Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Original article 235 ABSTRACT Paraoxonase (PON) enzyme family (paraoxonase 1, 2 and 3) has antiatherosclerotic properties. The decreased PON1 enzyme activity (EA), PON1 level and PON1-L55M polymorphism (PON1P) are risk factors for atherosclerosis. Effects of anaerobic training on PON1 levels and the role of PON1P are unclear. In present study, the effects of anaerobic training on serum PON1 level, PON1EA, high density lipoprotein (HDL) and its subgroups’ paraoxonase activities (HDLPON1EA, HDL2PON1EA, HDL3PON1EA) as well as the role of PON1P were investigated. The trained male athletes group (handball, basketball, volleyball) (AG: n=36, age=20.56±2.42 years) and the control group (CG: n=39, age=22.26±3.44 years) participated in this study. The PON1 and HDL’s PON1 enzyme activities, the protein levels of PON1 enzyme, oxidized low-density lipoprotein (oxLDL) levels and the PON1P (from genomic DNA samples) were determined. Serum PON1EA, HDLPON1EA, HDL2PON1EA and HDL3PON1EA enzyme activities of the athletic homozygous LL and M carrier (Mc) groups were not significantly different from sedentary, however the indicated enzyme activities of the athletic LL homozygous group were significantly higher than athletic Mc group (p<0.05). While the control genotype groups were compared, the control LL (CLL) genotype group had higher serum PON1EA (38.7%), HDLPON1EA (37.2%), HDL2PON1EA (41.9%) and HDL3PON1EA (33.1%) values than control Mc (CMc) genotype. These findings indicate that the genetically higher PON1EA and HDL and its subgroups’ PON1EA in LL genotype group may have an important role in the beneficial effects of anaerobic training. However, the Mc genotype group was genetically negatively affected from anaerobic training. Therefore, it was concluded that high intensity training may be a risk factor for atherosclerosis in athletes with Mc genotype. Keywords: Paraoxonase 1, Paraoxonase 1-L55M polymorphism, Anaerobic training, Atherosclerosis. 1Girne American University, Faculty of Sport Science, Department of Coaching Education, Kyrenia/Cyprus. 2Ege University, Faculty of Sport Science, Department of Coaching Education, İzmir/Turkey. 3Hatay Mustafa Kemal University, Faculty of Medicine, Department of Medical Genetics, Hatay/Turkey 4Ege University, Faculty of Medicine, Department of Medical Genetics, İzmir/Turkey 5Department of Coaching Education, School of Physical Education and Sports, Cyprus Health and Social Science University, Guzelyurt/Cyprus IZVLEČEK Encimska družina paraoksonaz (PON) – paraoksonaza 1, 2 in 3 – ima antiaterosklerotične lastnosti. Znižana encimska aktivnost PON1 (EA), raven PON1 in polimorfizem PON1-L55M (PON1P) predstavljajo dejavnike tveganja za aterosklerozo. Vplivi anaerobnega treninga na raven PON1 in vloga PON1P še niso povsem pojasnjeni. V tej študiji so raziskovali vplive anaerobnega treninga na serumsko raven PON1, encimsko aktivnost PON1 (PON1EA), lipoprotein visoke gostote (HDL) in paraoksonazno aktivnost njegovih podskupin (HDLPON1EA, HDL2PON1EA, HDL3PON1EA), kot tudi vlogo PON1P. V raziskavi so sodelovali moški športniki (rokomet, košarka, odbojka) – športna skupina (AG: n = 36, starost = 20,56 ± 2,42 let) in kontrolna skupina (CG: n = 39, starost = 22,26 ± 3,44 let). Določili so PON1 in HDL-odvisno encimsko aktivnost PON1, ravni beljakovin encima PON1, ravni oksidiranega lipoproteina nizke gostote (oxLDL) ter polimorfizem PON1P (iz genomskih DNA vzorcev). Serumske vrednosti PON1EA, HDLPON1EA, HDL2PON1EA in HDL3PON1EA pri športnikih z homozigotnim LL genotipom in nosilcih M alela (Mc skupina) niso bile statistično značilno različne od neaktivnih posameznikov. Vendar pa so bile omenjene encimske aktivnosti v športni skupini z LL genotipom statistično značilno višje kot pri športnikih Mc skupine (p < 0,05). Pri primerjavi genotipskih skupin v kontrolni skupini je imel LL genotip (CLL) višje vrednosti serumske PON1EA (za 38,7 %), HDLPON1EA (za 37,2 %), HDL2PON1EA (za 41,9 %) in HDL3PON1EA (za 33,1 %) v primerjavi z Mc genotipom (CMc). Ti izsledki kažejo, da ima genetsko višja PON1EA ter višja PON1 aktivnost HDL in njegovih podskupin pri osebah z LL genotipom lahko pomembno vlogo pri koristnih učinkih anaerobnega treninga. Nasprotno pa je bil Mc genotip genetsko neugodno prizadet zaradi anaerobnega treninga. Zato so raziskovalci zaključili, da je lahko visoko intenziven trening dejavnik tveganja za aterosklerozo pri športnikih z Mc genotipom. Ključne besede: Paroksonaza 1, Paroksonaza 1-L55M polimorfizem, anaerobni trening, ateroskleroza Corresponding author*: Ezgi Sevilmis Girne American University, Faculty of Sport Science, Department of Coaching Education, 99300, Kyrenia/Cyprus E-mail: ezgi.sewilmis@gmail.com https://doi.org/10.52165/kinsi.31.2.235-251 Ezgi Sevilmis1*, Bahtiyar Ozcaldiran2 Oya Yigitturk2 Faik Vural2 Semih Asikovali3 Burak Durmaz4 Cagan Kilic5 EFFECT OF ANAEROBIC TRAINING ON SERUM PARAOXONASE 1 (PON1) ACTIVITY AND ROLE OF PON1-L55M POLYMORPHISM UČINEK ANAEROBNEGA TRENINGA NA AKTIVNOST SERUMSKE PARAOKSONAZE 1 (PON1) IN VLOGA POLIMORFIZMA PON1-L55M Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 236 INTRODUCTION Coronary heart diseases (CHD) are among the leading main causes of death in the world. Low protein levels and activities of the paraoxonase enzyme family members (PON1, PON2 and PON3) are considered as a risk factor for CHD (Mackness et al., 1998). This multigene family is localized between q21.3 and q22.1 on the long arm of chromosome 7 in humans (Hegele, 1999). PON1 is the first identified and most studied member of this enzyme family (Deakin & James, 2004) and it has much more clarity compared to PON2 and PON3 (Li et al., 2003). It is known that PON1 has antioxidant, anti-inflammatory and antiatherosclerotic properties by protecting high-density lipoproteins (HDL) and low-density lipoproteins (LDL) from oxidation (Rajkovic et al., 2011; Priyanka et al., 2019). Oxidized low-density lipoproteins (oxLDL) causes endothelial dysfunction and poses a risk for coronary artery diseases (Levitan et al., 2010). Therefore, knowing PON1 and oxLDL levels is extremely important in predicting coronary artery disease. PON1 has the ability to hydrolyze paraoxon (PON1 enzyme activity, PON1EA, PON1 activity) and phenylacetate (arylesterase activity, ARE) in addition to being able to hydrolyze the oxidized lipids of HDL and LDL (Gan et al., 1991). This enzyme mainly synthesised from the liver is located on HDL and its subgroups (HDLs: HDL2 and HDL3) found in the blood (Aviram et al., 1998; Deakin et al., 2002). Additionally, PON1 can dissociate from the HDL in physiological conditions and increased free PON1 is associated with diseases with high oxidative stress (OS) (Kontush et al., 2010). Studies showed that PON1 activity, HDL2 and HDL3 levels were associated with CHD (Mackness et al., 2003; Deakin & James, 2004). Therefore, knowing the PON1 activities of HDL and its subgroups may be important role to understand risk factors for CHD. Factors such as age, diet, smoking, environmental conditions, disease status affect PON1 activity (James et al., 2000; Senti et al., 2001) however, its activity is mainly determined by polymorphisms. It has been shown that there are more than 160 polymorphisms in the coding region of the PON1 enzyme, introns that do not participate in protein coding and in the promoter region (Costa el al., 2005). Studies indicate that polymorphisms in the promoter region of PON1 T(-107)C, G(-824)A, G(-907)C have a strong effect on gene expression and enzyme levels in serum (Li et al., 2003). However, the most common polymorphisms due to amino acid changes in the coding region of PON1 occur in the 55th and 192nd codons. While the polymorphism in the 55th codon arises from the Leucine/Methionine (L/M) change, the polymorphism in the Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 237 192nd codon arises from the Glutamine/Arginine (Glu/Arg) change. A study on PON1-Q192R polymorphism revealed differences in PON1 activity according to Q and R alleles (Superko et al., 2012). Another study on the PON1-L55M polymorphism (PON1P) reported differences in PON1 activity and concentration according to the L and M alleles. Garin et al. (1997) showed that the amino acids sequence in leucine/methionine polymorphism at position 55 (L55M) has been associated with changes in PON1 serum concentrations and has also been reported to have an association with cardiovascular disease. In addition, it is known that PON1 polymorphisms are associated with CHD (Zhang et al., 2021). Another important factor affecting PON1 activity is exercise. In studies investigating the relationship between exercise and PON, aerobic exercises (acute/chronic) were mostly examined. Most of these studies showed that aerobic training increased PON1 activities and protein levels (Mahdirejei et al., 2015; Taylor et al., 2015; Benedetti et al., 2018; Russo et al., 2018). In the study by Nalcakan et al. (2016) it was reported that aerobic exercises increased PON1 activity and especially in the QQ phenotype, PON1 activity was significantly higher than control group. There are also studies showed that regular aerobic training had not significantly effect on PON1 activities and protein levels (Silva et al., 2011; Kotani et al., 2012). In the literature review, it is seen that the number of studies examining the relationship between anaerobic training and PON levels is quite limited. It is not clear to what extent PON enzymes are affected depending on the amount of OS created by high-intensity anaerobic training. In present study, the effects of anaerobic training on serum PON1 levels, PON1EA, HDL and its subgroups’ paraoxonase activities (HDLPON1EA, HDL2PON1EA, HDL3PON1EA) as well as the role of PON1P were investigated. METHODS Participants An athlete group (AG: n=36, age=20.56±2.42 years) consisting of healthy male aged between 18-35 years who regularly engage in anaerobic training (basketball, volleyball, handball), not being a smoker, alcohol, drugs or antioxidants users and a control group (CG: n=39, age=22.26±3.44 years) who have not exercised for at least 3-4 months, non-obese (Body mass index, BMI <30) joined in this study. The experimental procedures including possible risks were verbally explained to the participants after which they signed informed consent. The Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 238 present study was approved by the local university Ethics Committee and all data was collected in accordance with the Declaration of Helsinki. Training details AG trained for a total of 13 h, 5 days a week, 2,5 h/day. The training sessions included high- intensity running, technical-tactical exercises, vertical-horizontal jumpings, plyometrics, strength and power exercises (2 days/week) with high intensity loading. Additionally, aerobic and anaerobic endurance and speed training were executed. Physical measurements An electronic medical scale (Seca 769, Germany) was used for measuring the height and body weight of the participants and all measurements were done with shorts and without socks. BMI was calculated based on height and body weight by using BMI = m (kg) / h2 (m2) formula (McArdle et al., 2000). Blood Sampling and Analysis Following the physical measurements venous blood samples were obtained in 9-mL serum vacuum tubes, one with EDTA and heparinized blood at rest 3-4 hours after lunch. Serum blood with EDTA samples and heparinized blood tubes were kept at room temperature for 20 minutes. Serum blood tubes for 10 minutes centrifuged at 2000g and serum samples were separated. The serum samples were stored in the freezer (-82°C) for the measurements of the following parameters. DNA samples required for polymorphisms were isolated from blood with EDTA. All biochemical variables were determined within 1 month after obtaining the serum samples. Analysis of PON1 and oxLDL protein concentrations Concentrations of PON1 and oxLDL were determined using enzyme-linked immunosorbent assays by measuring absorbance at 450 nm on a microplate reader (Diareader ELX800G; Dialab GmbH, Vienna, Austria). ½ dilution was applied to serum samples for the analysis of PON3 and oxLDL levels. The commercial kits (Elabscience Biotechnology, Wuhan, China) were used for analysing oxLDL levels. Serum concentrations of PON1 and oxLDL were determined by means of standard curves constructed with purified PON and oxLDL proteins in a single batch. The coefficients of variation of PON1 and oxLDL were less than 10%. Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 239 Analysis methods of PON1 activity Spectrophotometer device (Shimadzu UV 1700, Japan) was used to measure serum PON1 activity. Measurements of serum PON1 activity were conducted manually based on the method used by Eckerson et al. (1983). According to this method, serum PON1 activity was determined using paraoxon (diethyl p-nitrophenylphosphate, Sigma Chemical Co, St. Louis, MO, USA) as the substrate with an autoanalyzer (Modular DP, Japan). Paraoxon hydrolysis rates were determined by recording the absorbance at 412 nm and 37°C, which provided a measurement of p-nitrophenol release. PON1 activities were measured in 800-mL assay mixtures containing 1 mmol/L paraoxon, 1 mmol/L CaCl2, and 5 mL of serum in 50 mmol/L TriseHCl buffer (pH 7.4), as described. One unit of paraoxonase activity was defined as 1 mmol p-nitrophenol formed per min under the above assay conditions. Analysis HDL and it’s subgroups’ PON1 activity HDL-containing (HDL and HDL3) supernatants were isolated from serum according to method of Kostner et al. (1985) depending on a differential precipitation process. The method is based on the selective precipitation of lipoproteins by varying the pH and the polyethylene glycol (PEG 20000) polymer (Ma: 20.000, Merck, Darmstadt, Germany) concentrations of the reagent. In this method, the cholesterol and PON1 activity levels of HDL2 were estimated by calculating the difference between HDL and HDL3. Analysis of lipids and lipoprotein levels Serum total cholesterol (TC) and serum tri-glycerides (TG) levels were measured according to standardized enzymatic methods by using commercial kits (Dialab Gmbh Wien, Austria) and autoanalyzer (Modular DP, Roche Diagnostics, Tokyo, Japan). Low-density lipoprotein cholesterol (LDL-C) was determined as described by Friedewald et al. (1972). Determination of total antioxidant status (TAS) and total oxidant status (TOS) Total antioxidant status (TAS) and total oxidant status (TOS) were measured from serum samples by using a microplate reader (Biotek Epoch2, USA) and commercial kits (Rel Assay Diagnostics, Turkey). In this method, by adding the dark blue-green ABTS radical to the sample, the substance combined with the antioxidants in the sample creates a new color. The change in absorbance seen at 660 nm is associated with the participant's total antioxidant level. The oxidants present in the sample oxidize the ferrous ion-chelate complex to ferric ion. Ferric ion forms a colored complex with chromogen in acidic medium. The color intensity which can Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 240 be measured spectrophotometrically, is related to the total amount of oxidant molecules present in the sample. It was given as mmol Trolox Eq/L for TAS and mmol H2O2 Eq/L for TOS. The ratio of serum TOS to TAS was accepted as oxidative stress index (OSI). Distribution of PON1-L55M phenotypes DNA isolation was carried out from blood samples with EDTA using a commercial kit (DNeasy Blood Tissue Kit, QIAGEN®-Hilden, Germany) and following the procedure specified in the kit. Genotyping: In order to investigate the SNP regions, the relevant region of the gene was amplified by PCR (SimpliAmp, Thermal Cycler, Singapore) and DNA sequence analysis was performed (MiSeq System, Illumina) and genotypes were determined. PON1-Revers Primer: 5’- ACACTCACAGAGCTAATGAAAGCC -3’ PON1-Forward Primer: 5’- GAAGAGTGATGTATAGCCCCAG -3’ PON1 activity ratios were used to classify the phenotypes of each participant as LL, LM, MM. Due to the small number of MM and LM homozygote genotype groups, the M carrier (Mc = MM + LM) were combined to form carrier group in order to make the statistical analysis safer. YOYO IR-1 test Participants performed the YOYO IR-1 test which is an incremental increasing interval shuttle run test at track & field (Figure 1). Figure 1. Image of participants during YOYO IR-1 test In this test, shuttle runs of 2x20 m were run and active rest was carried out at a distance of 10 m (2x5m) for 10 seconds between each shuttle run (after the completed distance of 40m). Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 241 Individuals in the test were asked to adjust their speed according to the auditory signals. The test was terminated when the 40m distance was not completed even though the signal was received and the next 40m was not completed either (Bangsbo et al., 2008). This test was completed in 10-20 minutes depending on the condition level of the participants. Statistical analyses SPSS Windows version 24.0 package program was used in the statistical analysis. The Shapiro Wilk test was used to examine whether the obtained data showed a normal distribution. The Student t test was used to compare the normal data features in two independent groups and the Mann Whitney U test was used to compare the non-normal data features in two independent groups. Relationships between numerical variables were analysed with the Spearman correlation coefficient. In the comparison of numerical data in more than two independent groups, Kruskal Wallis test and Dunn multiple comparison test were used for non-normal data. As descriptive statistics, mean±standard deviation, median (min-max) were given for numerical variables, and number and % values were given for categorical variables. In addition, the effect of exercise and polymorphism interaction on all parameters were examined by two-way analysis of variance (ANOVA). The significance level was accepted as p<0.05 in all statistical analyses. RESULTS VO2max and YOYO values of athletic group (AG) were found higher than control group (CG) (p<0.05). The oxLDL values of AG were higher compared to CG (p<0.05). While no significant difference was found between AG and CG groups in TOS values (p>0.05), TAS values of AG were lower than CG (p<0.05). Moreover, OSI values of AG were higher than CG (p<0.05). However, no difference was found between AG and CG in terms of PON1 protein levels and activities (p>0.05) (Table 1). Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 242 Table 1. Physical, physiological and biochemical parameters of athletic and control groups (means±standard deviation). AG (N=36) CG (N=39) T P AGE (years) 20.56 ± 2.42 22.26 ± 3.44 2.45 0.016 HEIGHT (cm) 190.01 ± 7.61 178.81 ± 7.44 -6.44 0.001 WEIGHT (kg) 87.08 ± 14.25 77.2 ± 11.85 -3.27 0.002 BMI (kg/m2) 24.03 ± 3.05 24.08 ± 2.77 0.06 0.949 YOYO (m) 1127.78 ± 504.5 857.95 ± 272.02 -2.91 0.005 VO2max (ml) 45.87 ± 4.24 43.61 ± 2.29 -2.90 0.005 HDL2PON1EA (U/L) 40.59 ± 32.66 43.9 ± 44.27 0.36 0.716 HDL3PON1EA (U/L) 54.83 ± 38.72 50.8 ± 33.26 -0.48 0.629 HDLPON1EA (U/L) 95.42 ± 70.27 94.7 ± 72.77 -0.04 0.965 SERUMPON1EA (U/L) 107.09 ± 80.08 104.06 ± 81.98 -0.16 0.872 PON1 (ng/mL) 292.73 ± 315.12 355.75 ± 31.68 0.87 0.387 oxLDL (pg/mL) 279.94 ± 54.72 255.48 ± 39.42 -2.23 0.029 TAS (mmol/L) 0.87 ± 0.3 1.02 ± 0.25 2.35 0.021 TOS (µmol/L) 18.39 ± 3.7 17.59 ± 7.39 -0.58 0.560 OSI (TOS/TAS) 26.12 ± 19.9 18.29 ± 10.38 -2.16 0.034 TC (mg/dL) 156.36 ± 44.94 157.03 ± 26.32 0.08 0.937 LDL-C (mg/dL) 78.75 ± 25.06 85.38 ± 25.97 1.13 0.263 TG (mg/dL) 101.83 ± 52.18 118.79 ± 58.97 1.32 0.193 HDL-C (MG/DL) 50.83 ± 12.27 47.79 ± 8.81 -1.24 0.219 Notes: p<0.05, p<0.01; AG = Athletic group; CG = Control group; BMI = Body mass index; HDL2PON1EA = HDL2’s paraoxonase 1 activity; HDL3PON1EA = HDL3’s paraoxonase 1 activity; HDLPON1EA = HDL’s paraoxonase 1 activity; SERUMPON1EA = Serum paraoxonase 1 activity; PON1 = Paraoxonase 1; oxLDL = Oxidized low-density lipoprotein; TOS = Total oxidant status; TAS = Total antioxidant status; OSI = Oxidative stress index (TOS/TAS ratio); TC = Total cholesterol; LDL-C = Low-density lipoprotein cholesterol; TG = Total tri-glycerides; HDL-C = High-density lipoprotein cholesterol. Paraoxonase findings of genotype groups VO2max and YOYO values of LL phenotype in athletes (ALL) were found higher compared to the control group (CLL) (p<0.01). No significant difference was found between the athletic and control groups in terms of PON1 protein levels and activities in the LL phenotype and M carrier group (p>0.05). Moreover, there was no significant difference between the athletic and control groups in terms of biochemical parameters in the LL phenotype and Mc carrier group (p>0.05) (Table 2). Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 243 Table 2. Comparison of biochemical parameters of ALL/CLL groups and AMc/CMc groups in PON1-L55M genotype (means±standard deviation). ALL (n=16) CLL (n=16) AMc (n=20) CMc (n=23) P P AGE (years) 20.41±3.03 21.15±2.01 0.273 20.64±2.64 23.65±4.14 0.037 HEIGHT (cm) 191.5±5.8 177.8±6.1 0.001 188.8±8.7 179.5±8.3 0.001 WEIGHT (kg) 86.43±8.95 75.89±9.22 0.003 87.6±17.61 78.11±13.51 0.053 BMI (kg/m2) 23.58±2.51 24.02±2.67 0.634 24.4±3.44 24.12±2.9 0.774 YOYO (m) 1245±518.43 837.5±222.7 0.009 1034±485.63 872.17±305.75 0.192 VO2max (ml) 46.86±4.36 43.43±1.87 0.007 45.09±4.08 43.73±2.57 0.208 HDL2PON1EA (U/L) 55.49±38.4 58.3±56.85 0.871 28.68±21.56 33.88±30.42 0.527 HDL3PON1EA (U/L) 69.65±41.45 63.16±30.29 0.617 42.98±32.76 42.2±33.11 0.938 HDLPON1EA (U/L) 125.13±79 121.46±78.83 0.896 71.66±53.2 76.08±63.45 0.807 SERUMPON1EA (U/L) 142.29±91.8 134.82±94.88 0.823 78.93±57.3 82.66±65.59 0.845 PON1 (ng/mL) 341.65±432.27 298.91±225.85 0.728 253.59±17.26 395.28±359.22 0.117 oxLDL (pg/mL) 270.8±56.28 248.69±38.18 0.203 287.25±53.75 260.21±40.42 0.067 TAS (mmol/L) 0.82±0.3 1.08±0.26 0.015 0.92±0.3 0.99±0.24 0.406 TOS (µmol/L) 17.82±3.48 18.39±7.3 0.781 18.85±3.89 17.04±7.57 0.341 OSI (TOS/TAS) 29.5±27.49 17.82±7.07 0.110 23.42±10.77 18.62±12.31 0.184 TC (mg/dL) 162.13±60.44 153.63±23.69 0.604 151.75±28.03 159.39±28.27 0.380 LDL-C (mg/dL) 75.31±24.01 79.69±23.24 0.604 81.45±26.17 89.35±27.5 0.342 TG (mg/dL) 100.44±59.69 129.13±70.81 0.225 102.95±46.9 111.61±49.56 0.561 HDL-C (mg/dL) 52.19±9.1 48.06±9.56 0.221 49.75±14.47 47.61±8.47 0.551 Notes: p<0.05, p<0.01; ALL = LL-phenotype in athlete group; CLL = LL-phenotype in control group; AMc = M-carriers phenotype (LM + MM) in athlete group; CMc = M-carriers phenotype (LM + MM) in control group; BMI = Body mass index; HDL2PON1EA = HDL2’s paraoxonase 1 activity; HDL3PON1EA = HDL3’s paraoxonase 1 activity; HDLPON1EA = HDL’s paraoxonase 1 activity; SERUMPON1EA = Serum paraoxonase 1 activity; PON1 = Paraoxonase 1; oxLDL = Oxidized low-density lipoprotein; TOS = Total oxidant status; TAS = Total antioxidant status; OSI = Oxidative stress index (TOS/TAS ratio); TC = Total cholesterol; LDL-C = Low-density lipoprotein cholesterol; TG = Total tri-glycerides HDL-C = High-density lipoprotein cholesterol While LL phenotype and the M carrier group were compared in the athletic group, serum PON1 activity was lower in the M carrier group (p<0.05). Additionally, HDLPON1 activity of athletic group was found lower in the M carrier group than LL phenotype (p<0.05). Moreover, the PON1 activity of the HDL subgroups (HDL2PON1EA, HDL3PON1EA) of the M carrier group in the athletic group was lower than LL phenotype (p<0.05). While LL phenotype and the M carrier group were compared in the control group, no difference was found in terms of biochemical parameters (p>0.05) (Table 3). However, the control LL (CLL) genotype group had higher serum PON1EA (38.7%), HDLPON1EA (37.2%), HDL2PON1EA (41.9%) and HDL3PON1EA (33.1%) values than control Mc (CMc) genotype. Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 244 Table 3. Comparison of biochemical parameters of ALL/AMc groups and CLL/CMc groups in PON1-L55M genotype (means±standard deviation). ALL (n=16) AMc (n=20) CLL (n=16) CMc (n=23) P P AGE (years) 20.41±3.03 20.64±2.64 0.798 21.15±2.01 23.65±4.14 0.155 HEIGHT (cm) 191.5±5.8 188.8±8.7 0.282 177.8±6.1 179.5±8.3 0.472 WEIGHT (kg) 86.43±8.95 87.6±17.61 0.799 75.89±9.22 78.11±13.51 0.572 BMI (kg/m2) 23.58±2.51 24.4±3.44 0.432 24.02±2.67 24.12±2.9 0.916 YOYO (m) 1245±518.43 1034±485.63 0.217 837.5±222.7 872.17±305.75 0.701 VO2max (ml) 46.86±4.36 45.09±4.08 0.222 43.43±1.87 43.73±2.57 0.684 HDL2PON1EA (U/L) 55.49±38.4 28.68±21.56 0.012 58.3±56.85 33.88±30.42 0.090 HDL3PON1EA (U/L) 69.65±41.45 42.98±32.76 0.045 63.16±30.29 42.2±33.11 0.051 HDLPON1EA (U/L) 125.13±79 71.66±53.2 0.021 121.46±78.83 76.08±63.45 0.054 SERUMPON1EA (U/L) 142.29±91.8 78.93±57.3 0.016 134.82±94.88 82.66±65.59 0.068 PON1 (ng/mL) 341.65±432.27 253.59±178.26 0.446 298.91±225.85 395.28±359.22 0.667 oxLDL (pg/mL) 270.8±56.28 287.25±53.75 0.378 248.69±38.18 260.21±40.42 0.372 TAS (mmol/L) 0.82±0.3 0.92±0.3 0.327 1.08±0.26 0.99±0.24 0.285 TOS (µmol/L) 17.82±3.48 18.85±3,89 0.412 18.39±7.3 17.04±7.57 0.584 OSI (TOS/TAS) 29.5±27.49 23.42±10.77 0.370 17.82±7.07 18.62±12.31 0.815 TC (mg/dL) 162.13±60.44 151.75±28.03 0.499 153.63±23.69 159.39±28.27 0.508 LDL-C (mg/dL) 75.31±24.01 81.45±26.17 0.473 79.69±23.24 89.35±27.5 0.259 TG (mg/dL) 100.44±59.69 102.95±46.9 0.888 129.13±70.81 111.61±49.56 0.368 HDL-C (mg/dL) 52.19±9.1 49.75±14.47 0.561 48.06±9.56 47.61±8.47 0.877 Notes: p<0.05, p<0.01; ALL = LL-phenotype in athlete group; AMc = M-carriers phenotype (LM + MM) in athlete group; CLL = LL-phenotype in control group; CMc = M-carriers phenotype (LM + MM) in control group; BMI = Body mass index; HDL2PON1EA = HDL2’s paraoxonase 1 activity; HDL3PON1EA = HDL3’s paraoxonase 1 activity; HDLPON1EA = HDL’s paraoxonase 1 activity; SERUMPON1EA = Serum paraoxonase 1 activity; PON1 = Paraoxonase 1; oxLDL = Oxidized low-density lipoprotein; TOS = Total oxidant status; TAS = Total antioxidant status; OSI = Oxidative stress index (TOS/TAS ratio); TC = Total cholesterol; LDL-C = Low-density lipoprotein cholesterol; TG = Total tri-glycerides; HDL-C = High-density lipoprotein cholesterol. No statistically significant difference was found between the 2 genotype groups in terms of L55M genotype distribution or their alleles frequencies (Table 4). Table 4. Genotypes and alleles frequency of PON1-L55M polymorphism in athletic and control groups. Polymorphism Genotype /Allele Group AG (n = 36) CG (n = 39) Total (n = 75) χ2 /p PON1-L55M Genotype LL 16 (44.4) 16 (41.0) 32 (42.7) 0.311/0.856 LM 16 (44.4) 17 (43.6) 33 (44.0) MM 4 (11.1) 6 (15.4) 10 (13.3) Allele L 48 (66.7) 49 (62.8) 97 (64.7) 0.242/0.622 M 24 (33.3) 29 (37.2) 53 (35.3) Notes: p<0.05; Note: AG, CG, and Total are presented as number (%). Abbreviations: AG = athletic group; CG = control group; L = leucine; M= methionine; PON = paraoxonase. Important correlations In athletic group; A significant correlation was found between YOYO and oxLDL (r=-0.391; p<0.05). In the ALL group; a significant correlation was found between serum PON1EA and HDLPON1EA (r=0.991; p<0.001). Additionally, PON1 activities of HDL subgroups were also Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 245 correlated with each other. Significant correlations were found between HDLPON1EA and HDL2PON1EA (r=0.988; p<0.001) and HDL3PON1EA (r=0.990; p<0.001). Also, a significant correlation was found between HDL2PON1EA and HDL3PON1EA (r=0.958; p<0.001). In AMc group; a significant correlation was found between serum PON1EA and HDLPON1EA (r=0.995; p<0.001) and TBARS (r=-0.499; p<0.05). Significant correlations were found between HDLPON1EA and HDL2PON1EA (r=0.969; p<0.001) and HDL3PON1EA (r=0.987; p<0.001). Also, a significant correlation was found between HDL2PON1EA and HDL3PON1EA (r=0.915; p<0.001). In control group; No significant correlation was found between parameters in the control group. In the CLL group; a significant correlation was found between serum PON1EA and HDLPON1EA (r=0.991; p<0.001). Moreover, PON1 activities of HDL subgroups were also correlated with each other as athletic group. Significant correlations were found between HDLPON1EA and HDL2PON1EA (r=0.952; p<0.001) and HDL3PON1EA (r=0.817; p<0.001). A significant correlation was found between HDL2PON1EA and HDL3PON1EA (r=0.599; p<0.05). In CMc group; a significant correlation was found between serum PON1EA and HDLPON1EA (r=0.997; p<0.001). Significant correlation was detected between HDLPON1EA and HDL2PON1EA (r=0.999; p<0.001). Moreover, a significant correlation was found between HDLPON1EA and HDL3PON1EA (r=0.999; p<0.001). Also, a significant correlation was found between HDL2PON1EA and HDL3PON1EA (r=0.995; p<0.001). DISCUSSION The main finding of the present study was that no significant difference was found between AG and CG in terms of PON1 protein level and activity. However, serum PON1EA, HDL2PON1EA, HDL3PON1EA and HDLPON1EA values were found significantly higher in athletic LL phenotype (ALL) compared to the M carrier group (AMc) (p<0.05). No difference was found between the LL phenotype in the control group (CLL) and the M carrier groups (CMc). In addition, there were no significant differences between the AG and CG groups in terms of TG, TC, HDL-C and LDL-C levels (p>0.05) whether polymorphisms were taken into account or not. Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 246 The effects of anaerobic training on PON1 protein levels and activities While genotypes are not taken into consideration there were no significant differences in the PON1 protein levels and activities between athletes and control groups (p>0.05) although OSI (including oxLDL) levels were higher (p<0.05). These findings can be interpreted as anaerobic training have no effect on athletes' PON1 protein level and serum PON1 activity but increases OSI (including oxLDL). There are many studies in the literature stating that exercise increases PON1 protein levels and activities. However, those studies showed the effect of aerobic not anaerobic exercises/training on PON1. Sang et al. (2015) showed that walking and low- intensity running training performed 5 times a week for 10 weeks increased PON1 activity. Another study showed that PON1 protein level and activity increased significantly after a single session of aerobic exercise on the treadmill (Taylor et al., 2015). There is a study in the literature reporting that PON1 protein levels increased after ultramarathon running (Benedetti et al., 2018). Russo et al. (2018) stated that aerobic training for 3 months increased PON1 activity. There are other studies reporting that endurance training and walking exercises significantly increased PON1 protein levels and activity (Kotani et al., 2012; Mahdirejei et al., 2015). A study showed that PON1 concentration and activity increased after an endurance test performed on a treadmill (Otacka-Kmiecik et al., 2021). In addition, another study stated that repeated endurance tests (3 endurance tests) performed on the treadmill increased PON1 activity (Otacka-Kmiecik et al., 2023). However, in the studies mentioned above the effects of aerobic processes have been revealed and it has been shown that low-medium intensity exercises (acute/chronic) have a positive effect on PON1. In our study, the effect of long-term training (chronic anaerobic training) in handball, basketball and volleyball branches where anaerobic processes are at the forefront, on PON1 was investigated. There are also studies in the literature reporting the positive effect of high-intensity exercises on PON1. Zibad et al. (2015) reported that strength training performed with the intensity in 80% of 1 repetition maximum increased the activity of PON1. Turgay et al. (2015) showed that long-term anaerobic exercise trainings increase PON1 activity. However, TaheriChadorneshin et al. (2017) stated that the effect of maximum effort training on PON1 activity and lipid profile have not yet clear. In our study, we examined anaerobic training which includes significantly intense high-intensity exercises and found that these trainings had no effect on PON1 protein level and activity. The main reason for this may be that the OSI values of the athletic group were higher than the control group. The high OSI value may have suppressed the PON1 increase. Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 247 The genotype groups’ serum PON1 levels and activities profile (the role of PON1 polymorphism-PON1P) In this present study, serum PON1EA, HDL2PON1EA, HDL3PON1EA and HDLPON1EA values were significantly higher in athletic LL phenotype (ALL) than M carrier group (AMc) (p<0.05). However, in control group, there was no significant difference between the LL phenotype (CLL) and the M carrier groups (CMc) (p>0.05). These findings show that the M carrier group was affected negatively by anaerobic training for the specified parameters whereas the LL group affected positively in terms of both serum PON1EA and PON1 activities of HDL subgroups. In this respect, our study findings are similar to the study results of Yigittürk et al. (2020). In the study by Yigitturk et al. (2020) examining the effect of hypoxic training on PON1 and the role of PON1–Q192R and PON1–L55M polymorphisms, it was stated that training under hypoxic conditions the PON1 activity was increased, especially in the QQ and LL groups compared to carrier groups. However, unlike our study they examined the effect of training under hypoxic conditions. The mentioned differences between the genotype groups for serum PON1 protein levels and serum or HDL subgroups’ PON1 activities may mainly be due to the PON1P. It is well known that low PON1 protein levels and enzyme activity are related to the CHD. In the light of this information, it can be concluded that athletes in the LL genotype group may have an advantage in terms of prevention of CHD when they perform high intensity exercises such as jumping, interval running, strength, speed and plyometric training which are used in basketball, volleyball and handball. On the contrary it can be said that M carrier group is negatively affected by anaerobic training and thus has risk for CHD due to the decrease in PON1 protein level and activity with these training. Therefore, future studies are needed to investigate training protocols for the prevention of CHD in the M carrier group. CONCLUSION These findings indicate that LL genotype had higher serum PON1EA. LL genotype group also had higher HDL and its subgroups’ PON1EA. Therefore, it can be said that the LL genotype group performing anaerobic training is more advantageous in preventing CHD. However, the M carrier genotype group was genetically negatively affected from anaerobic training and this may be considered as a risk factor for CHD. It can be concluded that carry out studies on special training protocols to protect the M carrier genotype group which is negatively affected by Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 248 anaerobic training from CHD by reducing the potential risks related to OS. In addition, findings of present study show that anaerobic training has no significant effect on all lipids and lipoprotein levels. Moreover, this study indicates that the PON1P is not related to all lipid and lipoprotein concentrations. In this study, the sample group was limited to athletes in anaerobic sports branches such as basketball, volleyball and handball. It is recommended to conduct further studies with a large number of participants in different branches, with different gender, age, diet, environmental conditions. Acknowledgements We respectfully remember Faruk Turgay who made significant contributions to the design, analysis, writing and interpretation of the study and passed away after the completion of the study. In addition, we thank the students participating in the study. Conflicts of interest On behalf of all authors, the corresponding author states that there is no conflict of interest. Funding The study was supported by the Ege University Scientific Research Project Coordination Unit with TDK-2021-22773 reference number. Data availability statement The datasets generated for this study are available on request to the corresponding author. Ethics approval This project was approved by the Ege University Medical Research Ethics Committee, İzmir, Turkey with 20-10T/48 reference number. All data was collected in accordance with the Declaration of Helsinki. Participants were informed about the details of the study and all provided written informed consent. Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 249 REFERENCES Aviram, M., Rosenblat, M., Bisgaier, C. L., Newton, R. S., Primo-Parmo, S. L., La Du, B. N. (1998). Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions. A possible peroxidative role for paraoxonase. Journal of Clinical Investigation, 101(8), 1581-1590. http://dx.doi.org/10.1172/JCI1649 Bangsbo, J., Iaia, F. M., Krustrup, P. (2008). The Yo-Yo intermittent recovery test; A useful tool for evaluation of physical performance in ıntermittent sports. Sports Medicine, 38(1), 37-51. https://doi.org/10.2165/00007256- 200838010-00004 Benedetti, S., Catalani, S., Peda, F., Luchetti, F., Citarella, R., Battistelli, S. (2018). Impact of the 24-h ultramarathon race on homocysteine, oxidized low-density lipoprotein, and paraoxonase 1 levels in professional runners. PloS One, 13(2), 1-11. https://doi.org/10.1371/journal.pone.0192392 Costa, L. G., Vitalone, A., Cole, T. B., Furlong, C. E. (2005). Modulation of paraoxonase (PON1) activity. Biochemical Pharmacology, 69(4), 541-550. https://doi.org/10.1016/j.bcp.2004.08.027 Deakin, S., Leviev, I., Gomaraschi, M., Calabresi, L., Franceschini, G., James, R. W. (2002). Enzymatically active paraoxonase-1 is located at the external membrane of producing cells and released by a high affinity, saturable, desorption mechanism. Journal of Biogical Chemistry, 277(6), 4301-4308. https://doi.org/10.1074/jbc.M107440200 Deakin, S. P., James, R. W. (2004). Genetic and enviromental factors modulating serum consentrations and activities of the antioxidant enzyme paraoxonase-I. Clinical Science, 107(5), 435-447. https://doi.org/10.1042/CS20040187 Eckerson, H. W., Romson, J., Wyte, C., La Du, B. N. (1983). The human serum paraoxonase-1polymorphism: identification of phenotypes by their response to salts. The American Journal of Human Genetics, 35(2), 214-227. PMCID: PMC1685526. Friedewald, W. T., Levy, R. I., Fredrickson, D. S. (1972). Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the pre-parative ultracentrifuge. Clinical Chemistry, 18(6), 499- 502. https://doi.org/10.1093/clinchem/18.6.499 Gan, K. N., Smolen, A., Eckerson, H. W., La Du, B. N. (1991). Purification of human serum paraoxonase/arylesterase. Evidence for one esterase catalysing both activities. Drug Metabolism Disposition, 19(1), 100–106. PMID:1673382 Garin, M. C., James, R. W., Dussoix, P., Blanche, H., Passa, P., Froguel, P., Juan, R. (1997). Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme. A possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. Journal of Clinical Investigation, 99(1), 62-66. https://doi.org/10.1172/JCI119134 Hegele, R. A. (1999). Paraoxonase genes and disease. Annals of Medicine, 31(3), 217–224. https://doi.org/10.3109/07853899909115981 James, R. W., Leviev, I., Righetti, A. (2000). Smoking is associated with reduced serum paraoxonase activity and concentration in coronary artery disease patients. Circulation, 101(19), 2252-2257. https://doi.org/10.1161/01.CIR.101.19.2252 Kontush, A., Chapman, M. J. (2010). Antiatherogenic function of HDL particle subpopulations: focus on antioxidative activities. Current Opinion Lipidology, 21(4), 312-318. https://doi.org/10.1097/MOL.0b013e32833bcdc1 Kostner, G. M., Molinari, E., Pichler, P. (1985). Evaluation of a new HDL2/HDL3 quantitation method based on precipitation with polyethylene glycol. Clinica Chimica Acta, 148(2), 139-147. https://doi.org/10.1016/0009- 8981(85)90224-4 Kotani, K., Caccavello, R., Mutou, T., Yamada, T., Taniguchi, N., Gugliucci, A. (2012). Association between reactive oxygen metabolites and paraoxonase 1 activity during a physical activity increase intervention with older Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 250 Japanese people. Australasian Journal of Ageing, 31(4), 222-226. https://doi.org/10.1111/j.1741- 6612.2011.00569.x Levitan, I., Volkov, S., Subbaiah, P. V. (2010). Oxidized LDL: diversity, patterns of recognition, and pathophysiology. Antioxidants & Redox Signaling, 13(1), 39–75. doi: 10.1089/ars.2009.2733 Li, H. L., Liu, D. P., Liang, C. C. (2003). Paraoxonase gene polymorphisms, oxidative stress and diseases. Journal of Molecular Medicine, 81(12), 766-779. https://doi.org/10.1007/s00109-003-0481-4 Mackness, B., Durrington, P. N., Mackess, M. I. (1998). Human serum paraoxonase. Gen Pharmacology, 31(3), 329-336. https://doi.org/10.1016/S0306-3623(98)00028-7 Mackness, B., Durrington, P., McElduff, P., Yarnell, J., Azam, N., Watt, M., Mackness, M. (2003). Low paraoxonase activity predicts coronary events in the caerphilly prospective study. Circulation, 107(22), 2775-2779. https://doi.org/10.1161/01.CIR.0000070954.00271.13 Mahdirejei, T. A., Razi, M., Barari, A., Farzanegi, P., Mahdirejei, H. A., Shahrestani, Z., Ahmadi, M. (2015). A comparative study of the effects of endurance and resistance exercise training on PON1 and lipid profile levels in obese men. Sport Science for Health, 11(3), 263-270. https://doi.org10.1007/s11332-015-0232-2 McArdle, W. D., Katch, F. I., Katch, V. L. (2000). Body composition: components, assessment, and human variability. In: E. Johnson (Ed.). Essentials of Exercise Physiology, (500-527). Lippincott Williams and Wilkins, USA. Nalcakan, G. R., Varol, S. R., Turgay, F., Nalcakan, M., Ozkol, M. Z., Karamizrak, S. O. (2016). Effects of aerobic training on serum paraoxonase activity and its relationship with PON1-192 phenotypes in women. Journal of Sport and Health Science, 5(4), 462-468. https://doi.org/10.1016/j.jshs.2015.01.010 Otacka-Kmiecik, A., Orlowska-Majdak, M., Stawski, R., Szkudlarek, U., Kosielski, P., Padula, G., Galczynski, S., Nowak, D. (2023). Effect of Exercise Repetitions on Arylesterase Activity of PON1 in Plasma of Average- Trained Men-The Dissociation between Activity and Concentration. Antioxidants, 12(6), 1-16, https://doi.org/10.3390/antiox12061296 Otacka-Kmiecik, A., Orlowska-Majdak, M., Stawski, R., Szkudlarek, U., Kosielski, P., Padula, G., Galczynski, S., Nowak, D. (2021). Repetitions of Strenuous Exercise Consistently Increase Paraoxonase 1 Concentration and Activity in Plasma of Average-Trained Men. Oxidative Medicine and Cellular Longevity, 1-11, https://doi.org10.1155/2021/2775025 Priyanka, K., Singh, S., Gill, K. (2019). Paraoxonase 3: Structure and its role in pathophysiology of coronary artery disease. Biomolecules, 9(12), 1-17. https://doi.org/10.3390/biom9120817 Rajkovic, M. G., Rumora, L., Barisic, K. (2011). The paraoxonase 1, 2 and 3 in humans. Biochemia Medica, 21(2), 122-130. https://doi.org/10.11613/bm.2011.020 Russo, A., Pirisinu, I., Vacca, C., Reginato, E., Tomaro, E. S., Pippi, R., Aiello, C., Talesa, V. N., Feo, P., Romani, T. (2018). An intensive lifestyle intervention reduces circulating oxidised low-density lipoprotein and increases human paraoxonase activity in obese subjects. Obesity Research & Clinical Practice, 12(1), 108-114. https://doi.org/10.1016/j.orcp.2016.11.006 Sang, H., Yao, S., Zhang, L., Li, X., Yang, N., Zhao, J., Zhao, L., Si, Y., Zhang, Y., Lv, X., Xue, Y., Qin, S. (2015). Walk-run training improves the anti-inflammation properties of high-density lipoprotein in patients with metabolic syndrome. The Journal of Clinical Endocrinology & Metabolism, 100(3), 870–879. https://doi.org10.1210/jc.2014-2979 Senti, M., Tomas, M.,Vila, J., Marrugat, J., Elosua, R. J. S., Masia, R. (2001). Relationship of age-related myocardial infarction risk and Gln/Arg 192 variants of the human paraoxonase1 gene: the REGICOR study. Atherosclerosis, 156(2), 443–449. https://doi.org/10.1016/S0021-9150(00)00680-8 Silva, J. L., Vinagre, C. G., Morikawa, A. T., Alves, M. J. N., Mesquita, C. H., Maranhão, R. C. (2011). Resistance training changes LDL metabolism in normolipidemic subjects: a study with a nanoemulsion mimetic of LDL. Atherosclerosis, 219(2), 532-537. https://doi.org/10.1016/j.atherosclerosis.2011.08.014 Kinesiologia Slovenica, 31, 2, 235-251 (2025), ISSN 1318-2269 Anaerobic Training and Paraoxonase 1 Activity 251 Superko, H. R., Pendyala, L., Williams, P. T., Momary, K. M., King, S. B., Garrett, B. C. (2012). High-density lipoprotein subclasses and their relationship to cardiovascular disease. Journal of Clinical Lipidology, 6(6), 496- 523. https://doi.org/10.1016/j.jacl.2012.03.001 Taylor, J. K., Esco, M. R., Qian, L., Dugan, K., Jones, K. W. (2015). Single session of aerobic exercise influences paraoxonase 1 activity and concentration. Retos, 27(1), 222-225. https://doi.org/10.47197/retos.v0i27.34383 TheriChadorneshin, H., Abtahi-Eivary, S. H., Cheragh-Birjandi, S., Yaghoubi, A., Ajam-Zibad M. (2017). The Effect of Exercise Training Type on Paraoxonase-1 and Lipid Profile in Rats. Shiraz E-Medical Journal, 18(7), 1- 6. https://doi.org/10.5812/semj.46131 Turgay, F., Şişman, A. R., Aksu, A. Ç. J. (2015). Effects of anaerobic training on paraoxonase-1 enzyme (PON1) activities of high density lipoprotein subgroups and its relationship with PON1-Q192R phenotype. Journal of Atherosclerosis Thrombosis, 22(3), 313-326. https://doi.org/10.5551/jat.25809 Yigitturk, O., Turgay, F., Kizildag, S., Ozsoylu, D., Balcı, G. A. (2020). Do PON1–Q192R and PON1–L55M Do PON1–Q192R and PON1–L55M polymorphisms modify the effects of hypoxic training on paraoxonase and arylesterase activity. Journal of Sport and Health Science, 1-10. https://doi.org/10.1016/j.jshs.2020.11.004 Zhang, K., Zhuo, H., Guo, J., Li, D., Dai, R. (2022). Paraoxonase 1 -L55M polymorphism and coronary heart disease risk in the Chinese population: evidence from a meta-analysis. Food Science and Technology, 42(1), 1-5. https://doi.org/10.1590/fst.56721 Zibad, M. A., Afzalpour, M. E., Abtahi, S. H., Saghebjoo, M., Zadeh, M. H. (2015). Interactive effect of Saffron extracts and acute resistance exercise on serum paraoxonase-1 activity and c-reactive protein. Sports Med icine, 11(4), 2682–2688. https://doi.org/10.3390/antiox12061296