFe2O430% catalyst increasing from 2.5 to 20 mg. A higher dosage of Bi2O2CO3/CoFe2O430% nano-composite in the solution provides more active sites for the
generation of H2 and e- (from NaBH4), led to an increased reaction rate.
Furthermore, it was found that the present catalyst could also catalyze the reduction of other aromatic nitro-compounds including 4-nitroaniline (4-NA), 2-nitroani-line (2-NA) and 2-nitrophenol (2-NP), to corresponding amines. Figure 13(a)-(c) shows the reduction of three ni-troarene by NaBH4 in the presence of Bi2O2CO3/ CoFe2O430% nanocomposite. The reductive reactions were completed within 15 min (for 4-NA), 29 min (for 2-NA) and 16 min (for 2-NP), respectively. The calculated reaction rate constants (kapp) for these substrates are displayed in Fig. 13(d). The kjpp values of these substrates are as the following order: 4-NA (0.24 min-1) > 2-NP (0.23 min-1) >2-NA (0.1 min-1). Since the reactions were carried out under the same experimental conditions, the different rates can be related to the structures of nitrocompounds.
In addition to catalytic activity, the stability and reusability of catalysts are important issues for their practical applications. The stability of as synthesized Bi2O2CO3/
Figure 13. The UV-vis absorption spectra change for the reduction process of (a) 4-nitroaniline (4-NA), (b) 2-nitroaniline (2-NA), and (c) 2-nitro-phenol (2-NP) with NaBH4 in the presence of Bi2O2CO3/CoFe2O430% catalyst. (d) the calculated apparent rate constant values. Conditions: catalyst (5.0 mg), NaBH4 (0.5 mL, 20 mM), and nitro compound (2 mL, 0.2 mM) at 25 °C.
Figure 14. Recyclability of the of Bi2O2CO3/CoFe2O430% nano-composite in the reduction of 4-NP. Conditions: catalyst (5.0 mg), [4-NP] = 0.2 mM and [NaBH4] = 20 mM, at 25 °C.
CoFe2O4 30% catalyst was checked by performing four consecutive cycles. The catalyst used in any experiment was collected by external magnetic field, washed with distilled water, dried at 60 °C and then employed for a new run without any observable weight loss. As shown in Figure 14, no significant loss of the catalytic activity can be observed after five successive runs of 4-NP reduction, indicating that the present composite catalysts are stable enough during the repeated experiments.
The nature of the recovered catalyst was also tested. As shown in Figure 15 (a) and (b), XRD pattern and FT-IR spectrum of the recycled Bi2O2CO3/CoFe2O430% nano-composite catalyst did not show significant changes after the fourth run in comparison with the fresh catalyst (see Figures 1(c) and 2(c)). Figures 15(c) and (d) show the SEM and TEM images of the catalyst after five cycles, respectively. It could be observed that the recovered catalyst kept its initial size and morphology (see Figures 3(e)-(f) and 4) and the surface of Bi2O2CO3 nanoplates was still decorated with CoFe2O4 nanoparticles, revealing the strong binding
mu1
«g
1
fit*
2 Kl #
Figure 15. (a) XRD pattern, (b) FT-IR spectrum, (c) SEM image, and (d) TEM image of the recovered Bi2O2CO3/CoFe2O430% nanocomposite after the 5th run.
between the CoFe2O4 nanoparticles and Bi2O2CO3 nano-plates. Therefore, the as-prepared Bi2O2CO3/CoFe2O4 composites can work as an effective catalyst for the of reduction nitroaromatic compounds with good stability and recyclability.
In order to show the advantage of the present method, we have compared the obtained results in the reduction of 4-NP with NaBH4 catalyzed by Bi2O2CO3/ CoFe2O430% with some reported catalysts in the litera-ture.68-80 From Table 1, it is clear that with respect to the reaction conditions and/or reaction times, the present method is more suitable and/or superior. It is clear that reaction in the presence of most reported catalysts required longer reaction times (Table 1, entries 1-10). However, the present catalyst showed close or lower catalytic activity compared with some of the catalysts (Table 1, entries 11 and 12). Also, the results confirms that this magnetic catalyst has higher catalytic activity than that of the previously reportedBi2O2CO3/NiFe2O430% catalyst in the reduction of 4-nitrophenol to 4-aminophenol under same conditions (Table 1, entries 13 and 14). Furthermore, the present nanocomposite can be easily prepared in one-step without the use of harsh, toxic and expensive chemicals which is very important in practical applications.
metals such as Au, Ag, Pt and Pd, Bi2O2CO3/CoFe2O4 composites were easy to available and inexpensive. The preparation procedure of Bi2O2CO3/CoFe2O4 magnetic nanocomposites via hydrothermal method was simple. And the as-prepared Bi2O2CO3/CoFe2O4 magnetic nano-composites were stable and well-dispersed. Moreover, the prepared Bi2O2CO3/CoFe2O4 nanocomposites were magnetically separable from water with higher long-time use stability. This study provides a new approach for reducing and removing nitroarenes pollutants (e.g. 4-NP) in wastewater without introducing secondary pollutant into the system. Studies on the synthesis of nanocompos-ites of Bi2O2CO3 with other ferrites (MFe2O4; M = Ni, Zn, Cu, Mn, ...) and their thermal catalytic and photocatalyt-ic applications are currently in progress and underway in our laboratory.
5. Acknowledgements
This work was supported by the Lorestan University Research Council and Iran Nanotechnology Initiative Council (INIC).
Table 1. Comparison of the result obtained for the complete reduction of 4-NP in the present work with those obtained by some reported catalysts.
Entry	Catalyst	Reaction conditions	Reaction time (min)	Ref.
1	Ni-PVA/SBA-15	H2O, NaBH4, r.t.	85	68
2	Hierarchical Au/CuO NPs	H2O, NaBH4, r.t	80	69
3	Cu NPs	THF/H2O, NaBH4, 50 °C	120	70
4	PdCu/graphene	EtOH/H2O, NaBH4, 50 °C	90	71
5	Au-GO	H2O, NaBH4, r.t.	30	72
6	CoFe2O4 NPs	H2O, NaBH4, r.t.	50	73
7	FeNi2 nano-alloy	H2O, NaBH4, r.t	60	74
8	NiCo2 nano-alloy	H2O, NaBH4, r.t.	30	75
9	CdS/GO	H2O, NaBH4, r.t.	30	76
10	dumbbell-like CuO NPs	H2O, NaBH4, r.t.	32	77
11	Ni NPs	H2O, NaBH4, r.t.	16	78
12	CuFe2O4 NPs	H2O, NaBH4, r.t.	14	79
13	Bi2O2CO3/NiFe2O430%	H2O, NaBH4, r.t.	42	80
14	Bi2O2CO3/CoFe2O430%	H2O, NaBH4, r.t.	20	This work
4. Conclusions
To conclude, a series of novel plate-like Bi2O2CO3/ CoFe2O4 magnetic nanocomposites were successfully synthesized via a simple hydrothermal method for the first time and applied to catalyze the reduction of ni-troarenes. Compared with the individual Bi2O2CO3 and CoFe2O4, the composite catalysts exhibit higher catalytic performance and stability for 4-nitrophenol reduction under ambient conditions. Compared with those noble
6. References
1.	J. R. Chiou, B. H. Lai, K. C. Hsu and D. H. Chen, J. Hazard. Mater. 2013, 248, 394-400. DOI:10.1016/j.jhazmat.2013.01.030
2.	Y. Shaoqing, H. Jun and W. Jianlong, Radiat. Phys. Chem. 2010, 79, 1039-1046. DOI:10.1016/j.radphyschem.2010.05.008
3.	A. C. Apolinario, A. M. Silva, B. F. Machado, H. T. Gomes, P. P. Araujo, and J. L. Figueredo, Appl. Catal. B: Environ. 2008, 84, 75-86. DOI:10.1016/j.apcatb.2007.12.018
4.	V. Maurino, C. Minero, E. Pelizzetti, P. Piccinini, N. Serpone
and H. Hidaka, J. Photochem. Photobiol. A: Chem. 1997, 109, 171-176. D01:10.1016/S1010-6030(97)00124-X
5.	P. Xiong, Y. Fu, L. Wang and X. Wang, J. Chem. Eng. 2012, 195, 149-157. D0I:10.1016/j.cej.2012.05.007
6.	F. R. Zaggout and N. A. Ghalwa. J. Environ. Manag. 2008, 86, 291-296. D0I:10.1016/j.jenvman.2006.12.033
7.	X. Zhu and J. Ni, Electrochim. Acta, 2011, 56, 10371-10377. D0I:10.1016/j.electacta.2011.05.062
8.	Y. Y. Chu, Y. Qian, W. J. Wang and X. Deng, J. Hazard. Mater. 2012, 199, 179-185. D0I:10.1016/j.jhazmat.2011.10.079
9.	C. Rizhi, D. Yan, X. Weihong and X. Nanping, Chin. J. Chem. Eng. 2007, 15, 884-888. D0I:10.1016/S1004-9541(08)60019-1
10.	Z. Wu, J. Chen, Q. Di and M. Zhang, Catal. Commun. 2012, 18, 55-59. D0I:10.1016/j.catcom.2011.11.015
11.	Y. Du, H. Chen, R. Chen and N. Xu, Appl. Catal. A: Gen. 2004, 277, 259-264. D0I:10.1016/j.apcata.2004.09.018
12.	K. I. Min, J. S. Choi, Y. M. Chung, W. S. Ahn, R. Ryoo and P. K. Lim, Appl. Catal. A: Gen. 2008, 337, 97-104. D0I:10.1016/j.apcata.2007.12.004
13.	T. Aditya, A. Pal and T. Pal, Chem. Commun. 2015, 51, 94109431 and reference cited therein.
14.	T. R. Mandlimath and B. Gopal, J. Mol. Catal A: Chem. 2011, 350, 9-15. D0I:10.1016/j.molcata.2011.08.009
15.	Y. C. Chang and D. H. Chen, J. Hazard. Mater. 2009, 165, 664-669. D0I:10.1016/j.jhazmat.2008.10.034
16.	Y. Deng, Y. Cai, Z. Sun, J. Liu, C. Liu, J. Wei, W. Li, C. Liu, Y. Wang and D. Y. Zhao, J. Am. Chem. Soc. 2010, 132, 84668473. D0I:10.1021/ja1025744
17.	S. Harish, J. Mathiyarasu, K. Phani and V. Yegnaraman, Catal. Lett. 2009, 128, 197-202. D0I:10.1007/s10562-008-9732-x
18.	J. Huang, S. Vongehr, S. Tang, H. Lu, J. Shen and X. Meng, Langmuir, 2009, 25, 11890-11896. D0I:10.1021/la9015383
19.	H. Koga and T. Kitaoka, J. Chem. Eng. 2011, 168, 420-425. D0I:10.1016/j.cej.2010.08.073
20.	P. Liu and M. Zhao, Appl. Surf. Sci. 2009, 255, 3989-3993. D0I:10.1016/j.apsusc.2008.10.094
21.	J. Wang, X. B. Zhang, Z. L. Wang, L. M. Wang, W. Xing and X. Liu, Nanoscale, 2012, 4, 1549-1552. D0I:10.1039/c2nr11912a
22.	Y. Zhu, J. Shen, K. F. Zhou, C. Chen, X. Yang and C. Li, J. Phys. Chem. C, 2010, 115, 1614-1619. D0I:10.1021/jp109276q
23.	F. H. Lin and R. A. Doong, J. Phys. Chem. C, 2011, 115, 65916598. D0I:10.1021/jp110956k
24.	K. Jiang, H. X. Zhang, Y. Y. Yang, R. Mothes, H. Lang and W. B. Cai, Chem. Commun. 2011, 47, 11924-11926. D0I:10.1039/c1cc14675k
25.	H. He and C. Gao, J. Nanomater. 2011, 2011, 1-10.
26.	X. Du, J. He, J. Zhu, L. Sun and S. An, Appl. Surf. Sci. 2012, 258, 2717-2723. D0I:10.1016/j.apsusc.2011.10.122
27.	D. Y. Li, Y. G. Zhang, Y. L. Zhang, X. F. Zhou and S. J. Guo, J. Hazard. Mater. 2013, 258-259, 42-49. D0I:10.1016/j.jhazmat.2013.02.058
28.	R. G. Li, F. X. Zhang, D. G. Wang, J. X. Yang, M. R. Li, J. Zhu, X. Zhou, H. X. Han and C. Li, Nat. Commun. 2013, 4, 1432. D0I:10.1038/ncomms2401
29.	S. M. Sun, W. Z. Wang and L. Zhang, J. Phys. Chem. C, 2013,117, 9113-9120. D0I:10.1021/jp4004592
30.	G. H. Tian, Y. J. Chen, W. Zhou, K. Pan, Y. Z. Dong, C. G. Tian and H. G. Fu, J. Mater. Chem. 2011, 21, 887-892. D0I:10.1039/C0JM03040F
31.	X. Zhao, J. H. Qu, H. J. Liu and C. Hu, Environ. Sci. Technol. 2007, 41, 6802-6807. D0I:10.1021/es070598b
32.	J. Jiang, K. Zhao, X. Y. Xiao and L. Z. Zhang, J. Am. Chem. Soc. 2012, 134, 4473-4476. D0I:10.1021/ja210484t
33.	Y. N. Wang, K. J. Deng and L. Z. Zhang, J. Phys. Chem. C,
2011,	115, 14300-14308. D0I:10.1021/jp2042069
34.	L. Ye, J. Liu, C. Gong, L. Tian, T. Peng and L. Zan, ACS Catal.
2012,	2, 1677-1683. D0I:10.1021/cs300213m
35.	Z. Ni, Y. Sun, Y. Zhang and F. Dong, Appl. Surf. Sci. 2016, 365, 314-335. D0I:10.1016/j.apsusc.2015.12.231
36.	R. Hu, X. Xiao, S. Tu, X. Zuo and J. Nan, Appl. Catal. B: Environ. 2015, 163, 510-519. D0I:10.1016/j.apcatb.2014.08.025
37.	Q. Wang, G. Yun, Y. Bai, N. An, J. Lian, H. Huang and B. Su, Appl. Surf. Sci. 2014, 313, 537-544. D0I:10.1016/j.apsusc.2014.06.018
38.	H. Lu, L. Xu, B. Wei, M. Zhang, H. Gao and W. Sun, Appl. Surf. Sci. 2014, 303, 360-366. D0I:10.1016/j.apsusc.2014.03.006
39.	N. Guo, Y. Cao, Y. Rong and D. Jia, RSC Adv. 2016, 6, 106046106053
40.	J. Cao, X. Li, H. Lin, S. Chen and X. Fu, J. Hazard. Mater. 2012, 239, 316-324. D0I:10.1016/j.jhazmat.2012.08.078
41.	X. Huang and H. Chen, Appl. Surf. Sci. 2013, 284, 843-848. D0I:10.1016/j.apsusc.2013.08.019
42.	N. Liang, J. Zai, M. Xu, Q. Zhu, X. Wei and X. Qian, J. Mater. Chem. A, 2014, 2, 4208-4216. D0I:10.1039/c3ta13931j
43.	Y. Ao, L. Xu, P. Wang, C. Wang, J. Hou and J. Qian, Dalton Trans., 2015, 44, 11321-11330. D0I:10.1039/C5DT01168J
44.	Y. Liu, P. Zhang, H. Lv, J. Guang, S. Li and J. Jiang, RSC Adv. 2015, 5, 83764-83772.
45.	Q. Zhang, H. Y. Wang, S. Z. Hu, G. Lu, J. Bai, X. X. Kang, D. Liu and J. Z. Gui, RSC Adv. 2015, 5, 42736-42743.
46.	N. Liang, M. Wang, L. Jin, S. S. Huang, W. L. Chen, M. Xu, Q. Q. He, J. T. Zai, N. H. Fang and X. F. Qian, ACS Appl. Mater. Interfaces, 2014, 6, 11698-11705. D0I:10.1021/am502481z
47.	L. Jin, G. Q. Zhu, M. Hojamberdiev, X. C. Luo, C. W. Tan, J. H. Peng, X. M. Wei, J. P. Li and P. Liu, Ind. Eng. Chem. Res. 2014, 53, 13718-13727. D0I:10.1021/ie502133x
48.	Y. Hu, C. Dong, K. L. Wu, S. H. Xia, X. Li and X. W. Wei, Mater. Lett. 2015, 147, 69-71. D0I:10.1016/j.matlet.2014.12.097
49.	T. Li, X. Hu, C. Liu, C. Tang, X. Wang and S. Luo, J. Mol. Catal. A: Chem. 2016, 425, 124-135. D0I:10.1016/j.molcata.2016.10.001
50.	X. Zhang, S. Li, S. Hua, J. Chen, W. Jiang, J. Zhang, L. Ji, L. Cai, Y. Wang, W. Song and J. Liu, Mater. Lett. 2016, 185, 50-53. D0I:10.1016/j.matlet.2016.08.086
51.	S. Shylesh, V. Schunemann, and W. R. Thiel, Angew. Chem., Int. Ed. 2010, 49, 3428-3459. D0I:10.1002/anie.200905684
52.	X. F. Shang, W. C. Lu, B. H. Yue, L. M. Zhang, J. P. Ni, Y. Lv and Y. L. Feng, Cryst. Growth Des. 2009, 9, 1415 -1420. D0I:10.1021/cg800730s
53.	G. E. Tobon-Zapata, S. B. Etcheverry and E. J. Baran, J. Mater. Sci. Lett. 1997, 16, 656-657. D0I:10.1023/A:1018527602604
54.	Y. S. Fu and X. Wang, Ind. Eng. Chem. Res. 2011, 50, 72107218. D0I:10.1021/ie200162a
55.	G. D. Hong, Y. Yamada, T. Nagatomi, Y. Takai and S. Fuku-zumi, J. Am. Chem. Soc. 2012, 134, 19572-19575. D0I:10.1021/ja309771h
56.	K. Modi, S. Shah, N. Pujara, T. Pathak, N. Vasoya and I. Jhala, J. Mol. Struct., 2013, 1049, 250-262. D0I:10.1016/j.molstruc.2013.06.051
57.	J. Gunjakar, A. More, K. Gurav and C. Lokhande, Appl. Surf. Sci., 2008, 254, 5844-5848 D0I:10.1016/j.apsusc.2008.03.065
58.	Y. C. Huang, W. J. Fan, B. Long, H. B. Li, F. Y. Zhao, Z. L. Liu, Y. X. Tong and H. B. Ji, Appl. Catal. B: Environ. 2015, 185, 68-76. D0I:10.1016/j.apcatb.2015.11.043
59.	D. D. Hu, K.Y. Zhang, Q. Yang, M. J. Wang, Y. Xi and C. G. Hu, Appl. Surf. Sci., 2014, 316, 93-101. D0I:10.1016/j.apsusc.2014.07.185
60.	H. J. Lu, L. L. Xu, B. Wei, M. Y. Zhang, H. Gao and W. J. Sun, Appl. Surf. Sci. 2014, 303, 360-366. D0I:10.1016/j.apsusc.2014.03.006
61.	S. Singh and N. Khare, RSC Adv. 2015, 5, 96562-96572.
62.	P. Madhusudan, J. Yu, W. Wang, B. Cheng and G. Liu, Dalton Trans. 2012, 41, 14345-14353. D0I:10.1039/c2dt31528a
63.	L. Xu, X. Yang, Z. Zhai and W. Hou, CrystEngCommun. 2011, 13, 7267-7275. D0I:10.1039/c1ce05671a
64.	Z. Jin, M. Xiao, Z. Bao, P. Wang and J. Wang, Angew. Chem., Int. Ed. 2012, 51, 6406-6410. D0I:10.1002/anie.201106948
65.	A. K. Patra, A. Dutta and A. Bhaumik, Catal. Commun. 2010, 11, 651-655. D0I:10.1016/j.catcom.2010.01.015
66.	H. Li, J. K. Jo, L. Zhang, C. S. Ha, H. Suh and I. Kim, Adv. Funct. Mater. 2010, 20, 3864-3873. D0I:10.1002/adfm.201001067
67.	M. Nemanashi and R. Meijboom, J. Colloid Interface Sci., 2013, 389, 260-267. D01:10.1016/j.jcis.2012.09.012
68.	R. J. Kalbasi, A. A. Nourbakhsh and F. Babaknezhad, Catal. Commun. 2011, 12, 955-960. D0I:10.1016/j.catcom.2011.02.019
69.	S. Y. Gao, X. X. Jia, Z. D. Li and Y. L. Chen, J. Nanopart. Res. 2012, 14, 1-11.
70.	Z. Duan, G. Ma and W. Zhang, Bull. Korean Chem. Soc. 2012, 33, 4003-4006. D0I:10.5012/bkcs.2012.33.12.4003
71.	A. K. Shil, D. Sharma, N. R. Guha, and P. Das, Tetrahedron Lett. 2012, 53, 4858-4861. D0I:10.1016/j.tetlet.2012.06.132
72.	Y. Choi, H. S. Bae, E. Seo, S. Jang, K. H. Park and B. S. Kim, J. Mater. Chem. 2011, 21, 15431-15436. D0I:10.1039/c1jm12477c
73.	M. Nasrollahzadeh, M. Bagherzadeh and H. Karimi, J. Colloid Interface Sci. 2016, 465, 271-278. D0I:10.1016/j.jcis.2015.11.074
74.	K. L. Wu, R. Yu and X. W. Wei, Cryst. Eng. Commun. 2012, 14, 7626-7632. D0I:10.1039/c2ce25457c
75.	K. L. Wu, X. W. Wei, X. M. Zhou, D. H. Wu, X. W. Liu, Y. Ye and Q. Wang, J. Phys. Chem. C. 2011, 115, 16268-16274. D0I:10.1021/jp201660w
76.	S. Liu, Z. Chen, N. Zhang, Z. R. Tang and Y. J. Xu, J. Phys. Chem. C. 2013, 117, 8251-8261. D0I:10.1021/jp400550t
77.	W. Che, Y. Ni, Y. Zhang and Y. Ma, J. Phys. Chem. Solid. 2015, 77, 1-7. D0I:10.1016/j.jpcs.2014.09.006
78.	D. Z. Jiang, J. Xie, D. Jiang, X. Wei and M. Chen, Cryst. Eng. Comm. 2013, 15, 560-569. D0I:10.1039/C2CE26398J
79.	J. Feng, L. Su, Y. Ma, C. Ren, Q. Guo and X. Chen, Chem. Eng. J. 2013, 221,16-24. D0I:10.1016/j.cej.2013.02.009
80.	P. Zarringhadam and S. Farhadi, J. Alloys Compd. 2017, 729, 1046-1057. D0I:10.1016/j.jallcom.2017.09.247
Povzetek
Nove magnetne nanodelce Bi2O2CO3/CoFe2O4 smo pripravili s hidrotermalno sintezo. Infrardečo spektroskopijo (FT-IR), rentgensko difrakcijo (XRD), vrstično elektronsko mikroskopijo (SEM), energijsko disperzivno spektroskopijo rentgenskih žarkov (EDX), presevno elektronsko mikroskopijo (TEM), rentgensko fotoelektronsko spektroskopijo (XPS), UV-Vis difuzno refleksijsko spektroskopijo (DRS), magnetometer z vibrirajočim vzorcem (VSM) in adsorpcijsko deso-rpcijsko analizo N2 smo uporabili za preučevanje strukture, morfologije, velikosti delcev, fazne sestave, optičnih in magnetnih lastnosti sintetiziranih nanokompozitov. Rezultati karakterizacije vzorcev so pokazali uspešno vezavo sferičnih nanodelcev CoFe2O4 in ploščam podobnih nanostruktur Bi2O2CO3. Katalitično aktivnost magnetnih nanokampozitov Bi2O2CO3/CoFe2O4 smo ocenili z redukcijo nekaterih aromatičnih nitro-spojin, kot so nitrofenoli in nitroanilini, z uporabo vodne raztopine natrijevega borhidrida (NaBH4) pri sobni temperaturi. Nanokampozit Bi2O2CO3/CoFe2O4 s 30 % CoFe2O4 je pokazal najboljše rezultate pri redukciji aromatskih nitro spojin s popolno pretvorbo v ustrezne amino spojine v 15-30 minutah s konstanto hitrostjo 0,10-0,24 min-1. Poleg tega lahko magnetni nanokompozit Bi2O2CO3/ CoFe2O4 zlahka odstranimo iz reakcijskega sistema z uporabo zunanjega magneta.
DOI: 10.17344/acsi.2018.4225	Acta Chim. Slov. 2018, 65, 462-469	©commohs
Scientific paper
Complex Formation in a Liquid-Liquid Extraction System Containing Vanadium(IV/V), 2,3-Dihydroxynaphtahlene and Thiazolyl Blue
Galya K. Toncheva,1 Zlatimir T. Zhelev,1 Vassil B. Delchev1 and Kiril B. Gavazov2^
1 Faculty of Chemistry, University of Plovdiv "Paisii Hilendarski", Plovdiv 4000, Bulgaria 2 Faculty of Pharmacy, Medical University of Plovdiv, Plovdiv 4002, Bulgaria * Corresponding author: E-mail: kgavazov@abv.bg Received: 28-01-2018
Abstract
Liquid-liquid extraction systems for Viv/v containing 2,3-dihydroxynaphtahlene (DN) and 3-(4,5-dimethylthi-azol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (thiazolyl blue, MTT) were studied. The optimum conditions for ViV and Vv extraction were found. ViV is extracted in chloroform as a 1:2:2 complex (V:DN:MTT) with Amax = 570 nm and £570 = 2.9 x 104 dm3 mol-1 cm-1. However, this wavelength was found unsuitable for precise spectrophotometric measurements due to time dependent absorbance changes. Vv forms predominantly a 1:1:1 complex with Amax = 335 nm. The calibration graph for this oxidation state is linear in the range of 0.06-1.5 |ig cm-3. The molar absorptivity, Sandell's sensitivity and limit of detection were calculated to be 1.6 x 104 dm3 mol-1 cm-1, 3.2 ng cm-2 and 0.02 |g cm-3, respectively. The ground-state equilibrium geometries of the anionic parts of the extracted ion-associates, [ViVO(DN2-)2] 2- and [Vv02(DN2-)]-, were optimized at the BLYP/6-31++G* level of theory.
Keywords: Vanadium(IV/V); 2,3-dihydroxynaphtahlene; ternary complex; liquid-liquid extraction; spectrophotometry; DFT calculations
1. Introduction
Vanadium is an essential trace element for living organisms1 and a pillar of modern technology2 with a potentially significant environmental impact due to human activity, such as the burning of fossil fuels, manufacturing of steel alloys, dyes, glass and ceramics, and application as a catalyst in various processes.2,3 Vanadium is the fifth most abundant transition element in the Earth's crust with an average content of 0.014%.3 Natural sources of airborne vanadium include continental dust, volcanic activity, marine aerosols and wild forest fires.2
It is known that prolong exposure to vanadium increases the risk of lung cancer and can damage the integumentary, respiratory, central nervous and digestive systems.4 The amount of vanadium resorbed in the gastrointestinal tract is a function of the oxidation state and coordination environment.5 The most important oxidation states of vanadium are IV and V. The ability to switch easily between them, along with the stereochemical
flexibility of this element6 are key factors that determine its role in biological systems.1,7
Vanadium deficiency in animal species is related to stunted growth, impaired reproduction, altered red blood cell formation, disturbed iron metabolism and abnormalities in blood lipid levels.2,8 There is an opinion among health specialists that vanadium deficiency can affect humans in a similar way.2 Insufficiently studied issues concerning the balance between its toxicity and essentiality8,9 define the necessity for vanadium determination in various samples and call for investigations of coordination compounds, which have the potential to be used for ViV/ Vv speciation.
Many methods have been proposed for vanadium determination and speciation.10-13 Very sensitive and cost effective are the spectrophotometric methods based on ternary complexes with catechol type ligands.14-19 However, the mechanism of colour development in some of these methods14,15 is debatable because it is not clear whether
the main spectral bands are due to the formation of coordination compounds or are products of reagent(s) oxidation and polymerization.20,21 On the other hand, it is difficult to find conditions for speciation analysis with such reagents as they are capable of reducing VV to VIV.19-26 In fact, little is known about the stabilizing effects of additional reagents on the initial oxidation state of vanadium in ternary complexes of this kind.
Several papers27-30 describe liquid-liquid extraction (LLE) of VV with 2,3-dihydroxynaphthalene (DN), a li-gand incorporating a catechol moiety, the interest in which has been revived thanks to Tarafder et al.31-33 In a previous paper,21 we compared the behaviour of VIV and VV in a LLE-chromogenic system involving DN and 2,3,5-triphe-nyl-2H-tetrazolium chloride (TTC). We found evidence for aggregation of the ternary complexes in the organic phase and shed light on the differences in the extraction mechanism for VIV and VV.
Here, we report results for LLE-chromogenic systems containing VIV or VV, DN and an alternative ion-association reagent: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe-nyl-2H-tetrazolium bromide (thiazolyl blue, MTT). MTT is a commercially available tetrazolium salt with many applications as a redox34 and ion-association reagent.35 MTT is known to have advantages over similar compounds in terms of stability and molar absorptivity of the obtained complexes35-38 and their applicability for Viv/Vv specia-tion analysis.26
2. Experimental Procedure and Theoretical Details 2. 1. Reagents and Apparatus
Stock VIV aqueous solution (ca. 5 x 10-2 mol dm-3) was prepared from VOSO4 ■ 5H2O (purum, Fluka AG, Switzerland) and standardized by potassium permanganate titration. Working solutions at a concentration of 2 x 10-4 mol dm-3 and pH ca. 3.0 were prepared daily by suitable dilution. VV solution (2 x 10-4 mol dm-3) was prepared by dissolving NH4VO3 (puriss. p.a., VEB Laborchemie Apolda, Germany) in water. Fresh DN chloroform solutions (2 x 10-3 mol dm-3) were prepared daily from the solid reagent (purum, Fluka AG, Switzerland). The concentration of MTT (p.a., LOBA Feinchemie GmbH, Austria) was 3 x 10-3 mol dm-3 (aqueous solution). The chloroform (p.a., Valerus, Bulgaria) was additionally distilled. The acidity of the aqueous medium was set by the addition of buffer solution, prepared by mixing 2.0 mol dm-3 aqueous solutions of CH3COOH and ammonia. pH was measured by a Hanna HI-83141 pH meter (Romania). Absorbance measurements were performed by using a Camspec M508 spectrophotometer (United Kingdom), equipped with 1 cm path-length glass cells. Distilled water was used throughout the work.
2. 2. Procedure
Aliquots of VIV or VV solution, buffer solution (1 cm3) and MTT solution were placed into 125 cm3 separa-tory funnels. The volume was made to 10 cm3 with water. An aliquot of DN chloroform solution was added and the organic phase was made up to 10 cm3 with chloroform. The funnel was shaken for a fixed time period (10-240 s). After the separation of the phases, a portion of the organic extract was transferred through filter paper into the spec-trophotometer cell. The absorbance was measured against chloroform or simultaneously prepared blank solution (containing all of the reagents with the exception of vanadium).
2. 3. Theoretical Details
The structures of the anionic coordination compounds were optimized at the BLYP/6-31++G* level of theory as described in the literature.21 The charge and multiplicity for [VIVO(DN2-)2]2- were set to -2 and doublet, respectively. The theoretical calculations were performed with the GAUSSIAN 03 program package. The results were visualized with the ChemCraft program.
3. Results and Discussion
The following variables were considered for the performed LLE-spectrophotometric optimisation experiments: organic solvent, wavelength for spectrophotomet-ric measurements, pH, extraction time and concentration of the reagents.
3. 1. Choice of Organic Solvent and Spectral Characteristics
Chloroform,21 dichloroethane,39 ethyl acetate29 and methyl isobutyl ketone30 were used in previous studies as extraction solvents for DN-containing complexes. Preliminary investigations showed that chloroform is the best solvent for the VIV/V-DN-MTT species. Absorption spectra of these species are shown in Fig 1. Fig. 1a includes spectra obtained with a low DN concentration (8.0 x 10-5 mol dm-3). Significant differences can be observed for the two oxidation states. The VIV complex (spectrum 1) has two intensive maxima (at 330 and 560 nm), while the VV complex (spectrum 2) is characterized by an intense maximum (at 335 nm). Another maximum for this oxidation state is at 680 nm; the corresponding band is broad and low intensive.
Spectra with a high DN concentration (1.6 x 10-3 mol dm-3) are depicted in Fig. 1b. The spectral changes accompanying the increase of the DN concentration can be attributed to reduction of VV to VIV. However, this reduction is only partial: there is no complete matching of the two spectra as observed under similar conditions in
our previous studies21 for the couple VV-DN-TTC and VIV-DN-TTC.
It should be mentioned that the absorbance of the blank is not stable in time (Fig. 1c). The increase of the ab-
a)
c)
o tf>
3
--1: V(tV)-DM-MTT
-2: V<V)-DN-MTT
......... 3; DN-MTT
300 400 500 600 700 800 900 Wavelength, nm
b)
1.6
— — 1: V(IV)-OM-MTT
-2 V(V)-DN-MTT
3: DN-MTT
400 500 600 700 Wavelength, nm
800
1.2
<u 0.8 o
TO
0.4
0.0
	-----0 min
	-5 ntn
	-10 min
	-IE mri
	-20 mil
	-25 min
	t -30 min
	^ -35 mil
	
300
400
500	600
Wavelength, nm
700
800
Figure 1. Absorption spectra in chloroform. a) At a low DN concentration, 8 x 10-5 mol dm-3: 1 - VIV-DN-MTT against blank; 2 -VV-DN-MTT against blank; 3 - blank (DN-MTT) against chloroform. Cv(iv) = CV(V) = 3 x 10-5 mol dm-3, Cmtt = 1.5 x 10-4 mol dm-3, pH 5, extraction time 2 min. b) At a high DN concentration, 1.6 x 10-3 mol dm-3: 1 - VIV-DN-MTT against blank; 2 - VV-DN-MTT against blank; 3 - blank (DN-MTT) against chloroform. Cv(iv) = CV(V) = 3 x 10-5 mol dm-3, Cmtt = 2.4 x 10-4 mol dm-3, pH 5, extraction time 2 min. c) Influence of time on the spectrum of the blank: cDN = 4 x 10-4 mol dm-3, cMTT = 1.0 x 10-4 mol dm-3, pH 5, extraction time 2 min.
sorbance at 580 nm fits well to a second order polynomial equation: y = -0.0001*2 + 0.0138x + 0.1477, R2 = 0.9996. The observed instability can be attributed to aggregation of the DN-MTT species in the organic phase. To eliminate this factor, in our further studies, we measured the absorb-ance at wavelengths outside the range of instability.
3. 2. Effect of pH
The effect of pH on the extraction is shown in Fig. 2. The absorbance of the VIV complex was measured at 335 (series 1) and 700 nm (series 1'). There are no significant differences in the pH profile for these wavelengths. This indicates that only one complex is extracted under the mentioned conditions (high DN concentration). Our further experiments were carried out at pH 5.0.
Series 2 represents the results for the complex obtained with VV. The course of the obtained curve is different, especially for the pH region above 5.5. This is in agreement with the concept that different complexes are formed with VIV and VV under the experimental conditions.
1.2
ID
0
c
TO
jO
	1_
o in
3
0.8
0.4
0.0
	■ 1: V[IV) 335 nm
	□ 1'; V(IV) 700 nm
■ ■ i • ■ ■	• 2: V(V) 335 nm ■
- • S □ a g • i	■ * * ' a • □ □
3,5
4.5
5.5 PH
6.5
7.5
Figure 2. Absorbance of the VIV complex (1 and 1') and VV complex (2) vs pH of aqueous phase. 1,1' - Cv(iv) = 4 x 10-5 mol dm-3, Cdn = 1.6 x 10-3 mol dm-3, cMTT = 1.0 x 10-4 mol dm-3, X = 335 nm (1) or 700 nm (1'); 2 - cV(V) = 3 x 10-5 mol dm-3, cDN = 6.0 x 10-4 mol dm-3, Cmtt = 1.0 x 10-4 mol dm-3, X = 335 nm, extraction time 2 min.
3. 3. Effect of Extraction Time
The influence of extraction time on the absorbance was followed in the interval from 10 seconds to 4 minutes. The results show that the time of 1.5 min is sufficient for quantitative extraction. Extraction times longer than 2.5 min can lead to a slight decrease of the absorbance. Hence, we extracted for 2 min in the further experiments.
3. 4. Effect of DN Concentration
The effect of DN concentration is shown in Fig. 3. Fig. 3a represents the results for VV. The absorbance at 335 nm is maximal when cDN > 6 x 10-4 mol dm-3. Fur-
a)
0.6
3
■ 0.4
3
0 2
• 1: 335 nm A 2: 650 nm


b)
o.s
« 0.4
<D
O
c
nj
jp
k_
o
S 0.2
0	2 4 Cm x 1(H, mol L"	6 8 1
		A A A
• • • • #	A *• A A A	
» A		• 1: 335 nm
		A 2: 700 nm 1 '_
5	10	15
cDN x 1 (H, mol L-i
20
Figure 3. Absorbance of extracted complexes of VV (a) and VIV (b) vs DN concentration. a) Cv(v) = 2 x 10-5 mol dm-3, cMTT = 1.5 x 10-4 mol dm-3, pH 5.5, X = 335 nm (1) and 650 nm (2). b) Cv(iv) = 2 x 10-5 mol dm-3 (1) or 4 x 10-5 mol dm-3 (2); cMTT = 3.5 x 10-4 mol dm-3 (1) or 1.0 x 10-4 mol dm-3 (2); pH 5.5 (1) or 5.0 (2); X = 335 nm (1) and 700 nm (2).
a)
<o
€
06
0.4
§ 0.2
• 1:	335 nm		
A 2:	650 nm		
	. • *	*	<
-	•		
•			
•a		A	1
%			
r			
0.0	0.5	1.0	1.5
eWTTx 10"4 mo! L-1
2.0
0.5
0.4
b)
3
<13
<u 0.3 <j
to
jD
o «
• •
• A *
0.2 ■
0.1
•	1: 335 nm
*	2: 700 nm
0	1	2	3	4	f
CMTT x 1 (H, mol L"1
Figure 4. Absorbance of extracted complexes of VV (a) and VIV (b) vs MTT concentration. a) Cv(v) = 3 x 10-5 mol dm-3, Cdn = 6.0 x 10-4 mol dm-3, pH 5.5, X = 335 nm (1) and 650 nm (2). b) cV(IV) = 2 x 10-5 mol dm-3 (1) or 3 x 10-5 mol dm-3 (2); cDN = 4.0 x 10-4 mol dm-3 (1) or 1.6 x 10-3 mol dm-3 (2); pH 5.0; X = 335 nm (1) and 700 nm (2).
ther studies were performed at this DN concentration. Fig. 3b shows the results for VIV. It is noteworthy that the saturation at the two wavelengths (335 and 700 nm) is achieved at different DN concentrations: 6 x 10-4 mol dm-3 (for 335 nm) and 1.4 x 10-3 mol dm-3 (for 700 nm). This can be explained with the formation of different ternary complexes (see below): a 1:1 (VIV:DN) complex with Amax close to 335 nm and a 1:2 (VIV:DN) complex with absorbance bands at higher wavelengths (Amax = 570 nm). Similar behaviour has been noticed in the VIV-DN-TTC system.21
3. 5. Effect of MTT Concentration
The effect of MTT concentration is shown in Fig. 4. Fig. 4a gives the results for VV at the optimum DN concentration (6 x 10-4 mol dm-3). The absorbance at 335 nm reach its maximal value for cmtt > 8 x 10-5 mol dm-3. Our further studies were performed at cmtt = 1 x 10-4 mol dm-3. The saturation curves for VIV are more complex (Fig. 4b). The absorbance steeply increases to about cmtt = 6 x 10-5 mol dm-3 and then decreases. A narrow plateau is
observed in the concentration range from 6 x 10 5 to 1.2 x 10-4 mol dm-3 for X = 335 nm.
3.6. Molar Ratios, Formulae and Equations
To determine the DN : V molar ratios in the ternary complexes, we used two methods: the straight line method of Asmus40 and the mobile equilibrium method41 (Fig. 5). These methods give reliable results for relatively weak chemical bonds.42,43 The MTT : V molar ratios were determined by the Yoe & Jones method44 (Fig. 6). The method is applicable for strong bonds,42,43 for which the two above-mentioned methods are usually inappropriate.
The results given in Fig. 5 (full markers; lines 1 and 1') show that there is a difference in the molar ratio for 335 nm (DN:VIV = 1:1) and 700 nm (DN:VIV = 2:1). Fig. 6a, in its turn, shows that the molar MTT:VIV ratio is 2:1 independently of the wavelength. Therefore, the composition of the two ternary complexes is 1:1:2 (VIV:DN:MTT; low DN concentration) and 1:2:2 (optimum conditions).
The following equation can be proposed for VIV extraction under the optimum conditions (Table 1):
Figure 5. Determination of the DN:VIV (1,1') and DN:VV (2,2') molar ratios by the mobile equilibrium method at different wavelengths. Straight line equations: 1) y = 0.97x + 4.45; 1') y = 2.01x + 6.66; 2) y = 1.00x + 4.41; and 2') y = 1.09x + 3.64.
VO2+(aq) + 2H2DN(org) + 2MTT+(aq) ^ (MTT+)2[VIVO(DN2-)2](org) + 4H+(aq)
(1)
The optimised ground-state geometry of the anionic chelate, [VivO(DN2-)2]2-, is shown in Fig. 7, structure I. In contrast to the VIV complex with DN and TTC21 for which a 1:2:1 composition has been determined (the anionic che-late in it contains one doubly deprotonated and one singly deprotonated ligand, structure II), the two DN ligands in the present research are doubly deprotonated. As a result, the four V-O bonds (with the oxygen atoms of DN) have
equal length (2.020 Â) and the structure is more stable. The dihedral angle between the two planar DN ligands is higher than that described in the literature.21 (Fig. 7, structure II) and the structure is not twisted: C19O24V25O22 = C5O21V25O23 = 152.7° and C4O22V25O24 = C^O^V^O^ = -152.7°. The corresponding angles for structure II are 144.0°, 158.7°, -134.3° and -129.5°.
The composition of the ternary complex of VV is 1:1:1 (see Fig. 5, lines 2 and 2', and Fig. 6b). Its extraction can be expressed by equation 2.
H2VO4-(aq)
H2DN(org) + MTT+(aq) (MTT+)[VVO2(DN)](org) + 2^O(aq)
(2)
Similar equation was proposed for the VV-DN-TTC system.21 However, it was considered only as a first stage of a series of processes leading ultimately to the formation of a VIV complex. In contrast to (TT+)[VvO2(DN)],21 (MTT+) [VvO2(DN)] is a stable ion-pair, less susceptible to oxidation-reduction events. Hence, MTT plays a stabilizing role on VV in a higher degree than TTC.
The optimised ground-state geometry of [V02(DN)]2- is shown in Fig. 7, structure III. The complex is tetrahedral with distances V
'14-
O11 = V14-O12 = 1.927,
V14-O13 = 1.636 and V14-O15 = 1.641.
Table 1. Optimum conditions for extraction of the ternary complexes
Parameter	Optimal value/range		Figure
	yiv	Vv	
PH	5.0-5.2	4.8-5.5	Fig. 2
Concentration of DN, mol L-1	1.6 x 10-3	6 x 10-4	Fig. 3
Concentration of MTT, mol L-1	1.2 x 10-4	1 x 10-4	Fig. 4
Extraction time, s	120	120	-
a)
0.8
0.6
3
to
<u" u c m
- 0.4
m
5
0.2
-	• 1:V(IV)335nm V(tV> 700 nm
Jß	• • • • ' A ~ k- à. i
b)
0 1 2 3 4 5 6 cmtt^cmiv)
OS
02: V(V} 335 nm A21: V(V) 650 nm
Figure 6. Determination of the MTT:VIV (a) and MTT:VV (b) molar ratios by the Yoe & Jones method.

-C2
»V3

9m
i-10
Qîfi
II
'25
ifc-Ci.
c4f
y? Ci
Ci Ci
C7 %
C4;
c^U
i V
On

■Ci,
Ci

III

He*
Ci

Figure 7. The optimized ground-state geometry of [VivO(DN2-)2]2- (I), [VIVO(DN2-)(DNH)-]- (II)21 and [VVO2(DN2-)]- (III).21
3. 7. Analytical Characteristics
Under the optimum conditions (Table 1), VIV is extracted as an ion-association complex, (MTT+)2 [VO(DN2-)2]. Its molar absorptivity at Amax (e570 = 2.9 x 104 dm3 mol-1 cm-1; Fig. 1b), calculated from the absorb-ance measured immediately after the extraction, is higher than the molar absorptivities of similar complexes (Table 2). However, this wavelength was found unsuitable for precise spectrophotometric measurements due to the above-mentioned instability of the absorbance (Fig. 1c). Because of the relatively high DN concentration, the results for the second maximum (X = 335 nm; e335 = 1.9 x 104 dm3 mol-1 cm-1) were also not satisfactory (high absorbance of the blank; insufficient repeatability).
By comparing the conditions for VIV and VV (Table 1), it is noticeable that lower reagents concentrations are needed for quantitative extraction of VV. It was found that the results are repeatable and the dependence between the
absorbance at Amax = 335 nm and concentration of VV is linear (R2 = 0.9994, N = 10) in a wide range (0.06-1.5 ^g cm-3). The regression equation was A = 0.316y - 0.0002. The standard deviations of the slope and intercept were 0.003 and 0.002, respectively. The limits of detection (LOD) and quantitation (LOQ) calculated as 3 and 10 times SD of the intercept divided by the slope were 0.02 ^g cm-3 and 0.06 ^g cm-3. The molar absorptivity and Sandell's sensitivity were 1.6 x 104 dm3 mol-1 cm-1 and 3.2 ng cm-2.
4. Conclusions
Vanadium(IV) and vanadium(V) form different chloroform-extractable ternary complexes with DN and MTT. Under the optimum conditions, VIV is extracted as a 1:2:2 complex (V:DN:MTT) with Amax = 570 nm. VV, in its turn, forms a 1:1:1 complex with Amax = 335 nm. This com-
I
Table 2. Influence of the cationic ion-association reagent on the complex's characteristics
Complex*	Composition	Organic solvent	^max, nm	emax, dm3 mol 1 cm 1	Ref.
VV-DN	1:2	MIBK	530	1.5 x 104	30
VV-DN-CTAB	Not studied	ethylacetate	530	1.5 x 104	29
VV-DN-TV	1:2:1	chloroform	342	1.5 x 104	28
VV-DN-INT	1:2:1	chloroform	340	2.5 x 104	27
VIV-DN-TTC	1:2:1	chloroform	333	2.1 x 104	21
VV-DN-MTT	1:1:1	chloroform	335	1.6 x 104	This work
VIV-DN-MTT	1:2:2	chloroform	570	2.9 x 104	This work
* - The initial oxidation state of vanadium is given
Abbreviations: CTAB, cetyltrimethylammonium bromide; TV, tetrazolium violet; INT, iodonitrotetrazolim chloride; TTC, triphenyltetra-zolium chloride
plex is obtained under mild conditions (low concentration of the reagents and wide pH range) and can be used for spectrophotometric determination of vanadium. When the DN concentration is not very high, the well-documented in the literature VV — VIV reduction by DN (a cat-echolic type ligand) is not observed. This fact can be a starting point for future research on the development of a method for spectrophotometric determination of VV and VIV in their co-presence.
S. References
1.	H. E. Michibata, Vanadium: biochemical and molecular biological approaches. Springer, Dordrecht-Heidelberg-London-New York, 2012. DOI:10.1007/978-94-007-0913-3
2.	B. Gummow, in: J. O. Nriagu, (Ed.): Encyclopedia of Environmental Health, Elsevier, Burlington, 2011; pp. 628-636. DOI:10.1016/B978-0-444-52272-6.00661-
3.	K. K. Chatterjee, Uses of Metals and Metallic Minerals, New Age International (P) Ltd. Publishers, New Delhi, India, 2007, pp. 272-275.
4.	A. Padilla-Rodríguez, J. A. Hernández-Viezcas, J. R. Peral-ta-Videa, J. L. Gardea-Torresdey, O. Perales-Pérez, F. R. Román-Velázquez, Microchem. J. 201S, ÏÏS, 1-11.
DOI: 10.1016/j.microc.2014.07.011
5.	Rehder, D., in: A. Sigel, H. Sigel, R. K.O. Sigel (Eds.): Interrelations between Essential Metal Ions and Human Diseases, Springer, 2013, pp. 139-169.
DOI: 10.1007/978-94-007-7500-8
6.	V. Ugone, E. Garribba, G. Micera, D. Sanna, J. Chem. Educ. 201S, 92, 1098-1102. DOI: 10.1021/ed500794m
7.	D. Rehder, Metallomics 201S, 7, 730-742. DOI: 10.1039/C4MT00304G
8.	K. Gruzewska, A. Michno, T. Pawelczyk, H. Bielarczyk, J. Physiol. Pharmacol. 2014, 65, 603-611.
9.	Ghosh, R.; Banik, S., in: D. Bagchi, A. Swaroop (Eds.): Food Toxicology, CRC Press, Boca Raton, 2017, pp. 337-354.
10.	M. J. C. Taylor, J. F. Staden, Analyst 1994, ÏÏ9, 1263-1276. DOI: 10.1039/AN9941901263
11.	Z. L. Chen, G. Owens, Anal. Chim. Acta 2008, 607, 1-14. DOI: 10.1016/j.aca.2007.11.013
12.	K. Pyrzynska, Microchim. Acta 2005, 149, 159-164. DOI: 10.1007/s00604-004-0304-5
13.	W.-Y. He, K.-P. Wang, J.-Y. Yang, Toxicol. Environ. Chem. 2018, DOI: 10.1080/02772248.2018.1428325
14.	C. Agarwal, M. Deb, R. Mishra, Anal. Lett. 1990, 23, 20632075. DOI: 10.1080/00032719008052550
15.	C. Agrawal, K. S. Patel, R. K. Mishra, Bull. Chem. Soc. Jpn. 1991, 64, 2616-2618. DOI: 10.1246/bcsj.64.2616
16.	T. Prasada Rao, M. L. P. Reddy, A. R. Pillai, Talanta 1998, 46, 765-813. DOI: 10.1016/S0039-9140(97)00262-2
17.	Z. Marczenko, M. Balcerzak, Metod'y spektrofotometrii v UF i vidimoj oblastyakh v neorganicheskom analize (in Russian), Binom. Laboratoriya znanij, Moscow, 2007.
18.	Gavazov, K. B., Acta Chim. Slov. 2012, 59, 1-17.
19.	N. K. Temel, R. Gürkan, Acta Chim. Slov. 2018, 65, 138-149. DOI:10.17344/acsi.2017.3724
20.	A. M. Nardillo, J. A. Catoggio, Anal. Chim. Acta 1975, 74, 85-99. DOI: 10.1016/S0003-2670(01)82782-3
21.	K. B. Gavazov, G. K. Toncheva, V. B. Delchev, Open Chem. 2016, 14, 197-205. DOI: 10.1515/chem-2016-0022
22.	K. Kustin, S.-T. Liu, C. Nicolini, D. Toppen, J. Am. Chem. Soc. 1974, 96, 7410-7415. DOI: 10.1021/ja00831a600
23.	J. H. Ferguson, K. Kustin, Inorg. Chem. 1979, 18, 3349-3357. DOI: 10.1021/ic50202a015
24.	K. Gavazov, Z. Simeonova, A. Alexandrov, Russ. J. Inorg. Chem. 2001, 46, 427-431.
25.	S. Adediran, R. Pratt, Biochemistry 2008, 47, 9467-9474. DOI: 10.1021/bi801153j
26.	P. Racheva, K. Gavazov, V. Lekova, A. Dimitrov, J. Iran. Chem. Res. 2008, 1, 113-121.
27.	Z. Simeonova, K. Gavazov, A. Alexandrov, Cent. Eur. J. Chem. 2006, 4, 258-266. DOI: 10.2478/s11532-006-0011-7
28.	V. Lekova, K. Gavazov, A. Dimitrov, P. Racheva, Sci. Res. Union Sci. Plovdiv, Ser. C 2007, 6, 171-174.
29.	R. K. Mondal, D. P. S. Rathore, P. K. Tarafder, in: National Seminar on Significant Advancements in Plasma/Flame/Associated Techniques and their Applications in Chemical Characterization of Atomic Minerals (SAP-2013), AMD Hyderabad, India, January 23-24 2013: AMD Hyderabad, India, pp. 83-84.
30.	R. K. Mondal, D. P. S. Rathore, P. K. Tarafder, Explor. Res. Atomic Miner. 2013, 23, 113-116.
31.	P. K. Tarafder, R. K. Mondal, Rev. Anal. Chem. 2011, 30, 7381. DOI: 10.1515/REVAC.2011.016
32.	P. K. Tarafder, S. K. Pradhan, R. K. Mondal, J. Radioanal. Nucl. Chem. 2016, 309, 1021-1028.
DOI: 10.1007/s10967-016-4738-0
33.	P. K. Tarafder, P. K. Ghosh, S. K. Pradhan, J. Radioanal. Nucl. Chem. 2017, 313, 353-360.
DOI: 10.1007/s10967-017-5334-7
34.	R. W. Sabnis, Handbook of biological dyes and stains: synthesis and industrial applications, Wiley, Hoboken, US, 2010, pp. 485-487. DOI: 10.1002/9780470586242
35.	K. B. Gavazov, A. N. Dimitrov, V. D. Lekova, Russ. Chem. Rev. 2007, 76, 169-179.
DOI: 10.1070/RC2007v076n02ABEH003655
36.	K. B. Gavazov, V. D. Lekova, G. I. Patronov, Acta Chim. Slov. 2006, 53, 506-511.
37.	P. V. Racheva, K. B. Gavazov, V. D. Lekova, A. N. Dimitrov, J. Anal. Chem. 2010, 65, 21-25.
DOI: 10.1134/S1061934810010053
38.	G. K. Toncheva, T. S. Štefanova, K. B. Gavazov, Oriental J. Chem. 2015, 31, 327-332. DOI: 10.13005/ojc/310137
39.	S. Kostova, V. Stajkovska, A. Aleksandrov, Sci. Works Plovdiv Univ. Chem. 2000, 29, 9-14.
40.	E. Asmus, Fresenius' J. Anal. Chem. 1960, 178, 104-116. DOI: 10.1007/bf00467200
41.	Z. Zhiming, M. Dongsten, Y. Cunxiao, J. Rare Earths 1997, 15, 216-219.
42.	M. I. Bulatov, I. P. Kalinkin, Prakticheskoe rukovodstvo po fotokolorimetricheskim i spektrofotometricheskim metodam analiza (in Russian), Khimiya, Leningrad, 1986.
43.	K. B. Gavazov, Chemistry 2013, 22, 222-253.
44.	J. H. Yoe, A. L. Jones, Ind. Eng. Chem. Anal. Ed. 1944, 16, 111-115. DOI: 10.1021/i560126a015
Povzetek
Proučili smo ekstrakcijski sistem tekočina-tekočina za Viv/v, ki vsebuje 2,3-dihidroksinaftalen (DN) in 3-(4,5-dimetilti-azol-2-il)-2,5-difenil-2ff-tetrazolijev bromid (tiazolil modro, MTT). Določili smo optimalne pogoje za ekstrakcijo ViV in Vv. ViV smo ekstrahirali v kloroformu kot 1:2:2 kompleks (V:DN:MTT) z Amax = 570 nm in £570 = 2.9 x 104 dm3 mol-1 cm-1, vendar ta valovna dolžina ni primerna za natančne spektrofotometrične meritve zaradi časovno odvisne spremembe absorbance. Vv tvori predvsem 1:1:1 kompleks z Amax = 335 nm. Za to oksidacijsko stanje je umeritvena krivulja linearna v območju 0.06-1.5 |ig cm-3. Vrednosti za molsko absorptivnost, Sandellovo občutljivost in mejo detekcije so 1.6 x 104 dm3 mol-1 cm-1, 3.2 ng cm-2 in 0.02 |g cm-3. Osnovno stanje struktur anionov prisotnih v ravnotežju, [ViVO(DN2-)2]2-in [VvO2(DN2-)]-, smo optimizirali na BLYP/6-31++G* nivoju teorije.
Scientific paper
Factors Influencing Imazapyr Herbicide Removal from Wastewater Using Photocatalytic Ozonation
Salma Bougarrani,1,* Laila El Azzouzi,1 Soukaina Akel,1 Lahbib Latrach,2 Asmae Bouziani1 and Mohammed El Azzouzi1
1 Laboratory of Spectroscopy, Molecular Modeling, Materials, Nanomaterials, Water and Environment, (LS3MN2E) Faculty of Sciences, University Mohammed V. BP 1014, Rabat, Morocco.
2 Faculty of Sciences Semlalia, Cadi Ayyad University, PO Box: 2390, Marrakech, Morocco.
* Corresponding author: E-mail: salma.bougarrani@gmail.com Tel: + 212 660425050, Fax: + 3535698213
Received: 28-02-2018
Abstract
This study investigates the degradation of imazapyr herbicide from wastewater by photocatalytic ozonation using TiO2 as a semiconductor. Effects of operational parameters on imazapyr removal efficiency including TiO2 dosing, initial herbicide concentration and pH were also studied. Obtained results showed that more than 90% of removal efficiency representing the disappearance of imazapyr was maintained until 7 pM in the presence of 200 mgL-1of Uvi00-Ti02. Otherwise, the degradation of imazapyr followed the first-order kinetics with a photocatalytic rate constant of 0.247 min-1, and complete degradation was achieved within 20 min using photocatalytic ozonation for 5 pM of Imazapyr at pH 7.
Keywords: Degradation; Imazapyr herbicide; Ozonation; Photocatalytic Ozonation; Wastewater treatment
1. Introduction
Persistent organic pollutants such as pesticides have attracted global environmental concerns in recent decades due to its adverse impacts on the environment and public health. Among the various pesticides, imazapyr is one of the most widespread types of contaminants of waters and soils, often found in the municipal sewage effluents and soil with varying trace concentrations in different parts ofthe world.1-2
Imazapyr, 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid, being a hetero aromatic molecule,3 is a non-selective herbicide which belongs to the imadazolinone family. Imazapyr is a persistent herbicide, with a half-life varying from 21 days to 49 months, and a high mobility in soils.3-4 Therefore, it is likely suspected to contaminate groundwater.5 Elimination of imazapyr present in drinking water by treatment with ozone has been demonstrated to be unsuccessful since half of the initial compound remains in water after the process. The photocatalytic oxidation of imazapyr has been studied previously using commercial TiO2 as well as newly synthesized mesoporous TiO2 materials.6 However, more studies are still needed to better understand the effect of the oxida-tive approaches on the control of this herbicide.
In recent years, various technologies have been developed and tested in laboratory scales or pilot plants to remove various recalcitrant organic pollutants from wastewater in order to minimize the potential health risks associated with exposure to these chemical pollutants.4 One of the alternatives to gain greater mineralization efficiency is the use of ozone in the presence of catalyst in order to enhance the free hydroxyl radicals production.4-5 The photocatalytic ozonation have been studied by many studies worldwide and the high efficiency of this treatment has been explained by a synergistic effect between ozonation and photocatalysis. The photogenerated electrons can react with ozone molecules generating ozonide radicals while decreasing the possible recombination of electronehole pairs. Pizarro et al.,5 and Ibrahimi et al.,6 reported that among six different advanced oxidation processes, photocatalytic ozonation was the most efficient for completing mineralisation of 4- chloronitrobenzene. These promising techniques are used for the treatment of contaminated water and wastewater to evaluate their capability in the decomposition of pollutants such as pesticides and to assess the treatment efficiencies of these com-binations.7
The advanced oxidation processes (AOPs) have been developed as one of the most promising options in the removal of various persistent organic pollutants by the generation of hydroxyl radicals (OH).8-9 Due to its low-cost and chemical stability, semi-conductor material like TiO2 has been successfully used in recent years.10-12 However, The degradation of Imazapyr has also been investigated by other authors using photocatalysis and ozone and results showed lower concentration compared to photo catalytic ozonation.13-30 The photocatalytic ozonation degradation of pesticides is largely dependent on operating parameters such as TiO2 dosage, initial herbicide concentration and solution pH.31-32 Understanding the effects of these factors on the photocatalytic degradation efficiency have an importance when designing a sustainable and efficient technique for wastewater treatment.
Based on this background informations, the present study aimed at performing a comprehensive evaluation of the capacity of photocatalytic ozonation to remove im-azapyr from wastewater.
The laboratory studies reported in this paper investigates the capacity and the applicability of TiO2-photocata-lytic ozonation in removing imazapyr herbicide from wastewater. Operational parameters such as TiO2 initial concentration, initial herbicide concentration and pH were also investigated.
2. Material and Methods
Imazapyr herbicide, (95%) was purchased from American Cyanamid Company. TiO2 Hombikat UV100 (99%) was purchased from Sachtleben Chemie in powdered form. The chemical structure of imazapyr herbicide is shown in figure 1. Potassium indigo trisulfonate was purchased from Riedel-de Hahn AG. The other chemicals used in the experiments were purchased from Riedel-de Hahn AG. They were all of analytical grade and used without further purification. All solutions were prepared using Milli-Q water at room temperature collected from Milli-Q apparatus (Millipore, Bedford).
Sample analysis from the study of the photocatalytic degradation of imazapyr was carried out using a mass spec-
trometry coupled to electrospray ionization system (ESI) for a qualitative and quantitative analysis. MS analysis was performed on Bruker Esquire 3000 plus mass spectrometer equipped with an ESI interface and an ion trap (Bruk-er-Daltonics Analytik GmbH Bremen, Germany). The ESI probe tip and capillary potentials were set at 2.5 kV and 25 V, respectively. The concentration of aqueous ozone was determined by Spectrometric method indigo trisulfonate according to Sanchez et al.,13 and mouradi et al.17 The absorption analysis of the indigo was monitored by Shimadzu UV-160A UV-Vis Spectrophotometer at 600 nm.
Titanium dioxide (100 % anatase, average particle size of 10 nm and BET Method-Brunauer, Emmett and Teller [BET] surface of > 250 m2 g-1) was used without any pre-treatment.
In a typical reaction, 200 mg/L of TiO2 were added to 500 mL of 5 ^M of imazapyr solution in a double walled cylindrical photoreactor (figure 2). Then, the solution was exposed to ultrasonic treatment for 2 minute in order to suspend the catalyst. Immediately afterwards, the stirring was started and maintained over 1h in the dark to ensure the adsorption equilibrium between the solution and the catalyst particles. The imazapyr degradation experiments were carried out in a simple photocatalyzed ozonation reactor, as presented in figure 2, with combining photocatal-ysis and ozonation.
The irradiation experiments were carried out under light generated by a medium pressure mercury lamp at 150W in a Duran cell (X > 300 nm), placed inside the reactor. A cooling water system was set up to prevent overheating of the lamp and of the solution. Samples were taken every 10 min and filtered two times in order to remove all the catalyst. The photocatalytic ozonation degradation of Imazapyr herbicide was investigated in an aqueous suspension 1: 3 acetone/water mixture in the presence of pure titanium used as a catalyst. Imazapyr showed important
Figure 1: Chemical structure of imazapyr herbicide.
Figure 2: Scheme of photocatalytic ozonation reactor used for imazapyr degradation.
fragments molecular ion peak at m/z = 262 and m/z = 284, The MS-ESI detects the Imazapyr under two forms (com-binated to H+ wich gives m/z= 262 and combinated to Na+ with m/z 284) and their degradation was followed as a function of time.
3. Results and Discussion
3. 1. Effect of TiO2 Dose on Imazapyr Degradation
Variations of Imazapyr removal rate under different TiO2 dose are presented in figure3. Imazapyr degradation increased slowly and reached the maximum removal rate of 93.0% in the concentration of 200 mg/L. Thus, this TiO2 dose (200 mg/L) could be considered as the optimal concentration of hombikat UV 100. The optimal amount of Hombikat UV 100 agrees well with reported results by other authors.14-26 This improvement can be attributed to the increasing of active sites by providing more TiO2 particles, which plays the semiconductor role in the photoca-talysis process. Consequently, the formation of electron-hole pairs and reactive hydroxyl radicals on the surface of semiconductor increased, which improved the oxidation of imazapyr into other intermediates.15-27
Figure 3: Removal rate of imazapyr under variation of TiO2 concentration. C(Imazapyr) = 5 |rM; stirring speed = 1000 min-1, aqueous suspension 1 : 3 acetone/ Milli-Q water.
3. 2. Effect of Initial Herbicide Concentration
The pollutant concentration in water is an important factor to determine the oxidation efficiency and the synergistic effects of photocatalytic ozonation processes.12-15 The effect of the initial herbicide concentration was studied for six concentrations of imazapyr by photocatalytic ozonation. The initial herbicide concentrations were 1 ^M, 3 ^M, 5 ^M, 7 ^M, 9 ^M and 15 ^M (0.26 mg/L, 0.79 mg/L, 1.31 mg/L, 1.83 mg/L, 2.36 mg/L, 3.9 mg/L respectively).
For this series of experiments the catalyst and the ozone doses were kept constant at 200 mg/L and 10 mg/L respectively. The irradiation time was fixed at 10 min for all samples after the adsorption step under dark conditions.
Obtained results showed that more than 90% of removal efficiency representing the disappearance of imazapyr was maintained until 7 ^M, further increase of im-azapyr concentration leads to decrease in removal efficiency (figure 4). A possible explanation resides in the fact that as imazapyr concentration rises, it is possible that more organic substances are deposed on the surface of TiO2, whereas less number of photons are available to reach the catalyst surface and the probability of reaction between imazapyr molecules and oxidizing species also decreases, thus resulting in less degradation percent-age.18-32
Figure 4: Removal efficiency of imazapyr as a function of imazapyr concentration, mcatalyst = 100 mg; stirring speed = 1000 min-1, aqueous suspension 1 : 3 acetone/ Milli-Q water.
3. 3. Effect of pH Influence on Imazapyr Degradation
Knowledge of the kinetics required to assess the efficiency of systems engineered for the oxidation of a variety of pollutants. Reliable kinetic studies require obvious substrate decay measurements. Thus, for comparison of the efficiency of these treatment processes, kinetic studies of imazapyr decomposition were carried out.
In all experimental runs, imazapyr concentration was found to decrease with irradiation time. A first order kinetics fitting of the thus obtained concentration vs. time plots allows to calculate the respective first order rate constants. Based on the exponential decay of concentration of imazapyr, the photoactivity profile was fitted assuming a first order reaction.
C = C0 exp(—k • t)
In which C is the concentration of imazapyr at time t, Co is the initial concentration, and k is the observed rate constant.
Many authors have reported that the kinetic behavior of photocatalytic reaction can be described by a modified Langmuir-Hinshelwood model, Atitar et al.,18 and Djerdj et al.19
The influence of pH on the effectiveness of imazapyr degradation by photocatalytic ozonation is shown in figure 5. The degradation experiments were carried out at pH values of 3, 7, and 10. Imazapyr removal rate reached a maximum at pH 7 with a first order rate constant of 0.247 min-1. However, for pH 3 and 10, the photocatalytic activity decreased appreciably. The rates constant at pH 3 and pH 10 are 0.107 min-1, 0.134 min-1 respectively (Table1). The study of pH influence on the photocatalytic ozonation process would be helpful to understand its underlying mechanism and would help obtaining a higher degree of removal. Based on the exponential decay of imazapyr concentration, the degradation by photocatalytic ozonation profile was fitted assuming a first order reaction model. Similar finding have been reported by Usharani et al.,14 and by Gar Alalma et al.15 These authors have reported first order reaction kinetics for the degradation and mineralization of chlorinated pesticides and insecticides and other various water pollutants by photocatalytic ozonation.14-33
The results, shown in figure 5, demonstrates that the optimal conditions for imazapyr degradation with photo-catalytic ozonation is neutral pH. On the other hand, the combination of two oxidation systems, ozonation and photocatalysis, for water treatment under optimal conditions are reported to have increased oxidation efficiencies (synergy) compared to the sum oxidation efficiencies of these two oxidation systems separately.32-36 Several studies have discussed the synergistic effects of photocatalytic ozonation on degradation and removal of different substances from aqueous solutions and the effects are reported in terms of the degradation and/or mineralization effi-
ciencies or oxidation rate constants of model water pollutants.17-27 The efficiency of photocatalytic ozonation is mainly attributed to the formation of more reactive and non-selective hydroxyl radicals in the oxidation medium, which react with almost all organic molecules at a rate of 106 - 109 M-1s-1.18-25-37 The photogenerated electrons can react with ozone molecules generating ozonize radicals while decreasing the possible recombination of electron hole pair, so better electron- whole separation. In addition to the synergistic effects which occur during photocatalyt-ic ozonation compared to simple photocatalysis in presence of oxygen. Bougarrani et al.,36 and Wang et al.,24 also reported similar results for the mineralization of aniline, dibutyl phthalate, respectively.
Table 1: Rate constant of imazapyr degradation with photocatalytic
ozonation for different pH.
pH	Photocatalytic ozonation		
	Rate constant K	R2	Standard Deviation
3	0.107 (min-1)	0.997	0.0012
7	0.247 (min-1)	0.997	0.0009
10	0.134 (min-1)	0.995	0.0015
Figure 5: Concentration of imazapyr as a function of time for different pH, C(Imazapyr) = 5 |iM ); stirring speed = 1000 min-1, m TiO2 = 100 mg). aqueous suspension 1 : 3 acetone/ Milli-Q water.
4. Conclusions
This study demonstrated the ability of photocatalytic ozonation using TiO2 as semiconductors for the degradation of imazapyr herbicide as organic pollutants. Imazapyr degradation is strongly influenced by the operating parameters such as TiO2 concentration, initial imazapyr concentration and pH. Under optimized conditions (TiO2 dose of 200 mg/L, 5^M of initial imazapyr concentration and pH 7), up to 95% of imazapyr removal was achieved within 20 min with removal rate constant of 0.247 min-1. Results of the present investigation suggest that photocatalytic ozona-tion using TiO2 is efficient for the removal of imazapyr form wastewater. The high efficiency of photocatalytic ozo-nation could be explained by a synergistic effect between ozonation and photocatalysis. The photogenerated electrons can react with ozone molecules generating ozonize radicals while decreasing the possible recombination of electron hole pair, so better electron- whole separation.
Therefore, the application of photocatalytic ozona-tion under the optimal conditions is recommended for organic pollutants treatment such as imazapyr herbicides in order to promote environmental and human health protection.
5. References
1. Assalin M. R., De Moraes S. G., Queiroz C. N., Ferracini V. L. & Duran N., J Environ Sci Health B, 2009, 45,1, 89-94. DOI: 10.1080/03601230903404598
2.	Antoniou M. G., Zhao C., O'Shea K. E., Zhang G., Dionysiou D., Han C., Nadagouda M. N., Choi H., Fotiou T., Triantis T. M. & Hiskia. RSC adv. 2016, 1-34.
3.	Atitar M. F., Dillert R. & Bahnemann D. W. J. Phys. Chem. C. 2017, 121 (8), 1-36. DOI:10.1021/acs.jpcc.6b11673
4.	Oller I., Gernjak W., Maldonado M. I., Perez-Estrada L. A., Sanchez-Perez J. A., Malato S., J Hazard Mater B, 2006, 138, 507-517. DOI:10.1016/j.jhazmat.2006.05.075
5.	Pizarro P., Guillard C., Perol N., Herrmann J.-M., Catal. Today, 2005, 101, 211-218. DOI:10.1016/j.cattod.2005.03.008
6.	Ebrahimi H., Ghorbani Shahna F., Arch Environ Prot, 2017, 43, 65-72. DOI:10.1515/aep-2017-0006
7.	Bamba D., Atheba P., Robert D., Trokourey A., Dongui B., Environ. Chem. Lett. 2008, 6, 163-167. DOI:10.1007/s10311-007-0118-x
8.	Boggard O. K., Gimsing A. L, Pest Manag Sci. 2008, 64, 441456. DOI:10.1002/ps.1512
9.	Shifu C., Yunzhang L., Chemosphere, 2007, 67, 1010-1017. DOI:10.1016/j.chemosphere.2006.10.054
10.	Okehata K., EI-Din M. G., Ozone Sci. Eng., 2005, 27, 83.
11.	Maddila S., Rana S., Pagadala R. & Jonnalagadda S. B., Desalin Water Treat, 2015, 1-15.
12.	Maddila S., Ndabankulu V. O., Jonnalagadda S. B., Global Nest J. 2016, 18(2), 269-278.
13.	Sanchez L., Peral J., & Domenech X., Appl Catal B, 1998, 19, 1, pp. 59-65. DOI:10.1016/S0926-3373(98)00058-7
14.	Usharani, Muthukumar M., and Kadirvelu K., Int. J. Environ. Res. 2012, 6(2), 557-564.
15.	Gar Alalma M., Tawfika A., Ookawara S., J. wat Proc Eng. 2015, 8, 55-63.
16.	Hameed B. H., Akpan U. G., J Hazard Mater. 2009, 170, 520529. DOI:10.1016/j.jhazmat.2009.05.039
17.	Mouradi, M., Bouizgaren, A., Farissi, M. and Ghoulam, C., Irrigation and Drainage 2017,
18.	Atitar M. F, and Bahnemann D. W., J. Phys. Chem. C, 2017, 1-36.
19.	Djerdj I., Arcon D., Jagliid Z., Niederberger M. J. Solid State Chem. 2008, 181, 1571- 1581. DOI:10.1016/j.jssc.2008.04.016
20.	Lissemore L., Hao C.Y., Yang P., Sibley P. K, Mabury S., and Solomon K. R. J. Chemosphere, 2006, 64, 717-729. DOI:10.1016/j.chemosphere.2005.11.015
21.	Sato, K., Iwashima, N., Wakatsuki, T. and Masunaga, T., /. Soil Sci. Plant Nutr., 2011, 57(4), pp.607-618.
DOI: 10.1080/00380768.2011.594966
22.	Bargaz, A., Isaac, M. E., Jensen, E. S. and Carlsson, G., /. Soil Sci. Plant Nutr., 2016, 179 (4), 537-546.
23.	Armakovic S. J., Armakovic S., Fincur N. L., Sibul F., Vione D., Setrajcic J. P. & Abramovic B. F. RSC Advances, 2015, 5 (67), 54589-54604. DOI:10.1039/C5RA10523D
24.	Wang R. M., Liu C. M, Zhang H. Z., Chen C. P., Guo L., Xu H. B., Yang S. H. Appl. Phys. Lett. 2004, 85, 2080-2082.
DOI: 10.1063/1.1789577
25.	Putra E. K., Pranowo R., Sunarso J., Indraswati N., Ismadji S. Water Res, 2009, 43, 2419-2430. DOI:10.1016/j.watres.2009.02.039
26.	Klavarioti, M., Mantzavinos, D., Kassinos, D. Environ. Int. 2009, 35, 402-417. DOI:10.1016/j.envint.2008.07.009
27.	Kümmerer, K. /. Environ. Manage, 2009, 90, 2354-23. DOI:10.1016/j.jenvman.2009.01.023
28.	Zhang G., Wang Q., Zhang W., Yuan T. and Wang P. Photo-chem Photobiol Sci, 2017, 98-103.
29.	Safari G. H., Hoseini M., Seyedsalehi M., Kamani H., Jaafari J., Mahv A. H. Int. /. Environ. Sci. Technol. 2015, 12 603-616. DOI:10.1007/s13762-014-0706-9
30.	Bourgin M., Borowska E., Helbing J., Hollender J., Kaiser H. P., Kienle C., McArdell C. S., Simon E. & Gunten U. Water Res. 2017, 122, 234-245. DOI:10.1016/j.watres.2017.05.018
31.	Ebrahimi H., Shahna F. G., Bahrami A., Jaleh B. & Abed K. A. Arch Environ prot. 2017, 43 (1), 65-72. DOI:10.1515/aep-2017-0006
32.	Bougarrani S., El azzouzi L., Bouziani A., Akel S., Latrach L., Baicha Z., El azzouzi M. Mor. /. Chem.2017, 5 (3), 446-452.
33.	Hermosilla D., Merayo N., Gascó A. & Blanco Á. Environ Sci Pollut Res, 2015, 22 (1), 168-191. DOI:10.1007/s11356-014-3516-1
34.	Iglesias O., Fernández deDios M.A., Tavares T., Sanromán M. A. & Pazos M. J. Ind. Eng. Chem 2015, 27 (1), 276-282. DOI:10.1016/j.jiec.2014.12.044
35.	Ismail A., Abdelfattah I., Faisal M. & Hela A. / Hazard Mater. 2018, 342 (15), 519-526. DOI:10.1016/j.jhazmat.2017.08.046
36.	Bougarrani S., Skadell K., Arndt R., El Azzouzi M., and Gläser R., /. Environ. Chem. Eng., 2018, 6 (2), 1934-1942. DOI:10.1016/j.jece.2018.02.026
37.	Zhang G., Wang Q., Zhang W., Yuan T. & Wang P. Photochem Photobiol Sci. 2017, 15 (8), 98-103.
Povzetek
Študija preučuje razgradnjo herbicida Imazapyr iz odpadnih vod s fotokatalitično ozonacijo katalizirano s TiO2. Preučevali smo vpliv količine dodanega TiO2, koncentracije herbicida in pH vrednosti. Rezultati so pokazali, da lahko dosežemo 90 % razgradnjo pri koncentracijah herbicida Imazapyr v koncentracijah do 7 |M ob prisotnosti UV100-TiO2 v koncentraciji 200 mgL-1. Razpad herbicida Imazapyr lahko opišemo s kinetiko prvega reda s konstanto fotolize 0.247 min-1. S fotokatalitično ozonacijo smo dosegli popolno razgradnjo 5 |M herbicida Imazapyr pri pH vrednosti 7 v 20 min.
Short communication
Interaction Between the Rubidium Cation and [2.2.2]Paracyclophane: Experimental and Theoretical Study
Emanuel Makrlik,1'* Stanislav Bohm,2 David Sykora,2 Magdalena Kvičalova1 and Petr Vanura2
1 Faculty of Environmental Sciences, Czech University of Life Sciences, Kamycka 129, 165 21 Prague 6 - Suchdol,
Czech Republic
2 University of Chemistry and Technology, Prague, Technicka 5, 166 28 Prague 6, Czech Republic
* Corresponding author: E-mail: makrlik@centrum.cz Phone: +420 376 594 672
Received: 21-06-2017
Abstract
By means of electrospray ionization mass spectrometry (ESI-MS), it was evidenced experimentally that the rubidium cation (Rb+) reacts with the electroneutral [2.2.2]paracyclophane ligand (C24H24) to form the cationic complex [Rb(C24H24)]+. Moreover, applying quantum chemical calculations, the most probable conformation of the proven [Rb(C24H24)] + complex was solved. In the complex [Rb(C24H24)] + having a symmetry very close to C3, the "central" cation Rb+, fully located in the cavity of the parent [2.2.2]paracyclophane ligand, is coordinated to all three benzene rings of [2.2.2]paracyclophane via cation-n interaction. Finally, the binding energy, E(int), of the considered cation-n complex [Rb(C24H24)] + was evaluated as -99.3 kJ/mol, confirming the formation of this fascinating complex species as well. This means that the [2.2.2]paracyclophane ligand can be considered as a receptor for the rubidium cation in the gas phase.
Keywords: [2.2.2]Paracyclophane; Rubidium cation; Cation-n interaction; DFT calculations; Structures.
1. Introduction
It is well-known that n-prismands and certain hydrocarbon cyclophanes are capable of forming n-complex-es with some small metal cations, where benzene rings act as n-donors for the respective complexes.1 This fascinating complexation behavior is especially effective for [2.2.2]pa-racyclophane and related structures.2,3 Pierre et al.3 have reported the preparation of the silver triflate complex of [2.2.2]paracyclophane and claimed that it was the first member of a new class of compounds; owing to the complexation properties, they proposed the name n-prismand for such hydrocarbon cyclophanes. Furthermore, Vogtle et al.4 have shown that concave hydrocarbon cyclophanes can extract certain metal ions from an aqueous phase into a nonpolar phase. They have tested these hydrocarbons as ionophores and have shown that PVC-[2.2.2]paracyclo-phane membranes demonstrated remarkable sensitivity toward the univalent silver cation.4 Recently, the first-principles model of Fermi resonance in the alkyl CH stretch
region has been applied to 1,2-diphenylethane and [2.2.2] paracyclophane.5 Finally, the role of the metal formal charge in the cation-n interactions has been evaluated with relativistic DFT methods involving a versatile n-cryptating structure, namely [2.2.2]paracyclophane.6
Cation-n interaction refers to the noncovalent attraction between a cation and a n-system.7,8 Its strength is often comparable with the interaction between a cation and traditional ligands, including water, alcohols, and amines. As a result of this cation-n interaction, there are extraordinarily important driving forces in molecular recognition processes in many biological and artificial systems.9-12 The considered cation-n interaction is a well-established phenomenon in the gas phase, as well as in the solid state,13-19 and is known to play very important role in the stabilization of tertiary structures of various proteins.20
We must emphasize that the cation-n interactions of [2.2.2]paracyclophane (C24H24 ; see Figure 1) with the
Figure 1. Structural formula of [2.2.2]paracyclophane (C24H24).
"soft" cations Ag+ 3>21>22 and Tl+ 23 have been investigated and proven quite unambiguously.
However, up to now, interaction of the mentioned electroneutral [2.2.2]paracyclophane ligand with a very bulky cation has not been studied and [2.2.2]paracyclo-phane was considered to be a receptor for the transition metal cations.6 On the other hand, in our previous work we show, that paracyclophane [2.2.2] could also encapsulate light alkali metal cation Na+.24
Therefore, in the present work, electrospray ionization mass spectrometry (ESI-MS) was applied as an experimental technique for characterization of the cation-n interaction between the very voluminous heavy univalent rubidium cation (Rb+) and this [2.2.2]paracyclophane li-gand in the gas phase. In this context we must state that the cation Rb+ was chosen for the present study especially for the sake of an expected fascinating structure of the resulting cationic complex involving the [2.2.2]paracyclophane ligand. Furthermore, by means of quantum chemical DFT calculations, the most probable conformation of the experimentally evidenced cationic complex [Rb(C24H24)]+ in the gas phase was suggested.
2. Experimental
[2.2.2]Paracyclophane (puriss., >99%) was purchased from Aldrich, while rubidium chloride (puriss., >99%), RbCl, was supplied by Fluka. Other chemicals used (Lachema, Brno, Czech Republic) were of reagent grade purity. In this context it should be stated that rubidium has two stable isotopes, i.e., 85Rb (natural abundance: 72.168%) and 87Rb (natural abundance: 27.832%).
The mass spectra were measured on the 3200 Q TRAP (AB Sciex, Canada) mass spectrometer. This instrument was equipped with an electrospray ion source. The experiments were carried out in a positive-ion mode. Nitrogen was used as a nebulizer gas. The operating conditions for the mass spectrometer were set as follows: ionspray voltage 5.5 kV; curtain gas 10 arbitrary units, ion source gas(1) 18 arbitrary units and ion source gas(2) 0 arbitrary units; ion source temperature ambient; declus-tering potential 35 V and entrance potential 10 V. Mass spectra were recorded from m/z 100 to 800. A mixture of
[2.2.2]paracyclophane (8 x 105 mol/L) and RbCl (2 x 10-3 mol/L) dissolved in methanol/chloroform (1:1) was introduced into the ESI source via a PEEK capillary at a flow rate of 10 ^L/min.
3. Results and Discussion 3. 1. Electrospray Ionization Mass Spectrometry
Figure 2 depicts an ESI mass spectrum measured in a positive-ion mode for a mixture of [2.2.2]paracyclo-phane (C24H24) with RbCl in a methanol/chloroform (1:1) solution. The intense peaks in the mass spectrum at m/z 397 and 399 evidently belong to the cationic complex [Rb(C24H24)]+. Besides, two insets in Figure 2 represent the real and calculated isotope patterns of the cationic cluster [Rb(C24H24)]+ related to the presence of two stable isotopes of rubidium, i.e., 85Rb and 87Rb, in natural abundances 72.168 and 27.832%, respectively. It is necessary to emphasize that under the present experimental conditions, the cationic complex species [Rb(C24H24)]+ was proven in the gas phase. No other [2.2.2]paracyclophane complexes with Rb+ were found by using this experimental method.
Figure 2. Positive-ion mode ESI mass spectrum of a mixture of [2.2.2]paracyclophane (8 x 105 mol/L) with RbCl (2 x 10-3 mol/L) in methanol/chloroform (1:1). The inset shows the real isotope pattern of the [Rb(C24H24)]+ complex on an expanded mass scale. The inset (a) provides the calculated isotope pattern of the considered [Rb(C24H24)]+ complex.
Furthermore, Figure 3a shows a collision induced dissociation (CID) mass spectrum of the ions [85Rb(C24H24)]+ (m/z 397), where the only one significant fragment ion signal was found at m/z 85. Analogously, in a
CID mass spectrum of [87Rb(C24H24)]+ given in Figure 3b, the sole fragment ions at m/z 87 were observed. These facts clearly indicate that the only significant fragmentation channel in the investigated complex [Rb(C24H24)]+ is the loss of one electroneutral [2.2.2]paracyclophane ligand, similarly as in our recent paper.23
85
a)	tildf
	Si 10
	
Q)	
O	ills'
c	
CO	
u	
c	Siio1
3	
.Q	4x10'
<	
	iltf
	Ä10*
	trlO1
397
250
m/z
b)
Figure 3. CID mass spectra of (a) [85Rb(C24H24)]+ and (b) [87Rb(C24H24)]+ ions obtained with nitrogen (1 x 10-2 mbar) at collision energy of 15 eV (laboratory frame).
In summary, we have evidenced experimentally that the cationic complex [Rb(C24H24)]+ must be present in the gas phase, and when the mentioned complex is collisional-ly activated, it decomposes almost exclusively via elimination of the electroneutral [2.2.2]paracyclophane molecule (i.e., C24H24), while the charge is retained on the rubidium atom in the form of Rb+.
3. 2. Quantum Chemical DFT Calculations
The theoretical calculations were performed at the density functional level of theory by using modern hybrid W-B97XD functional including long range and dispersion corrections,25 employing the Gaussian 09 suite of programs.26 Modern balanced def2-TZVP basis set27 was used, and the optimizations were unconstrained. In order
to increase the numerical accuracy and to reduce oscillations during the molecular geometry optimization, two-electron integrals and their derivatives were calculated by using the pruned (99,590) integration grid, having 99 radial shells and 590 angular points per shell. This was ensured by means of the Gaussian 09 keyword "inte-gral(ultrafinegrid)".
The most prob able conformation ofthe [Rb(C24H24)]+ cationic complex was predicted on the basis of the thorough conformational analyses (i. e., eight very different initial mutual positions of the [2.2.2]paracyclophane ligand and the Rb+ cation were considered during the geometry optimization) and the respective vibrational frequency analyses, analogously as in our articles.28-32
During the model calculations, the molecular geometries of the free [2.2.2]paracyclophane ligand and its cati-on-n complex with Rb+ were optimized, similarly as in our previous papers.28-32 The optimized conformation of this free [2.2.2]paracyclophane, having a symmetry very close to C3, is given in Figure 4.
Furthermore, we must emphasize that the only conformation was obtained by the full DFT optimization of the [2.2.2]paracyclophane - Rb+ complex (i.e., [Rb(C24H24)]+), which is shown in Figure 5. It should be
Figure 4. Two projections of the DFT optimized structure of free [2.2.2]paracyclophane (w-B97XD / def2-TZVP).
stated that the respective vibrational calculations found no imaginary frequencies. In the cationic complex [Rb(C24H24)]+ with a symmetry very close to C3 as well, the "central" cation Rb+, fully located in the cavity of the parent [2.2.2]paracyclophane ligand, is coordinated to all three benzene rings of [2.2.2]paracyclophane via cation-n interaction (the distances between the "central" cation Rb+ and the centroids of the three benzene rings are 2.88, 2.88, and 2.88 A), as also presented in detail in Figure 5. Further conformation of the [Rb(C24H24)]+ complex was not found by using the above-mentioned theoretical procedure. Besides, from comparison of Figure 4 with Figure 5, it is obvious that the inclusion of the rubidium cation causes a slight deformation of the ligand molecule in the considered [Rb(C24H24)]+ complex. It must be pointed out that encapsulation of light alkali metal cation Na+ do not cause any deformation of the mentioned [2.2.2]paracyclophane ligand (see Figure 6).24
Finally, the binding energy, -E(int), of the [Rb(C24H24)]+ complex, involving the 7point correction for the basis set superposition error (BSSE),33,34 was calculated as -99.3 kJ/mol. Recently, the binding energy of the
Figure 5. Two projections of the DFT optimized structure of the [Rb(C24H24)]+ complex (w-B97XD / def2-TZVP); the distances between the "central" cation Rb+ and the centroids of the three benzene rings are 2.88, 2.88, and 2.88 A.
Figure 6. DFT optimized structure of the [Na(C24H24)]+complex (w-B97XD / def2-TZVP); the distances between the "central" cation Na+ and the centroids of the three benzene rings are 2.65, 2.63, and 2.60 Â (Ref. 24).
complex [2.2.2]paracyclophane - Tl+ (i.e., [Tl(C24H24)]+) in the gas phase has been determined as -198.1 kJ/mol.23 It means that the stability of the investigated complex [Rb(C24H24)]+ in the gas phase is substantially lower than that of the mentioned [Tl(C24H24)]+ complex species, although the deformation of the ligand, caused by an inclusion of the Tl+ cation is even higher, than in the case of the Rb+ cation.23 This is evidently caused by the higher "softness" of Tl+ in comparison with Rb+.
4. Conclusions
In this work, we have shown that an experimental (ESI-MS) and theoretical (DFT calculations) approach can provide important information concerning the noncova-lent binding interaction between the electroneutral [2.2.2] paracyclophane ligand and the univalent rubidium cation (Rb+) in the gas phase. On the basis of the mentioned experimental method, the cationic complex [Rb(C24H24)]+ was evidenced quite unambiguously. In addition, employing DFT calculations, the most probable conformation of this fascinating rubidium(I) complex was suggested. In the resulting complex [Rb(C24H24)]+ with a symmetry very close to C3, the "central" cation Rb+, fully located in the cavity of the parent [2.2.2]paracyclophane ligand, is coordinated to all three benzene rings of [2.2.2]paracyclophane via cation-n interaction. It means that [2.2.2]paracyclophane can be considered as a receptor for the rubidium cation in the gas phase. As follows from the previous facts, the present work may be a significant contribution especially to both experimental and theoretical study of [2.2.2]paracy-clophane, as well as to structural chemistry in general.
5. Acknowledgements
This work was supported by the Grant Agency of Faculty of Environmental Sciences, Czech University of Life Sciences, Prague, Project No.: 42900/1312/3114 entitled "Environmental Aspects of Sustainable Development of Society", as well as by the Czech Ministry of Education, Youth, and Sports (Project MSMT No.: 20/2015).
6. References
1.	Comprehensive Supramolecular Chemistry, vol. 1, edited by J. L. Atwood, J. E. D. Davis, D. D. MacNicol, F. Vögtle, Perga-mon, Oxford, UK, 1996.
2.	F. Vögtle, S. Ibach, M. Nieger, C. Chartroux, T. Krüger, H. Stephan, K. Gloe, Chem. Commun. 1997, 1809-1810. DOI:10.1039/A703715E
3.	J. L. Pierre, P. Baret, P. Chautemps, M. Armand, J. Am. Chem. Soc. 1981, 103, 2986-2988. DOI:10.1021/ja00401a013
4.	J. Gross, G. Harder, A. Siepen, J. Harren, F. Vögtle, H. Stephan, K. Gloe, B. Ahlers, K. Cammann, K. Rissanen, Chem. Eur. J. 1996, 2, 1585-1595. DOI:10.1002/chem.19960021218
5.	E. G. Buchanan, J. C. Dean, T. S. Zwier, E. L. Sibert III, J. Chem. Phys. 2013, 138, 064308/1-064308/11.
DOI: 10.1063/1.4790163
6.	A. O. Ortolan, G. F. Caramori, G. Frenking, A. Muñoz-Castro, New J. Chem. 2015, 39, 9963-9968. DOI:10.1039/C5NJ02384J
7.	D. A. Dougherty, Science 1996, 271, 163-168. https://www.ncbi.nlm.nih.gov/pubmed/8539615
8.	A. S. Mahadevi, G. N. Sastry, Chem. Rev. 2013, 113, 21002138. DOI:10.1021/cr300222d
9.	J. C. Ma, D. A. Dougherty, Chem. Rev. 1997, 97, 1303-1324. DOI:10.1021/cr9603744
10.	K. S. Kim, P. Tarakeshwar, J. Y. Lee, Chem. Rev. 2000, 100, 4145-4185. DOI:10.1021/cr990051i
11.	N. Zacharias, D. A. Dougherty, Trends Pharm. Sci. 2002, 23, 281-287. https://www.ncbi.nlm.nih.gov/pubmed/12084634
12.	G. W. Gokel, Chem. Commun. 2003, 2847-2852. DOI:10.1039/b305483g
13.	D. Schröder, H. Schwarz, J. Hrusák, P. Pyykkö, Inorg. Chem. 1998, 37, 624-632. DOI:10.1021/IC970986M
14.	A. Gapeev, C.N. Yang, S. J. Klippenstein, R. C. Dunbar, J. Phys. Chem. A 2000, 104, 3246-3256. DOI: 10.1021/jp992627d
15.	S. Tsuzuki, M. Yoshida, T. Uchimaru, M. Mikami, J. Phys. Chem. A 2001, 105, 769-773. DOI:10.1021/jp003287v
16.	H. Huang, M. T. Rodgers, J. Phys. Chem. A 2002, 106, 42774289. DOI:10.1021/jp013630b
10. Y. Mo, G. Subramanian, J. Gao, D. M. Ferguson, J. Am. Chem.
Soc. 2002, 124, 4832-4837. DOI:10.1021/ja0174433 18. A. S. Reddy, G. N. Sastry, J. Phys. Chem. A 2005, 109, 88938903. DOI:10.1021/jp0525179
19.	D. Vijay, G. N. Sastry, Phys. Chem. Chem. Phys. 2008, 10, 582-590. DOI:10.1039/B713703F
20.	K. Sakurai, T. Mizuno, H. Hiroaki, K. Gohda, J. Oku, T. Tana-ka, Angew. Chem., Int. Ed. Engl. 2005, 44, 6180-6183. DOI:10.1002/anie.200500806
21.	C. Cohen-Addad, P. Baret, P. Chautemps, J. L. Pierre, Acta Crystallogr., Sect. C: Cryst. Struct. Commun. 1983, C39, 13461349. DOI:10.1107/S0108270183008483
22.	P. G. Jones, P. Bubenitschek, F. Heirtzler, H. Hopf, Acta Crystallogr., Sect. C: Cryst. Struct. Commun. 1996, C52, 13801384. DOI: 10.1107/S0108270195017008
23.	E. Makrlik, S. Böhm, D. Sykora, B. Klepetarova, P. Vanura, M. Polasek, Chem. Phys. Lett. 2015, 642, 39-42. DOI:10.1016/j.cplett.2015.10.074
24.	E. Makrlik, D. Sykora, S. Böhm, P. Vanura, J. Mol. Struct. 2018, 1154, 79-82. DOI:10.1016/j.molstruc.2017.10.027
25.	J.-D. Chai, M. Head-Gordon, Phys. Chem. Chem. Phys. 2008, 10, 6615-6620. DOI:10.1039/b810189b
26.	M. J. Frisch, G. W. Trucks, H. B. Schlegel, G. E. Scuseria, M. A. Robb, J. R. Cheeseman, G. Scalmani, V. Barone, B. Men-nucci, G. A. Petersson, H. Nakatsuji, M. Caricato, X. Li, H. P. Hratchian, A. F. Izmaylov, J. Bloino, G. Zheng, J. L. Sonnenberg, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Haseg-awa, M. Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai, T. Vreven, J. A. Montgomery, Jr., J. E. Peralta, F. Ogliaro, M. Bearpark, J. J. Heyd, E. Brothers, K. N. Kudin, V. N. Starover-ov, R. Kobayashi, J. Normand, K. Raghavachari, A. Rendell, J. C. Burant, S. S. Iyengar, J. Tomasi, M. Cossi, N. Rega, J. M. Millam, M. Klene, J. E. Knox, J. B. Cross, V. Bakken, C. Adamo, J. Jaramillo, R. Gomperts, R. E. Stratmann, O. Yazyev, A. J. Austin, R. Cammi, C. Pomelli, J. W. Ochterski, R. L. Martin, K. Morokuma, V. G. Zakrzewski, G. A. Voth, P. Salvador, J. J. Dannenberg, S. Dapprich, A. D. Daniels, Ö. Farkas, J. B. Foresman, J. V. Ortiz, J. Cioslowski, D. J. Fox, Gaussian 09, Revision C.01. Gaussian Inc., Wallingford, CT (2009).
27.	F. Weigend, R. Ahlrichs, Phys. Chem. Chem. Phys. 2005, 7, 3297-3305. DOI:10.1039/b508541a
28.	J. Kriz, J. Dybal, E. Makrlik, P. Vanura, B. A. Moyer, J. Phys. Chem. B 2011, 115, 7578-7587. DOI:10.1021/jp203221k
29.	E. Makrlik, P. Vanura, R. Rathore, Monatsh. Chem. 2015, 146, 521-525. DOI:10.1007/s00706-014-1370-y
30.	E. Makrlik, P. Vanura, Mol. Phys. 2015, 113, 3712-3716. DOI: 10.1080/00268976.2015.1054326
31.	E. Makrlik, S. Böhm, P. Vanura, P. Ruzza, Mol. Phys. 2015, 113, 1472-1477. DOI:10.1080/00268976.2015.1006276
32.	E. Makrlik, J. Kvicala, P. Vanura, Mol. Phys. 2016, 114, 20462051. DOI:10.1080/00268976.2016.1177221
33.	L. Turi, J. J. Dannenberg, J. Phys. Chem. 1993, 97, 2488-2490. DOI:10.1021/j100113a002
34.	J. E. Rode, J. C. Dobrowolski, Chem. Phys. Lett. 2002, 360, 123-132. DOI:10.1016/S0009-2614(02)00779-0
Povzetek
Z uporabo elektrosprej ionizacijske masne spektrometrije (ESI-MS) smo dokazali, da rubidijev kation (Rb+) z elektronev-tralnim [2.2.2] paraciklofanskim ligandom (C24H24) tvori kationski kompleks [Rb(C24H24)]+. S pomočjo kvantno-kem-ijskih izračunov smo določili tudi najbolj verjetno konformacijo tega kompleksa. Ugotovili smo, da ima simetrijo zelo blizu C3, da je „osrednji" kation Rb+ v celoti umeščen v prostor matičnega [2.2.2]paraciklofanskega liganda, in koordiniran z vsemi tremi benzenskimi obroči [2.2.2]paraciklofana preko kation-n interakcije. Ocenili smo energijo vezave, E(int), obravnavanega kation-n kompleksa [Rb(C24H24)]+. Vrednost -99,3 kJ/mol potrjuje verjetnost nastanka tega zanimivega kompleksa, kar pomeni, da [2.2.2]paraciklofanski ligand lahko obravnavamo kot receptor Rb+ v plinski fazi.
Erratum for
"Trans-Activation Response Element RNA is Detectable in the Plasma of a Subset of Aviremic HIV-1-Infected Patients"
Anžej Hladnik,1 Jana Ferdin,1 Katja Goričar,1 Steven G. Deeks,2 Boris M. Peterlin,2 Ana Plemenitaš,1 Vita Dolžan1 and Metka Lenassi1^
* Corresponding author: E-mail: metka.lenassi@mf.uni-lj.si, Tel: +386-1-5437658; Fax: +386-1-5437641
Acta Chim Slov. 2017 Sep; 64(3): 530-536. ID 2863. DOI: 10.17344/acsi.2016.2863
With this Erratum, we would like to acknowledge that Anzej Hladnik and Jana Ferdin contributed equally to the published work. Therefore, the authorship of the manuscript should have been written as follows:
Trans-Activation Response Element RNA is Detectable in the Plasma of a Subset of Aviremic HIV-1-Infected Patients
Anžej Hladnik,1,3 Jana Ferdin,1,3 Katja Goričar,1 Steven G. Deeks,2 Boris M. Peterlin,2 Ana Plemenitaš,1 Vita Dolžan1 and Metka Lenassi1^
* Corresponding author: E-mail: metka.lenassi@mf.uni-lj.si, Tel: +386-1-5437658; Fax: +386-1-5437641
3 These authors contributed equally to this work.
DRUŠTVENE VESTI IN DRUGE AKTIVNOSTI SOCIETY NEWS, ANNOUNCEMENTS, ACTIVITIES
Vsebina
Poročilo o delu v letu 2017..........................................................................................................................................................................................................S51
Koledar važnejših znanstvenih srečanj s področja kemije,
kemijske tehnologije in kemijskega inženirstva....................................................................................................................................S55
Navodila za avtorje....................................................................................................................................................................................................................................S62
Contents
Report for 2017................................................................................................................................................................................................................................................S51
Scientific meetings - chemistry, chemical technology and chemical engineering..................S55
Instructions for authors....................................................................................................................................................................................................................S62
POROČILO PREDSEDNIKA SLOVENSKEGA KEMIJSKEGA DRUŠTVA
O DELU DRUŠTVA V LETU 2017
V	letu 2017 je bilo društvo aktivno na številnih področjih. Izvajali smo redne letne aktivnosti, pri katerih je bil glavni poudarek na rednem izdajanju društvene revije Acta Chimica Slovenica ter organizaciji največjega letnega dogodka društva, konference »Slovenski kemijski dnevi 2017«.
Slovenski kemijski dnevi 2017 so bili organizirani v Portorožu, v Kongresnem centru Grand hotela Bernardin, od 20-22. septembra 2017.
Programskemu in organizacijskemu odboru je predsedoval takratni predsednik društva, prof. dr. Venčeslav Kaučič, skupaj s člani odbora v zasedbi prof. dr. Marija Bešter Rogač, prof. dr. Zorka Novak Pintarič, prof. dr. Darja Lisjak, prof. dr. Marjan Veber in prof. dr. Janez Plavec. Na posvetovanju je bilo predstavljenih več kot 100 prispevkov v obliki predavanj in posterjev. Delo je potekalo plenarno in v dveh vzporednih sekcijah. Udeleženci konference so bili zelo zadovoljni s kakovostjo znanstvenih in strokovnih prispevkov ter spremljevalnim programom srečanja. Na konferenci je sodelovalo 16 sponzorjev. Objavili smo Zbornik povzetkov in referatov konference, ki je dostopen na USB ključu ter na voljo v številnih strokovnih knjižnicah po Sloveniji.
Plenarni predavatelji so bili: prof. dr. Barbara Malič (Institut »Jožef Stefan«), prof. dr. Jurij Lah (Fakulteta za kemijo in kemijsko tehnologijo, Univerza v Ljubljani), prof. dr. Andràs Perczel (Eôtvôs Lorand University, Institute of Chemistry, Madžarska) in prof. dr. Ferenc Friedler (Pazmany Péter Catholic University Budapest, Madžarska). Poleg štirih plenarnih predavanj so udeleženci poslušali sedem "keynote" vabljenih predavanj, ki so jih izvedli prof. dr. Iztok Turel (Fakulteta za kemijo in kemijsko tehnologijo, Univerza v Ljubljani), prof. dr. Darja Lisjak (Institut »Jožef Stefan«), doc. dr. Boštjan Genorio (Fakulteta za kemijo in kemijsko tehnologijo, Univerza v Ljubljani), prof. dr. Zdenko Časar (Lek d.d.), prof. dr. Gregor Mali (Kemijski inštitut), prof. dr. Slobodan Gadžuric (Faculty of Science, University of Novi Sad, Srbija) in doc. dr. Matjaž Finšgar (Fakulteta za kemijo in kemijsko tehnologijo, Univerza v Mariboru).
V	sklopu konference smo 21. septembra 2017 izvedli redni občni zbor društva, na katerem smo izvolili novo vodstvo za mandatno obdobje september 2017 - september 2021. Predsedevanje društva je prevzel dr. Albin Pintar, podpredsedstvo prof. dr. Marjan Veber, prof. dr. Zdravko Kravanja in prof. dr. Matjaž Valant. Vlogo tajnikov so člani društva zaupali prof. dr. Mariji Bešter Rogač in dr. Maticu Lozinšku, vlogo blagajnika pa dr. Samu An-drenšku. Izvolili smo tudi nove člane glavnega odbora, nadzornega odbora in častnega razsodišča.
V	letniku Acta Chimica Slovenica 2017 (vol. 64) so izšle štiri številke s skupno 105 originalnimi znanstvenimi
članki, 2 preglednima člankoma in 9 kratkimi prispevki na skupno 1055 straneh z dvokolonskim tiskom. V slovenskem delu revije so bila na 129 straneh kot društvene vesti objavljena sekcijska poročila, seznami diplomskih, magistrskih in doktorskih del s področja kemije v letu 2017 in en slovenski strokovni članek o kemijskem laboratoriju celjske kraljice. Tretja številka je bila posvečena konferenci mladih znanstvenikov z naslovom »Cutting Edge«, četrta pa akademiku profesor Mihi Tišlerju ob njegovi 90. letnici. V uredništvo je prispelo preko 1200 prispevkov, vendar jih zaradi neustrezne tehnične priprave in dokumentacije zavrnemo več kot 80 % brez recenzije. Slaba polovica recenziranih člankov je pozitivno ocenjenih. Objavljeni članki pokrivajo aktualna področja organske, anorganske, fizikalne in analizne kemije, kemije materialov, kemijskega, biokemijskega in okoljskega inženirstva ter splošne, uporabne in biomedicinske kemije. Pisani so v angleškem jeziku s slovenskim povzetkom. Faktor vpliva (Impact Factor) ACSi za leto 2016 znaša IF = 0,984 in se je kljub prizadevnemu delu urednikov nekoliko znižal (IF = 1,167 za 2015). Na internetni strani http://acta.chem-soc.si objavljamo elektronsko verzijo revije Acta Chimica Slovenica, kar povečuje branost ter mednarodno odmevnost revije. Članki, objavljeni v ACSi, so povzeti tudi v Chemical Abstracts Plus, Current Contents (Physical, Chemical and Earth Sciences), Science Citation Index Expanded in Scopus. V pričetku leta 2017 smo uvedli uporabo licence Creative Commons, ki ureja avtorske pravice objavljenih člankov.
Januarja 2018 je nova odgovorna urednica ACSi postala prof. dr. Ksenija Kogej, z odhodom prejšnjega odgovornega urednika prof. dr. Aleksandra Pavka pa sta se v uredniškem odboru zamenjala tudi dva področna urednika (namesto M. Bešter-Rogač in A. Pavko sedaj K. Kogej in A. Podgornik). S prvo številko v letu 2018 bo ACSi izhajala le še v elektronski obliki, zato uredniški odbor pripravlja spremembe v elektronskem obveščanju bralcev o izhajanju revije. Tako načrtujemo nadgradnjo spletne strani in tudi novo vrsto člankov - vabljene tematske članke, ki bodo pisani na vabilo UO. Pričakujemo, da bo ta kategorija člankov prispevala k večji branosti in odmevnosti revije. Tako kot v prejšnjih letih bodo tudi v 2018 izšle 4 številke ACSi. Četrta številka bo posvečena prof. dr. Ivanu Kregarju.
Društvo je bilo tudi v letu 2017 uspešno pri prijavili na Javni razpis za sofinanciranje izdajanja domačih znanstvenih periodičnih publikacij v letu 2017 in 2018. Dobili smo odobrena sredstva v višini 36.284,08 EUR za obe leti, kar je letno 18.142,04 EUR. V primerjavi s preteklim razpisom (2015 in 2016) je to 21.565,04 EUR manj. V letu 2017 smo prejeli sredstva v treh obrokih.
Zahvaljujem se tudi vsem inštitucijam, ki so v letu 2017 finančno podprle izdajanje revije. Te so Fakulteta za
kemijo in kemijsko tehnologijo Univerze v Ljubljani, Fakulteta za Kemijsko in kemijsko tehnologijo Univerze v Mariboru, Kemijski inštitut, Inštitut »Jožef Stefan« in Fakulteta za farmacijo Univerze v Ljubljani. Sponzorji revije so bili z objavo oglasa Krka d.d., Novo mesto, Donau Lab d.o.o. Ljubljana in Helios Domžale, d.o.o.
V letu 2017 smo nadaljevali z aktivnostmi za pridobivanje novih članov. Medse smo jih privabili 26, od tega 6 študentov. Za ta namen smo konec leta 2017 pričeli s prenovo grafične podobe društva ter s pomočjo grafične oblikovalke izdelali plakate, ki nagovarjajo nove člane k vpisu. Plakate smo že razobesili po številnih inštitucijah, s to aktivnostjo bomo nadaljevali tudi v letu 2018. Za nove člane smo uvedli simbolno darilo (reprezentančne kemične svinčnike) ob njihovem vpisu v društvo. Člane smo o aktivnostih v letu 2017 še pogosteje obveščali preko elektronske pošte in preko spletne strani društva, proti koncu leta 2017 pa smo za namene promocije in obveščanja vzpostavili tudi Facebook in Twitter profil društva, ki sta hitro in dobro zaživela.
Člani Slovenskega kemijskega društva so bili dejavni tudi na področju mednarodnega sodelovanja. Predvsem je potrebno omeniti članstvo društva v mednarodnih združenjih IUPAC, ECTN, IUCr, EURACHEM, Eu-CheMS, EFCE, EPF in ECA.
Poleg članstva v teh organizacijah, so se izvajale tudi nekatere druge pomembne mednarodne aktivnosti:
Predsednik društva Venčeslav Kaučič in tajnik društva Marjan Veber sta se udeležila generalne skupščine ECTN na Malti od 1-4 aprila 2017. Na tem srečanju je bil Marjan Veber izvoljen za glavnega zakladnika tega evropskega združenja.
Prof. dr. Zdravko Kravanja se je udeležil generalne skupščine EFCE v Barceloni, 1. oktobra 2017. Generalna skupščina poteka v sklopu »10th World Congress of Chemical Engineering, WCCE10«, ki se ga udeležujejo tudi člani društva.
Predsednik Slovenskega kemijskega društva, prof. dr. Venčeslav Kaučič se je udeležil generalne skupščine EuCheMS v Rimu, Italija, od 26-27. septembra 2017. Na generalni skupščini so podpisali dokument »Research and Education Without Borders After Brexit: A Position Paper« in obravnavali druge pomembne teme na evropski ravni. Potekale so tudi priprave na 7. kongres EuCheMS, ki bo leta 2018 v Liverpoolu, UK, od 26-30. avgusta. Slovensko kemijsko društvo skrbi za promocijo konference preko spletne strani, družabnih omrežij in z deljenjem letakov.
Predsednica sekcije EURACHEM Slovenija, Dr. Ni-neta Hrastelj in drugi člani društva, so aktivno sodelovali pri organizaciji delavnice »9th Proficiency testing in analytical chemistry, microbiology and laboratory medicine 0 Current Practice and Future Directions«, ki je bila od 9-12. oktobra 2017 v Portorožu.
Kristalografska sekcija je pod vodstvom prof. dr. Antona Medena in drugih aktivnih članov organizirala
25. Slovensko-hrvaško kristalografsko srečanje, ki je potekalo od 14-18. junija 2017 na FKKT, UL.
Prof. dr. Venčeslav Kaučič se je v Rimu udeležil Generalne skupščine EuCheMS, ki je potekala 26. in 27. septembra 2017.
Od 7-14. julija 2017 se je prof. dr. Venčeslav Kaučič, takrat še v vlogi predsednika Slovenskega kemijskega društva in titularnega člana ChemRAWN odbora IUPAC, udeležil sestanka Generalne skupščine in Izvršilnega odbora IUPAC, ki sta potekala v Sao Paulo, Brazilija. Poleg naštetih dveh dogodkov je v času IUPAC GA potekal še sestanek predsednikov kemijskih društev - World Chemistry Leadership Meeting in dvodnevni sestanek ChemRAWN odbora.
Predsednik Sekcije za polimere dr. David Pahovnik, se je od 2-7. julija 2017 udeležil generalne skupščine Evropske polimerne federacije, ki je potekala v Lyonu, Francija. Sekcija za polimere je septembra 2017 za člane sekcije organizirala tudi predavanje prof. Devona A. Ship-pa iz Clarkson univerze, Potsdam, NY, ZDA.
Člani IUPAC Affiliate Membership Program so v letu 2017 prejeli šest številk revije Chemistry International, imeli možnost ugodnejših kotizacij pri udeležbi na konferencah IUPAC ter pri nakupu literature (nomenklature itd.).
Člani društva so bili aktivni pri pripravah na organizacijo dveh mednarodnih konferenc, ki bosta potekali leta 2018 in 2019 in kjer pričakujemo številčno mednarodno udeležbo. To sta konferenci ECIS 2018 (32nd Conference of The European Colloid and Interface Society: 2-7. september 2018, Ljubljana) in konferenca EAAOP-6 (6th European Conference on Environmental Applications of Advances Oxidation Processes: 26-30. junij 2019, Portorož).
Društvo se je v letu 2017 uspešno prijavilo na Javni razpis ARRS za sofinanciranje delovanja v mednarodnih znanstvenih združenjih v letu 2017, kjer smo bili uspešni pri vseh oddanih vlogah.
15. junija 2017 je društvo v sodelovanju s Kemijskim inštitutom slavnostno odkrilo doprsni kip prof. Maksa Samca. Dogodek je potekal v okviru tedna Kemijskega inštituta. Častni gost in slavnostni govorec prireditve je bil predsednik Državnega zbora Republike Slovenije dr. Milan Brglez. Nekaj besed o delu in življenju akademika Maksa Samca je, kot predstavnik Slovenske akademije znanosti in umetnosti ter Slovenskega kemijskega društva, povedal tudi akad. prof. dr. Branko Stanovnik. Doprsni kip je delo akademskega kiparja Marjana Keršiča Belača, za idejno zasnovo podstavka in njegovo izvedbo pa je poskrbel akademski kipar Jiri Kočica.
Ljubljana, 15. marec 2018
dr. Albin Pintar predsednik društva
Mariborska podružnica
Mariborska podružnica se je v letu 2017 usmerila v izpolnitev ciljev, ki si jih je zastavila v preteklem letu.
Člani mariborske podružnice smo se udeležili že tradicionalne konference ,Slovenski Kemijski Dnevi, ki so potekali na v Portorožu. Predsedovali smo posameznim sekcijam in sodelovali kot predavatelji.
Skrb Mariborske podružnice je tudi stalno izobraževanje članov. V ta namen smo organizirali strokovna predavanja in razne seminarje, na katerih so predavali priznani tuji in domači strokovnjaki. Predavanja so pokrivala pomembna področja teoretične in uporabne kemije, kemijske in procesne tehnike ter kemijskega izobraževanja. V mesecu Maju smo gostili tujega predavatelja dr. Lam Hon Loong iz Univerze Nottingham, Tehnična fakulteta Malezija. Njegovo področje je v okviru procesne tehnike.
Prav tako smo v mesecu Maju gostili direktorja podjetja Sanofarm d.o.o. Simona Šutalo, ki se je predstavil s predavanjem iz področja Fitoterapija in njen pomen. V nadaljevanju je predstavil način dela v majhnem in interdisciplinarnem kolektivu. Predavanje je bilo še posebej dobrodošlo za absolvente druge stopnje, ki na nek način zaključujejo ali pa vsaj delno zaključujejo izobraževanje in se začno postavljati na lastne noge.
Aktivno smo sodelovali tudi pri mednarodnih poletnih šolah. V mesecu juliju na naši fakulteti potekala 22. mednarodna poletna šola na temo visokotlačnih tehnologij: »ESS-HPT« The Eurpean Summer school in High Pressure Technology, ki jo je organiziral naš Laboratorij za Separacijske procese in produktno tehniko v sodelovanju s Tehnološko fakulteto v Grazu.
dr. Regina Fuchs-Godec
Poročilo Sekcije za kristalografijo za leto 2017
Sekcija za kristalografijo pri Slovenskem kemijskem društvu je v letu 2017 skupaj s hrvaškim kristalografskim društvom iz Zagreba organizirala 25. (jubilejno) zaporedno srečanje slovenskih in hrvaških kristalografov. Srečanje je potekalo v Sloveniji v Ljubljani v prostorih nove stavbe Fakultete za kemijo in kemijsko tehnologijo. Kot vsako leto je bila tudi tokrat udeležba mednarodna, zato je bil uradni jezik srečanja angleščina. S sredstvi donatorjev in sponzorjev ter veliko prostovoljnega dela članov sekcije smo uspeli organizirati srečanje tako, da smo obdržali tradicijo, da za udeležence ni bilo kotizacije.
Podobno kot na prejšnjih konferencah, so se tudi tokrat povabilu za sodelovanje odzvali ugledni, mednarodno uveljavljeni plenarni predavatelji. To so bili Elena Bol-dyreva (Novosibrisk, Rusija), »High-pressure studies of organic and coordination compounds«; Jeremy Karl Coc-kroft (London, Združeno kraljestvo), »Powder Diffraction: an Essential Complementary Tool for those Skilled in the Art but one with Pitfalls for the Unwary«; Marjan Ma-rinšek (Ljubljana, Slovenija), »Microstructure evolution in cermet anodes for solid oxide fuel cells«; Krešimir Molča-nov (Zagreb, Hrvaška), »Stacking of planar conjugated rings - beyond aromatics«; Dietmar Stalke, (Gottingen,
Germany) »More than 100 years of Lewis' diagrams - still valid in the light of charge density?«. Novost na srečanjih je bila dobro obiskana delavnica za uporabo programa Olex2 (prav tako brezplačna za udeležence), ki jo je vodil Horst Puschmann (Durham, Združeno kraljestvo),
Konferenca je bila po obisku in po kakovosti prispevkov uspešna. Udeleženci so v 66 prispevkih v obliki predavanj osvetlili številna področja kristalografije. Srečanje je bil tako v strokovnem delu kot na družabnih dogodkih (vodena ekskurzija po Ljubljani z vožnjo po Ljubljanici in večerjo na Ljubljanskem gradu) spet priložnost za izmenjavo spoznanj, navezavo stikov in intenzivno učenje mlajših kolegov.
Zaradi omejenih sredstev v raziskovalnih programih ni projektih, smo se slovenski kristalografi v letu 2017 lahko le v omejenem številu (en udeleženec) udeležiti svetovnega kongresa IUCr v Hyderabadu v Indiji.
Aktivno poteka delo za pripravo 26. Slovensko- hrvaškega kristalografskega srečanja, ki bo junija 2018 v Po-reču. S hrvaškimi kolegi pa bomo sodelovali tudi pri kandidaturi za organizacijo Evropske konference o praškovni difrakciji.
prof. dr. Anton Meden
KOLEDAR VAŽNEJŠIH ZNANSTVENIH SREČANJ S PODROČJA KEMIJE IN KEMIJSKE TEHNOLOGIJE
SCIENTIFIC MEETINGS -CHEMISTRY AND CHEMICAL ENGINEERING
2018
July 2018_
1	- 5
Information: 1 - 6
Information:
2	- 6
Information: 3 - 8
Information: 8 - 11
Information: 8 - 12
Information: 8 - 13
Information:
8	- 13
Information:
9	- 13
Information:
10	- 14 Information: 12 - 15 Information:
WORLD POLYMER CONGRESS MACRO18 Cairns Queensland, Australia http://www.macro18.org
24th IUPAC INTERNATIONAL CONFERENCE ON PHYSICAL ORGANIC CHEMISTRY (ICPOC 24) Faro, Portugal http://icpoc24.ualg.pt/
XVI INTERNATIONAL IUPAC CONFERENCE ON HIGH TEMPERATURE MATERIALS CHEMISTRY (HTMC-XVI) Ekaterinburg, Russian Federation http://htmc16.ru/
5th INTERNATIONAL CONGRESS ON CHEMISTRY FOR CULTURAL HERITAGE (CHEMCH 2018) Bucharest, Romania http://www.chemch2018.ro
8th INTERNATIONAL CONFERENCE ON ENGINEERING FAILURE ANALYSIS Budapest, Hungary
https://www.elsevier.com/icefa-conference
PREPA12 - SYMPOSIUM »SCIENTIFIC BASES FOR THE PREPARATION OF HETEROGENEOUS CATALYSTS« Louvain-la-Neuve, Belgium
https://www.ldorganisation.com/v2/produits.php?langue=english&cle_menus=1238916539
27th IUPAC INTERNATIONAL SYMPOSIUM ON PHOTOCHEMISTRY Dublin, Ireland
https://iupac.org/event/27th-iupac-international-symposium-photochemistry/
22nd INTERNATIONAL CONFERENCE ON PHOSPHORUS CHEMISTRY
Budapest, Hungary
http://www.icpc22.mke.org.hu/
EUROMEMBRANE 2018 Valencia, Spain
http://euromembrane2018.org/
25th INTERNATIONAL CONFERENCE ON CHEMISTRY EDUCATION ICCE 2018)
Sydney, Australia
http://www.icce2018.org/
7th INTERNATIONAL CONGRESS ON SUSTAINABILITY SCIENCE & ENGINEERING
Ohaio, USA
http://icosse.org/2018
15 - 20	THE 18th INTERNATIONAL SYMPOSIUM ON SOLUBILITY PHENOMENA AND
RELATED EQUILIBRIUM PROCESSES (ISSP) Tours, France Information:	http://issp18.org/
15	- 20	28th INTERNATIONAL CONFERENCE ON ORGANOMETALLIC CHEMISTRY
Florence, Italy Information:	http://www.icomc2018.com/
16	- 17	SUPPORTING FAIR EXCHANGE OF CHEMICAL DATA THROUGH STANDARDS
DEVELOPMENT Amsterdam, Netherlands Information:	www.go-fair.org
23 - 25	WORLD CONGRESS & EXPO ON CHEMICAL ENGINEERING & CATALYSIS
Osaka, Japan
Information:	https://scientificfederation.com/catalysis-2018/
30 - Aug 4	43rd INTERNATIONAL CONFERENCE ON COORDINATION CHEMISTRY
Sendai, Japan Information:	http://iccc2018.jp
August 2018 _
12 - 17	18th INTERNATIONAL BIOTECHNOLOGY SYMPOSIUM
Montréal, Canada Information:	http://ibs2018montreal.org/
25 - 29	23rd INTERNATIONAL CONGRESS OF CHEMICAL AND PROCESS ENGINEERING
CHISA 2018 Prague, Czech Republic Information:	http://2018.chisa.cz/
25	- 29	21st CONFERENCE ON PROCESS INTEGRATION, MODELLING AND OPTIMISATION
FOR ENERGY SAVING AND POLLUTION REDUCTION PRES 2018 Prague, Czech Republic Information:	http://2018.chisa.cz/
26	- 30	ECC7 - 7th EuCheMS CHEMISTRY CONGRESS
Liverpool, UK Information:	https://www.euchems2018.org/
26 - 30	35th INTERNATIONAL CONFERENCE ON SOLUTION CHEMISTRY (ICSC)
Szeged, Hungary Information:	http://www.mke.org.hu/ICSC2018
26 - 31	22nd INTERNATIONAL MASS SPECTROMETRY CONFERENCE (IMSC) 2018
Florence, Italy Information:	http://www.imsc2018.it/
30 - 31	ICOSSE 2018 : 20th INTERNATIONAL CONFERENCE ON OPERATING SYSTEMS AND
SOFTWARE ENGINEERING Bangkok, Thailand
Information:	https://www.waset.org/conference/2018/08/bangkok/ICOSSE
30 - Sep 3	INTERNATIONAL SUMMER SCHOOL "SUPRAMOLECULAR CHEMISTRY IN
MEDICINE AND IN TECHNOLOGY: ADVANCES AND CHALLENGES" Varna, Bulgaria Information:	http://supramedchem.orgchm.bas.bg
September 2018
2 - 6
Information:
SMARTER 6 meeting Ljubljana, Slovenia https://smarter6.ki.si/
2 - 6
Information: 2 - 6
Information: 2 - 7
Information:
2	- 7
Information:
3	- 7
Information:
4	- 7
Information:
4	- 7
Information:
5	- 7
Information: 5 - 7
Information: 5 - 8
Information: 9 - 12
Information: 9 - 12
Information: 9 - 12
Information: 9 - 13
Information: 9 - 14
Information:
EUROPEAN CONFERENCE ON RESEARCH IN CHEMICAL EDUCATION (ECRICE)
Warsaw, Poland
http://www.ecrice2018.pl/
EFMC-ISMC 2018 - XXV EFMC INTERNATIONAL SYMPOSIUM ON MEDICINAL
CHEMISTRY
Ljubljana, Slovenia
www.efmc-ismc.org
69th ANNUAL MEETING OF THE INTERNATIONAL SOCIETY OF
ELECTROCHEMISTRY
Bologna, Italy
http://annual69.ise-online.org/
32nd CONFERENCE OF EUROPEAN COLLOID AND INTERFACE SOCIETY (ECIS) Ljubljana, Slovenia
http://ecis2018.fkkt.uni-lj.si/index.html
25th INTERNATIONAL CONFERENCE ON HIGH RESOLUTION MOLECULAR SPECTROSCOPY - BILBAO 2018 Bilbao, Spain
http://www.chem.uni-wuppertal.de/conference/
12th CONFERENCE ON POLYMER-SOLVENT COMPLEXES AND INTERCALATES
(POLYSOLVAT-12)
Grenoble, France
https://iupac.org/event/12th-conference-polymer-solvent-complexes-intercalates-polysolvat-12/
N-LIGANDS2018 - 7th EuCheMS CONFERENCE ON NITROGEN-LIGANDS
Lisbon, Portugal
http://www.n-ligands2018.com/
ADVANCED INORGANIC MATERIALS GREEN AND UNCONVENTIONAL SYNTHESIS APPROACHES AND FUNCTIONAL ASSESSMENT (AIM 2018) Padova, Italy
http://www.chimica.unipd.it/silvia.gross/workshop/home.html
TBMCE 2018 - THE FIRST INTERNATIONAL CONFERENCE ON TECHNOLOGIES AND BUSINESS MODELS FOR CIRCULAR ECONOMY Portorož, Slovenia https://tbmce.um.si
15th EURASIA CONFERENCE ON CHEMICAL SCIENCES Rome, Italy
http://www.eurasia2018.org
24th CONFERENCE ON ISOPRENOIDS Bialystok, Poland https://isoprenoids-24.uwb.edu.pl/
12th EUROPEAN SYMPOSIUM ON BIOCHEMICAL ENGINEERING SCIENCES
Lisbon, Portugal
http://esbes2018.org/
16th EUROPEAN CONFERENCE ON MIXING Toulouse, France
http://inpact.inp-toulouse.fr/MIXING16/
EUROPEAN CORROSION CONGRESS Prague, Czech Republic http://www.eurocorr2018.org/
8th IUPAC INTERNATIONAL CONFERENCE ON GREEN CHEMISTRY
Bangkok, Thailand
http://www.greeniupac2018.com
10 - 14
Information: 13 - 15
Information:
16	- 19 Information: 16 - 21 Information: 16 - 21 Information:
17	- 18 Information:
18	- 21 Information: 19 - 21 Information: 19 - 21 Information: 19 - 22
Information: 24 - 27 Information: 30 - Okt. 3
Information: 30 - Okt. 4
Information:
9th INTERNATIONAL CONFERENCE FOR CONVEYING AND HANDLING OF PARTICULATE SOLIDS London, UK
http://www.constableandsmith.com/events/chops-2018/
2nd EDITION OF GLOBAL CONFERENCE ON CATALYSIS, CHEMICAL ENGINEERING & TECHNOLOGY (CAT-2018) Rome, Italy
https://catalysis-conferences.magnusgroup.org/
DISTILLATION & ABSORPTION CONFERENCE 2018
Florence, Italy
http://www.aidic.it/da2018/
22nd INTERNATIONAL CONFERENCE ON ORGANIC SYNTHESIS (22-ICOS) Florence, Italy
http://www.22-icos-florence.it
13th INTERNATIONAL CONFERENCE ON SOLID STATE CHEMISTRY
Pardubice, Czech Republic
http://www.ssc-conference.com/2018/
4th INTERNATIONAL CONFERENCE ON CHEMICAL ENGINEERING Vancouver, Canada
https://chemicalengineering.conferenceseries.com/
11th INTERNATIONAL DRYING SYMPOSIUM Valencia, Spain
http://www.ids2018.webs.upv.es/
SLOVENIAN CHEMICAL SOCIETY ANNUAL MEETING 2018 Portorož, Slovenia
http://chem-soc.si/scs-annual-meeting-2018
17th RUŽIČKA DAYS »TODAY SCIENCE - TOMORROW INDUSTRY« Vukovar, Croatia
http://www.ptfos.unios.hr/ruzicka/2014/
25th CONGRESS OF THE SOCIETY OF CHEMISTS AND TECHNOLOGISTS OF
MACEDONIA
Ohrid, Macedonia
http://www.sctm.mk/congress/index.php/SCTM/25Congress
XII ITALIAN FOOD CHEMISTRY CONGRESS (CHIMALI 2018)
Camerino, Italy
http://chimali2018.unicam.it/
5th INTERNATIONAL SYMPOSIUM ON GREEN CHEMISTRY, SUSTAINABLE DEVELOPMENT AND CIRCULAR ECONOMY Skiathos island, Greece http://greenchem5.civil.auth.gr/
13th CONFERENCE ON SUSTAINABLE DEVELOPMENT OF ENERGY, WATER AND ENVIRONMENT SYSTEMS - SDEWES CONFERENCE Palermo, Italy
http://www.palermo2018.sdewes.org
October 2018
4 - 5	2nd SYMPOSIUM ON ORGANIC AND INORGANIC CHEMISTRY, SOUTHERN AFRICA
Gaborone, Botswana
Information:	https://www.chalmers.se/en/conference/Organic_Inorganic_Chemistry
4 - 5	INTERNATIONAL SUSTAINABLE PRODUCTION AND CONSUMPTION CONFERENCE
Manchester, UK Information:	http://www.icheme.org/ispcc
7 - 12
Information: 10 - 12 Information: 14 - 17
Information: 14 - 18 Information: 16 - 19 Information:
18	- 19 Information:
19	- 21
Information: 21 - 24
Information: 24 - 25
Information: 28 - 31
Information:
27th EUCHEMS CONFERENCE ON MOLTEN SALTS AND IONIC LIQUIDS
(EUCHEMSIL2018)
Lisboa, Portugal
http://www.euchemsil2018.org/
EAST-WEST CHEMISTRY CONFERENCE 2018 (EWCC2018)
Lviv, Ukraine
http://ewcc2018.org/
4th INTERNATIONAL CONFERENCE ON BIOINSPIRED AND BIOBASED CHEMISTRY & MATERIALS Nice, France
http://www.unice.fr/nice-conference/
14th IUPAC INTERNATIONAL CONGRESS OF PESTICIDE CHEMISTRY Rio de Janeiro, Brazil
https://iupac.org/event/14th-iupac-international-congress-of-pesticide-chemistry/
IBERO AMERICAN CHEMISTRY CONGRESS Lima, Peru
http://sqperu.org.pe/congreso-2018/
INTERNATIONAL WORKSHOP ON ENERGETIC MATERIALS Istanbul, Turkey http://iwem2018.istanbul.edu.tr
3rd INTERNATIONAL CONGRESS OF CHEMISTS AND CHEMICAL ENGINEERS OF BOSNIA AND HERZEGOVINA Sarajevo, Bosnia and Herzegovina http://www.pmf.unsa.ba/hemija/kongres/index.php/en
15th INTERNATIONAL CONFERENCE ON MICROREACTION
TECHNOLOGY
Karlsruhe, Germany
http://dechema.de/en/IMRET2018.html
IES2018 - 25th SEMINAR AND SYMPOSIUM ON INFORMATION AND EXPERT SYSTEMS IN THE PROCESS INDUSTRIES Belgrade, Serbia
http://bg.ac.rs/en/members/faculties/FTM.php
XXIX INTERAMERICAN CONGRESS OF CHEMICAL ENGINEERING
INCORPORATING THE 68th CANADIAN CHEMICAL ENGINEERING
CONFERENCE
Toronto, Canada
http://www.csche2018.ca/
Nnvpmbpr 2018	
4 - 7	2018 - SUSTAINABLE INDUSTRIAL PROCESSING SUMMIT
	Rio de Janeiro, Brazil
Information:	https://www.flogen.org/sips2018/
4 - 8	EMERGING POLYMER TECHNOLOGIES SUMMIT
	Hanoi, Vietnam
Information:	http://emts 18. org/index.html
5 - 7	MicrobiotaMi 2018
	Milano, Italy
Information:	https://microbiotami.com/
5 - 9	XXIII INTERNATIONAL CONFERENCE ON CHEMICAL REACTORS
	Ghent, Belgium
Information:	http://conf.nsc.ru/CR_23/en/
7 - 9	14th INTERNATIONAL CONFERENCE ON POLYSACCHARIDES-GLYCOSCIENCE
(14th ICPG) Praha, Czech Republic Information:	http://www.polysaccharides.csch.cz/index.html
25 - 29	30th INTERNATIONAL SYMPOSIUM ON THE CHEMISTRY OF NATURAL PRODUCTS
AND THE 10TH INTERNATIONAL CONGRESS ON BIODIVERSITY Athens, Greece Information:	http://www.iscnp30-icobl0.org/
2019
January 2019
29
Information:
IYPT2019 OPENING CEREMONY Paris, France http://www.iypt20l9.org/
February 2019
12
Information:
EMPOWERING WOMEN IN CHEMISTRY: A GLOBAL NETWORKING EVENT Online
https://iupac.org/100/global-breakfast/
March 2019
31 - Apr. 4 Information:
AIChE SPRING MEETING 2019 AND 15th GLOBAL CONGRESS ON PROCESS SAFETY New Orleans, USA
https://www.aiche.org/conferences/aiche-spring-meeting-and-global-congress-on-process-safety/2019
May 2019
19 - 24 Information:
14th IUPAC INTERNATIONAL CONGRESS OF CROP PROTECTION CHEMISTRY
Ghent, Belgium
https://www.iupac2019.be
June 2019 _
2 - 6
Information: 16 - 19 Information: 16 - 20
Information:
14th international symposium on macrocyclic and supramolecular
CHEMISTRY Lecce, Italy https://ismsc2019.eu/
LOSS PREVENTION 2019 Delft, The Netherlands http://lossprevention2019.org/
17th INTERNATIONAL CONFERENCE ON CHEMISTRY AND THE ENVIRONMENT - ICCE2019 Thessaloniki, Greece
http://www.euchems.eu/ events/17th-international-conference-chemistry-environment-icce2019/
16 - 20	12th IWA INTERNATIONAL CONFERENCE ON WATER RECLAMATION AND REUSE
Berlin, Germany
Information:	http://efce.info/IWA+Conference+2019.html
26 - 28	THERMODYNAMICS 2019
Huelva, Spain
Information:	http://efce.info/Thermodynamics+2019.html
26 - 30	6th EUROPEAN CONFERENCE ON ENVIRONMENTAL APPLICATIONS OF
ADVANCED OXIDATION PROCESSES (EAAOP-6) Portorož, Slovenia Information:	http://eaaop6.ki.si/
July 2019 _
1 - 3
Information: 5 - 12
Information: 21 - 26
Information: 30 - Aug. 1
Information:
CONGRESS ON NUMERICAL METHODS IN ENGINEERING
Guimaräes, Portugal
www.cmn2019.pt
IUPAC 2019 PARIS FRANCE Paris, France
https://www.iupac2019.org/
THE 18th INTERNATIONAL SYMPOSIUM ON NOVEL AROMATIC COMPOUNDS
(ISNA-18)
Sapporo City, Japan
https://iupac.org/event/18th-international-symposium-novel-aromatic-compounds-isna-18/
8th INTERNATIONAL CONFERENCE FOR NETWORK FOR INTER-ASIAN CHEMISTRY EDUCATORS (NICE) Taipei, Taiwan
https://iupac.org/event/8th-international-conference-network-inter-asian-chemistry-educators/
September 2019
15 - 19
Information: 25 - 27 Information:
11th EUROPEAN CONGRESS OF CHEMICAL ENGINEERING - ECCE11 & 4th EUROPEAN CONGRESS OF APPLIED BIOTECHNOLOGY - ECAB5 Florence, Italy
http://efce.info/ECCE12_ECAB5-p-112545.html
SLOVENIAN CHEMICAL SOCIETY ANNUAL MEETING 2019 Maribor, Slovenia
http://chem-soc.si/slovenski-kemijski-dnevi-2019
Acta Chimica Slovenica
Author Guidelines
Submissions
Submission to ACSi is made with the implicit understanding that neither the manuscript nor the essence of its content has been published in whole or in part and that it is not being considered for publication elsewhere. All the listed authors should have agreed on the content and the corresponding (submitting) author is responsible for having ensured that this agreement has been reached. The acceptance of an article is based entirely on its scientific merit, as judged by peer review. There are no page charges for publishing articles in ACSi. The authors are asked to read the Author Guidelines carefully to gain an overview and assess if their manuscript is suitable for ACSi.
Additional information
•	Citing spectral and analytical data
•	Depositing X-ray data
Submission material
Typical submission consists of:
•	full manuscript (PDF file, with title, authors, abstract, keywords, figures and tables embedded, and references)
•	supplementary files
-	Full manuscript (original Word file)
-	Statement of novelty (Word file)
-	List of suggested reviewers (Word file)
-	ZIP file containing graphics (figures, illustrations, images, photographs)
-	Graphical abstract (single graphics file)
-	Proposed cover picture (optional, single graphics file)
-	Appendices (optional, Word files, graphics files)
Incomplete or not properly prepared submissions will be rejected.
Submission process
Before submission, authors should go through the checklist at the bottom of the page and prepare for submission.
Submission process consists of 5 steps. Step 1: Starting the submission
•	Choose one of the journal sections.
•	Confirm all the requirements of the checklist.
•	Additional plain text comments for the editor can be provided in the re I evant text field.
Step 2: Upload submission
•	Up I oad full manuscript in the form of a Word file (with titl e, authors, abstract, keywords, figures and tables embedded, and references).
Step 3: Enter metadata
•	First name, last name, contact email and af I iation for all authors, in re I evant order, must be provided. Corresponding author has to be se I ected. Full postal address and phone number of the corresponding author has to be provided.
•	Title and abstract must be provided in plain text.
•	Keywords must be provided (max. 6, separated by semicolons).
•	Data about contributors and supporting agencies may be entered.
•	References in plain text must be provided in the rel evant text filed.
Step 4: Upload supplementary files
•	Original Word file (original of the PDF uploaded in the step 2)
•	Statement of novelty in a Word file must be uploaded
•	All graphics have to be up I oaded in a single ZIP file. Graphics should be named Figure 1.jpg, Figure 2.eps, etc.
•	Graphical abstract image must be uploaded separately
•	Proposed cover picture (optional) should be up-l oaded separatel y.
•	Any additional appendices (optional) to the paper may be uploaded. Appendices may be published as a supplementary material to the paper, if accepted.
•	For each uploaded file the author is asked for additional metadata which may be provided. Depending of the type of the file please provide the relevant title (Statement of novelty, List of suggested reviewers, Figures, Graphical abstract, Proposed cover picture, Appendix).
Step 5: Confirmation
•	Final confirmation is required.
Article Types
Feature Articles are contributions that are written on editor's invitation. They should be clear and concise summaries of the most recent activity of the author and his/her research group written with the broad scope of ACSi in mind. They are intended to be general overviews of the authors' subfield of research but should be written in a way that engages and informs scientists in other areas. They should contain the following (see also general directions for article structure in ACSi below): (1) an introduction that acquaints readers with the authors' research field and outlines the important questions to which answers are being sought; (2) interesting, new, and recent contributions of the author(s) to the field; and (3) a summary that presents possible future directions. Manuscripts normally should not exceed 40 pages of one column format (letter size 12, 33 lines per page). Generally, experts in a field who have made important contribution to a specific topic in recent years will be invited by an editor to contribute such an Invited Feature Article. Individuals may, however, send a proposal (one-page maximum) for an Invited Feature Article to the Editorin-Chief for consideration.
Scientific articles should report significant and innovative achievements in chemistry and related sciences and should exhibit a high level of originality. They
should have the following structure:
1.	Tit I e (max. 150 characters),
2.	Authors and af I iations,
3.	Abstract (max. 1000 characters),
4.	Keywords (max. 6),
5.	Introduction,
6.	Experimental,
7.	Results and Discussion,
8.	ConcI usions,
9.	Acknowledgements, 10.References.
The sections should be arranged in the sequence generally accepted for publications in the respective fields and should be successively numbered.
Short communications generally follow the same order of sections as Scientific articles, but should be short (max. 2500 words) and report a significant aspect of research work meriting separate publication. Editors may decide that a Scientific paper is categorized as a Short Communication if its length is short.
Technical articles report applications of an already described innovation. Typically, technical articles are not based on new experiments.
Preparation of Submissions
Text of the submitted articles must be prepared with Microsoft Word. Normal style set to single column, 1.5 line spacing, and 12 pt Times New Roman font is recommended. Line numbering (continuous, for the whole document) must be enabled to simplify the reviewing process. For any other format, please consult the editor. Articles should be written in English. Correct spelling and grammar are the sole responsibility of the author(s). Papers should be written in a concise and succinct manner. The authors shall respect the ISO 80000 standard [1], and IUPAC Green Book [2] rules on the names and symbols of quantities and units. The Système International d'Unités (SI) must be used for all dimensional quantities.
Graphics (figures, graphs, illustrations, digital images, photographs) should be inserted in the text where appropriate. The captions should be self-explanatory. Lettering should be readable (suggested 8 point Arial font) with equal size in all figures. Use common programs such as MS Excel or similar to prepare figures (graphs) and ChemDraw to prepare structures in their final size. Width of graphs in the manuscript should be 8 cm. Only in special cases (in case of numerous data, visibility issues) graphs can be 17 cm wide. All graphs in the manuscript should be inserted in relevant places and aligned left. The same graphs should be provided separately as images of appropriate resolution (see below) and submitted together in a ZIP file (Graphics ZIP). Please do not submit figures as a Word file. In graphs, only the graph area determined by both axes should be in the frame, while a frame around the whole graph should be omitted. The graph area should be white. The legend should be inside the graph area. The style of all graphs should be the same. Figures and illustrations should be of sufficient quality for the printed version, i.e. 300 dpi minimum. Digital images and photographs should be of high quality (minimum 250 dpi resolution). On submission, figures should be of good enough resolution to be assessed by the referees, ideally as JPEGs. High-resolution figures (in JPEG,
TIFF, or EPS format) might be required if the paper is accepted for publication.
Tables should be prepared in the Word file of the paper as usual Word tables. The captions should appear above the table and should be self-explanatory.
References should be numbered and ordered sequentially as they appear in the text, likewise methods, tables, figure captions. When cited in the text, reference numbers should be superscripted, following punctuation marks. It is the sole responsibility of authors to cite articles that have been submitted to a journal or were in print at the time of submission to ACSi. Formatting of references to published work should follow the journal style; please also consult a recent issue:
1.	J. W. Smith, A. G. White, Acta Chim. Slov. 2008, 55, 1055-1059.
2.	M. F. Kemmere, T. F. Keurentjes, in: S. P. Nunes, K. V. Peinemann (Ed.): Membrane Technology in the Chemical Industry, Wiley-VCH, Weinheim, Germany, 2008, pp. 229-255.
3.	J. Levec, Arrangement and process for oxidizing an aqueous medium, US Patent Number 5,928,521, date of patent July 27, 1999.
4.	L. A. Bursill, J. M. Thomas, in: R. Sersale, C. Coll e I a, R. Aiell o (Eds.), Recent Progress Report and Discussions: 5th International Zeo I ite Conference, Naples, Italy, 1980, Gianini, Naples, 1981, pp. 25-30.
5.	J. Szegezdi, F. Csizmadia, Prediction of dissociation constant using microconstants, http://www. che-maxon.com/conf/Prediction_of_dissociation _con-stant_using_microco nstants.pdf, (assessed: March 31, 2008)
Titles of journals should be abbreviated according to Chemical Abstracts Service Source Index (CASSI).
Special Notes
•	Complete characterization, including crystal structure, should be given when the synthesis of new compounds in crystal form is reported.
•	Numerical data should be reported with the number of significant digits corresponding to the magnitude of experimental uncertainty.
•	The SI system of units and IUPAC recommendations for nomenclature, symbols and abbreviations should be followed closely. Additionally, the authors should follow the general guidelines when citing spectral and analytical data, and depositing crystallographic data.
•	Characters should be correctly represented throughout the manuscript: for example, 1 (one) and l (ell), 0 (zero) and O (oh), x (ex), D7 (times sign), B0 (degree sign). Use Symbol font for all Greek letters and mathematical symbols.
•	The rules and recommendations of the IUBMB and the International Union of Pure and Applied Chemistry (IUPAC) should be used for abbreviation of chemical names, nomenclature of chemical compounds, enzyme nomenclature, isotopic compounds, optically active isomers, and spectroscopic data.
•	A conflict of interest occurs when an individual (author, reviewer, editor) or its organization is involved in multiple interests, one of which could possibly corrupt the motivation for an act in the
other. Financial relationships are the most easily identifiable conflicts of interest, while conflicts can occur also as personal relationships, academic competition, etc. The Editors will make effort to ensure that conflicts of interest will not compromise the evaluation process; potential editors and reviewers will be asked to exempt themselves from review process when such conflict of interest exists. When the manuscript is submitted for publication, the authors are expected to disclose any relationships that might pose potential conflict of interest with respect to results reported in that manuscript. In the Acknowledgement section the source of funding support should be mentioned. The statement of disclosure must be provided as Comments to Editor during the submission process.
•	Published statement of Informed Consent.
Research described in papers submitted to ACSi must adhere to the principles of the Declaration of Helsinki (http://www.wma.net/e/policy/ b3.htm). These studies must be approved by an appropriate institutional review board or committee, and informed consent must be obtained from subjects. The Methods section of the paper must include: 1) a statement of protocol approval from an institutional review board or committee and 2), a statement that informed consent was obtained from the human subjects or their representatives.
•	Published Statement of Human and Animal Rights.When reporting experiments on human subjects, authors should indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2008. If doubt exists whether the research was conducted in accordance with the Helsinki Declaration, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. When reporting experiments on animals, authors should indicate whether the institutional and national guide for the care and use of laboratory animals was followed.
•	To avoid conflict of interest between authors and referees we expect that not more than one referee is from the same country as the corresponding au-thor(s), however, not from the same institution.
•	Contributions authored by Slovenian scientists are evaluated by non-Slovenian referees.
•	Papers describing microwave-assisted reactions performed in domestic microwave ovens are not considered for publication in Acta Chimica Slovenica.
•	Manuscripts that are not prepared and submitted in accord with the instructions for authors are not considered for publication.
Appendices
Authors are encouraged to make use of supporting information for publication, which is supplementary material (appendices) that is submitted at the same time as the manuscript. It is made available on the Journal's web site and is linked to the article in the
Journal's Web edition. The use of supporting information is particularly appropriate for presenting additional graphs, spectra, tables and discussion and is more likely to be of interest to specialists than to general readers. When preparing supporting information, authors should keep in mind that the supporting information files will not be edited by the editorial staff. In addition, the files should be not too large (upper limit 10 MB) and should be provided in common widely known file formats to be accessible to readers without difficulty. All files of supplementary materials are loaded separately during the submission process as supplementary files.
Proposed Cover Picture and Graphical Abstract Image
Graphical content: an ideally full-colour illustration of resolution 300 dpi from the manuscript must be proposed with the submission. Graphical abstract pictures are printed in size 6.5 x 4 cm (hence minimal resolution of 770 x 470 pixels). Cover picture is printed in size 11 x 9.5 cm (hence minimal resolution of 1300 x 1130 pixels)
Authors are encouraged to submit illustrations as candidates for the journal Cover Picture*. The illustration must be related to the subject matter of the paper. Usually both proposed cover picture and graphical abstract are the same, but authors may provide different pictures as well.
* The authors will be asked to contribute to the costs of the cover picture production.
Statement of novelty
Statement of novelty is provided in a Word file and submitted as a supplementary file in step 4 of submission process. Authors should in no more than 100 words emphasize the scientific novelty of the presented research. Do not repeat for this purpose the content of your abstract. List of suggested reviewers
List of suggested reviewers is a Word file submitted as a supplementary file in step 4 of submission process. Authors should propose the names, full affiliation (department, institution, city and country) and e-mail addresses of three potential referees. Field of expertise and at least two references relevant to the scientific field of the submitted manuscript must be provided for each of the suggested reviewers. The referees should be knowledgeable about the subject but have no close connection with any of the authors. In addition, referees should be from institutions other than (and preferably countries other than) those of any of the authors.
How to Submit
Users registered in the role of author can start submission by choosing USER HOME link on the top of the page, then choosing the role of the Author and follow the relevant link for starting the submission process. Prior to submission we strongly recommend that you familiarize yourself with the ACSi style by browsing the journal, particularly if you have not submitted to the ACSi before or recently.
Correspondence
All correspondence with the ACSi editor regarding the paper goes through this web site and emails. Emails are sent and recorded in the web site database. In the correspondence with the editorial office please provide ID number of your manuscript. All emails you receive from the system contain relevant links. Please do not answer the emails directly but use the embedded links in the emails for carrying out relevant actions. Alternatively, you can carry out all the actions and correspondence through the online system by logging in and selecting relevant options.
Proofs
Proofs will be dispatched via e-mail and corrections should be returned to the editor by e-mail as quickly as possible, normally within 48 hours of receipt. Typing errors should be corrected; other changes of contents will be treated as new submissions.
Submission Preparation Checklist
As part of the submission process, authors are required to check off their submission's compliance with all of the following items, and submissions may be returned to authors that do not adhere to these guidelines.
1.	The submission has not been previously published, nor is it under consideration for publication in any other journal (or an explanation has been provided in Comments to the Editor).
2.	All the listed authors have agreed on the content and the corresponding (submitting) author is responsible for having ensured that this agreement has been reached.
3.	The submission files are in the correct format: manuscript is created in MS Word but will be submitted in PDF (for reviewers) as well as in original MS Word format (as a supplementary file for technical editing); diagrams and graphs are created in Excel and saved in one of the file formats: TIFF, EPS or JPG; illustrations are also saved in one of these formats. The preferred position of graphic files in a document is to embed them close to the place where they are mentioned in the text (See Author guidelines for details).
4.	The manuscript has been examined for spelling and grammar (spell checked).
5.	The title (maximum 150 characters) briefly explains the contents of the manuscript.
6.	Full names (first and last) of all authors together with the affiliation address are provided. Name of author(s) denoted as the corresponding author(s), together with their e-mail address, full postal address and telephone/fax numbers are given.
7.	The abstract states the objective and conc I usions of the research concisely in no mo re than 150 words.
8.	Keywords (minimum three, maximum six) are provided.
9.	Statement of novelty (maximum 100 words) clearly explaining new findings reported in the manuscript should be prepared as a separate Word file.
10.	The text adheres to the stylistic and bibliographic requirements outlined in the Author guidelines.
11.	Text in normal style is set to single column, 1.5 line spacing, and 12 pt. Times New Roman font is
recommended. All tables, figures and illustrations have appropriate captions and are placed within the text at the appropriate points.
12.	Mathematical and chemical equations are provided in separate lines and numbered (Arabic numbers) consecutively in parenthesis at the end of the line. All equation numbers are (if necessary) appropriately included in the text. Corresponding numbers are checked.
13.	Tables, Figures, illustrations, are prepared in correct format and resolution (see Author guidelines).
14.	The lettering used in the figures and graphs do not vary greatly in size. The recommended lettering size is 8 point Arial.
15.	Separate files for each figure and illustration are prepared. The names (numbers) of the separate files are the same as they appear in the text. All the figure files are packed for uploading in a single ZIP file.
16.	Authors have read special notes and have accordingly prepared their manuscript (if necessary).
17.	References in the text and in the References are correctly cited. (see Author guidelines). All references mentioned in the Reference list are cited in the text, and vice versa.
18.	Permission has been obtained for use of copyrighted material from other sources (including the Web).
19.	The names, full affiliation (department, institution, city and country), e-mail addresses and references of three potential referees from institutions other than (and preferably countries other than) those of any of the authors are prepared in the word file. At least two relevant references (important papers with high impact factor, head positions of departments, labs, research groups, etc.) for each suggested reviewer must be provided.
20.	Full-colour illustration or graph from the manuscript is proposed for graphical abstract.
21.	Appendices (if appropriate) as supplementary material are prepared and will be submitted at the same time as the manuscript.
Privacy Statement
The names and email addresses entered in this journal
site will be used exclusively for the stated purposes of
this journal and will not be made availab I e for any other purpose or to any other party.
ISSN: 1580-3155
Koristni naslovi
Slovensko kemijsko druStva
stovwifan chwnicaf society Slovensko kemijsko društvo
www.chem-soc.si e-mail: chem.soc@ki.si
Wessex Institute of Technology
www.wessex
.ac.uk
SETAC
www.setac.org
European Water Association
http://www.ewa-online.eu/
European Science Foundation
www. esf .org
o
EFCE European Federation of Chemical Engineering
https://efce.info/
International Union of Pure and Applied Chemistry
https://iupac.org/
„h *
Novice europske zveze kemijskih društev (EuCheMS) naj'dete na:
EuCheMS: Brussels News Updates
http://www.euchems.eu/newsletters/
Planetarni centrifugalni mikser ARM-310CE
[Tj (M Brezkontaktno mešanje in disperzija Tudi za zelo viskozne materiale
v
Širok spekter uporabe Atraktivna cena
Donau Lab d.o.o., Ljubljana Tbilisijska 85 SI-1000 Ljubljana www.donaulab.si office-si@donaulab.com

* .sr.ü,
SLOVENSKI KEMIJSKI DNEVI
2018
PLENARNI PREDAVATELJI
19. - 21. SEPTEMBER KONGRESNI CENTER GRAND HOTEL BERNARDIN PORTORO Ž
o
Slovensko kemijsko društvo SJovenion Chem/coi Society
prof. dr. Markus Antonietti
Max-Planck inštitut, Potsdam, Nemčija
U
prof. dr. Zdravko Kravanja
Fakulteta za kemijo in kemijsko tehnologijo, Univerza v Mariboru
prof. dr. Paolo Fornasiero
Univerza v Trstu, Italija
prof. dr. Janez Plavec
Kemijski inštitut, Ljubljana
REG I ST RAC IJ E: http://www.chem-soc.si/slovenski-kemijski-dnevi-2018
BODITE NEUSTAVLJIVI
MAGNEZIJ Krka 300
I Mg+B?
Granulat za pripravo napitka vsebuje magnezijev citrat in vitamin B2
t
Magnezij in vitamin B2 prispevata k zmanjševanju utrujenosti in izčrpanosti ter normalnemu delovanju živčnega sistema.
Magnezij prispeva tudi k delovanju mišic.
MAGNEZIJ Krka
300
granulat za napitek
"«NEajbvciTiUTMrr,^,^
«mit lil ju
Mg


www.magnezijkrka.si
'^krkk^P

@ Okus po pomaranči in limeti. @ Brez konzervansov. ® Brez umetnih barvil, arom in sladil. ® Ena vrečka na dan.
Prehransko dopolnilo ni nadomestilo za uravnoteženo in raznovrstno -	prehrano. Skrbite tudi za zdrav življenjski slog.
\
I ^ KRKK
Acta Chim/ca Slovenica Acta ChimicaSlovenica
LiverSex presents the; first multi-tissue and multi-level computational metabolic model, which is eSle to deseribe the sexual aspects in heprtic metabolism. LiverSex is able to provide detailed insighta into gender de-peddent complex liver pathologies in liver-related disease development and progression. (see page 253)
ActaChimicaSh ylcta Chimica Slovenica
Year 2018, Vol. 65, No. 2
Acta ChimicaSlc Acu Chimica Slovenica
IW.I T«--	ml T ij/t»uy	tw-
ol.* ' rn in	aft™«i	b PnmBlFatt*
I '.-iuiriai K'v., V:' '.'.» n ú jui)fcsK <:L;V-J .1.i ,w .1 Quito ■ Ts tfiil fV- i R.1ÚI1 it a«HksFhtai iV.lv,. PtiinObraüifca
¡A I : j itaqp fr-^t'..-. JM'+Wii-H ültijrmk^ Quia rfC--)^n(d¡( m
¡w ■ hUu	IfalKtr nfcZrifcA hr.1 fcp« a
Acta ChimicaSlc Actt Chimica Sic Slovenica
i
+ a«V * 1	6M015
frf	id Oúlujfa* IV i . rtk M&nultad IvVrUnlBKka
UannllllUtiCMfcn
¡fen-U Wkknd tunCttfa*•«!»»- Mra*
Hal*
Act&ChimicaSlc Actí Chimica Slovenica
3
»2015
I«.*. ■ I	Vm.'rlTT^*	nnfi
YKUH il 'h i >U'
Act&ChimicaSlc AclaChhmc&Sk Slovenica
Acta ChimicaSlc A ctci Ch im ica .S ic Slovenica
fchwilbt r~- MttfliM fWmietLiHlfitjMMftn u¿M im blonxMrf baí fiTTi rt Nruwfaei Onto iwwtatttnl
ActaChimica Slc Actí Chimica Slovenica
4 cta( 2
KWllí
'i s. .¡ í' tl lliv»ra!¡ti.n.^' mfti\,u.~TVCitt Quk taiwtaK d SLVAJI JimTllnutniM locravlal
Acta ChimicaSlc ActaChwúcaSlc Slovenica
3
ame
III o	
Acta Chirr y4ctoChin Slovenica	licaSlc • nca Acta 4
1	ame
	
fMK n¡VJnJTO.WKSBmttxAIA1ÍUAH tora.Mkiunn.tepo Ih^A^I^U^.yi^JmakinVn'^^'CmtewlIba fJftafcn Kit AttWiMt Üar.Kíti fcffdÉWm* firji •u.'b« MU»	
ActaC/z imica Slc ActaC himica Slovenica
1
Sfirt	fnp Ej(W P(t=«*-» * i [utd Sotrf ti hKaJUbcrX
UdÁtk fcCr[J«fcíM,ÍN.*d[Siíi
Sáiif k fqtn Fvmd .uin a Ww»i¿ hjH fatua. LeWoí \t ftraJ rnl i fetinBetf ji" ^|[»u¡PX M fVMN i Hgutf' jh¡ IVtíi^iIí; '! .nWi»	'toiWtó
tap' ri u.itaw 'kKji
Acta CñimicaSlc ActaChimicaSlc Slovenica
Acta ChimicaSlc ActaQtimiea.Sk Slovenica
~	B4fflti:
• rV
J ' s ' s
•. , i
Übkvdiü iv i CBh i!! LVtkson ri H y* i- . mad hwv ímc* t*m rtrr™ rf ifn »ww —^ bíre^ vi^L'rn vi a**t 'mai Cch rkooMk rh.inw é it.c—. kd vkW 'vl .üí- -:t fnrrirá hOfís VUnb EfamMrk Mraal al f+j re ícfc é
Acta ChimicaSlc ActciChimk&Sk Slovenica
4
«ar*.-ib-WWrin MlíjJ lib >ij<* ri Ka! <D tick .Ui-ürwi1 Ph.-. Umi IM» al i™ «mol ^ufcti TtT tiL'm.n ¡i Ln*toN*»'tiCM»Ki ftDxt ¡ Gttuni ti Uui S^iÜJSi I iKiew luna W.*jí» 'V ÍC^KtKd>-hi¿ian*nv»» iflká Bi>W»J»Bfc|b»Ífi imUlli i|h
I bujtüir li Stf. I í m I. «4» Sr* lif 'j Mk:! «E üd '.'«^Mao1 kttqci
Mi- ¡MMíhi.-'-tCHU