Acta agriculturae Slovenica, 116/2, 273–285, Ljubljana 2020 doi:10.14720/aas.2020.116.2.1346 Original research article / izvirni znanstveni članek Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance Ahmed M. HASSANEIN 1, 2 , Ahmed H. MOHAMED 3 , Heba Ahmed ABD ALLAH 3 , Hoida ZAKI 3 Received November 19, 2019; accepted October 26, 2020. Delo je prispelo 19. novembra 2019, sprejeto 26. oktobra 2020. 1 Sohag University, Faculty of Science, Central Laboratory of Genetic Engineering, Sohag, Egypt 2 Corresponding author, e-mail: Hassaneinam2@yahoo.com 3 South Valley University, Faculty of Science, Botany and Microbiology Department, Qena, Egypt Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance Abstract: Two cultivars of faba bean (Vicia faba ‘Giza 843’ and ‘Nobaria 3’) that differ in aluminum (Al) tolerance were used to study cytogenetic and genomic alterations under the influence of Al Cl 3 (5, 15, and 25 mmol AlCl 3 ) for different pe- riods (6, 12 and 24 h). Under Al treatments, mitotic index in both cultivars decreased and total chromosomal abnormalities increased. The frequencies of micronuclei and chromosomal abnormalities (C-anaphase, metaphase-star chromosomes, breaks, sticky and disturbed chromosomes during metaphase or anaphase) in ‘Giza 843’ were lower than in ‘Nabaria 3’. In- crease of the registered cytogenetic events under the influence of Al stress led to increase the detected polymorphism using RAPD and ISSR markers. Application of RAPD primers gave the same value of polymorphism in both faba bean cultivars under Al stress. Polymorphism average of nine ISSR prim- ers of ’Giza 843’ (65.36 %) was lower than that of ‘Nobaria 3’ (71.59 %). Molecular markers, cytogenetic characteristics and seedling growth data indicate that Al tolerance of ‘Giza 843’ was higher than of ‘Nobaria 3’. This work shows that cytoge- netic and ISSR techniques could be used efficiently to distin- guish between the ability of two faba bean cultivars to tolerate toxic effects of Al. Key words: aluminum tolerance; Vicia faba L.; chromo- somal abnormalities; cytogenetics; RAPD, ISSR Citogenetske in molekularne raziskave dveh sort boba so od- krile njuno različno toleranco na aluminij Izvleček: Dve sorti boba (Vicia faba ‘Giza 843’ in ‘Noba- ria 3’), ki sta se razlikovali v toleranci na aluminij (Al) sta bili uporabljeni v raziskavi citogentskih in genomskih sprememb, ki so jih povzročile različne koncentracije Al Cl 3 (5, 15, in 25 mmol AlCl 3 ) v različnih časovnih obdobjih (6, 12 in 24 h). Pri obravnavanjih z Al se je mitotski indeks obeh sort zmanjšal, ce- lokupne kromosomske aberacije pa so se povečale. Pogostost malih jeder (micronuclei) in kromosomskih aberacij (C-ana- faze, zvezdasti kromosomi v metafazi, lomi kromosomov, zle- pljeni in nenormalni kromosomi v metafazi in anafazi) sta bili pri ’Giza 843’ manjši kot pri ‘Nabaria 3’ . Povečanje ugotovljenih citogenetskih dogodkov zaradi vpliva Al stresa je povečalo ugo- tovljeni polimorfizem z RAPD in ISSR označevalci. Uporaba RAPD začetnih oligonukleotidov je dala enako vrednost poli- morfizma pri obeh sortah izpostavljenih aluminijevemu stresu. Poprečje polimorfizma devetih ISSR začetnih oligonukleoti- dov je bilo pri‘Giza 843’ (65,36 %) manjše kot pri‘Nobaria 3’ (71,59 %). Molekulski označevalvi, citogenetske značilnosti in parametri rasti sejank so pokazali, da je tolerance na aluminij pri ‘Giza 843’ večja kot pri ‘Nobaria 3’. Raziskava kaže, da bi se citogenetske metode in ISSR tehnike lahko učinkovito upo- rabljale za razlikovanje sposobnosti tolerance različnih sort na toksične učinke Al. Ključne besede: toleranca na aluminij; Vicia faba L.; kro- mosomske aberacije; citogenetika; RAPD; ISSR Acta agriculturae Slovenica, 116/2 – 2020 274 A. M. HASSANEIN et al. 1 INTRODUCTION Faba bean (Vicia faba L.) is one of the most impor- tant legume plants where it is cultivated for humans as well as animals. Faba bean seeds contain high proteins and other important components. It is a diploid species with 2n = 12. It belongs to Viceae tribe of Papilionoideae subfamily of Fabaceae family. In general, legume plants are used to improve the fertility of soil through nitro- gen fixation. Around the world, 37 collections including about 38,360 faba bean germplasm have been conserved; the largest collection belongs to International Center for Agricultural Research in the Dry Areas - ICARDA in Syria (Duc et al., 2010). Genetic variation in faba bean ranges from 10 to 60 % depending on plant genotype and the environmen- tal conditions (Suso et al., 2006). Faba bean is cultivated under several conditions, but water deficiency, increased soil salinity and pollution with toxic metals such as alu- minum (Al) limit the faba bean production (Abdelhamid et al., 2010). Consequently, faba bean growth and yield retardants should be investigated. Aluminum abundance in the earth’s crust is very high. In nature, the highest amount of Al is present in un- soluble form (aluminum silicate), but very small amount of Al is present in soluble form; this enters and affects biological systems (May and Nordstrom, 1991). The de- tected negative effects of Al on plant root tips were at- tributed to increase of cell wall rigidity, decrease of cell respiration and DNA replication, and interfere with cell division (Llugany et al., 1995). Some authors confirmed that root tips play a major role in Al toxicity/protection (Bennet and Breen, 1991), but others refuse this hypoth- esis (Ryan et al., 1993). In Al-sensitive maize cultivar, Al was accumulated in the distal transition zone of the root apex (1-2 mm) and inhibited root elongation (Sivaguru and Horst, 1998). In plants, Al tolerance varies between species or cul- tivars of each one and it depends on detoxification of ac- cumulated Al or prevention of Al uptake (Rengel, 1996). Aluminum toxicity is usually associated with chromo- somal changes, which can be detected by karyologic analysis of Al-treated root tips by estimating mitotic in- dices (MI), micronucleus (MN) formation and chromo- somal abnormalities (CA) (Yi et al., 2010; Kotelnikova et al., 2019). Faba bean could be used as a test species for monitoring the genotoxicity of Al because of its small number of chromosomes and their length make it easy to detect the damage occurring under the influence of the studied factor (Gopalan, 1999; Yi et al., 2010; Altwaty et al., 2016). Induction of reactive oxygen species (ROS) forma- tion under Al toxicity was reported (Rout et al., 2001) causing single and double strand DNA breaks. Conse- quently, the frequency of CA and MN is increased (Yi et al., 2010). In faba bean root tips, high concentrations of Al resulted in decreased MI, reduced mitotic activity and blocked DNA synthesis (Mohanty et al., 2004), and DNA recombination (Achary and Panda, 2010). Yi et al. (2010) reported that some mitotic cells could enter and continue mitotic cell division with abnormal DNA. Chromosomal abnormalities due to abiotic stress agent could be detected not only by cytogenetic ap- proach but also with molecular testing based on PCR. Chromosomal abnormalities as well as point mutations may result in alterations either at or between the RAPD or ISSR primer binding sites leading to alterations of the PCR products. These products can be used to calculate polymorphism which gives clear indication about the stability of the studied genome under the influence of the studied agent (Hassanein et al., 2018). The data available so far on the toxic effects of high concentrations of Al on plant species are few. While rela- tively high concentrations of AlCl 3 was used in our study (5- 25 mmol for 24 h), they were lower than what used by others (Karimai and Poozesh, 2016). Under relatively high concentrations of AlCl 3 , studies linking results of cytogenetical and molecular techniques are scarce. Con- sequently, the aim of this study was to investigate genome stability of two faba bean cultivars under the influence of relatively high dose of AlCl 3 using cytogenetical and molecular techniques. Also, to know which of the easi- est and cheapest molecular biology techniques, such as RAPD or ISSR, confirm the obtained cytogenetic data. 2 MATERIAL AND METHODS In preliminary experiment, seeds of ten faba bean cultivars were obtained from Agriculture Research and Seeds Center in Qena, Egypt. Faba bean seeds were sur- face sterilized with 5 % (v/v) commercial sodium hy- pochlorite for 5 min followed by 0.2 % (w/v) mercuric chloride for 5 min. Seeds were rinsed in sterilized deion- ized water 3 times, 10 min each. For seed germination, they were subjected to a series of AlCl 3 concentrations (5, 10, 15, 20, 25, 30, 35 and 40 mmol) for different exposure times (6, 12 and 24 hr). After ten days, seed germination and seedling growth parameters were estimated. Conse- quently, three AlCl 3 concentrations (5, 15 and 25 mmol) as well as the most tolerant (‘Giza 843’) and sensitive (‘Nobaria 3’) cultivars were used for further studies. Seeds of ‘Giza 843’ and ‘Nobaria 3’ were selected to be homogeneous in size and color, and without wrinkles. Ten sterilized seeds were grown in sterilized petri dish contains filter paper and a thin layer of sterilized distilled Acta agriculturae Slovenica, 116/2 – 2020 275 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance water (15 ml) for 2 to 3 days. Seedlings with root length of 2-3 cm were immersed in solution of AlCl 3 of three concentrations (5, 15 and 25 mmol) for three time pe- riods (6, 12 and 24 h). Faba bean seeds treated with dis- tilled water were used as control. In each treatment, three replicates were used, each with 10 seeds/Petri dish. Seeds were germinated under lab condition at 28 ± 2 °C. For each treatment, ten root tips were cut and fixed overnight in ethanol:acetic acid 3:1 (v/v) at 4  o C. Then, root tips were hydrolyzed with 1 N HCl, stained microsopic slides were prepared by at 60 °C for 8-10 minutes. Then, roots were washed and transferred into the Feulgen stain for one hour. Root tips were teased out on clean slide, coated with egg-albumen, in a drop of 45 % glacial acetic acid and they squashed between cover and slide. To separate covers, slides were turned face down in a Petri-dish con- taining distilled water. Plant materials were dehydrated using a series of ethyl alcohol (50 %, 70 %, 96 %) for 10 minutes in each alcohol concentration. The slides were immersed in a solution of absolute ethanol and xylol (1:1). Slides were cleared in pure xylol for 10 minutes, mounted in Canada balsam and transferred to dry in a hot air oven at 35-40 °C for 2-3 days (Darlington and La Cour, 1976; Kanaya et al., 1994). The percentage of MI, phase indexes, total abnor- malities and the percentage of the aberrations were de- termined according to the following formulas: Mitotic index (M.I.) = (No. of dividing cells x 100)/ (No. of non dividing cells + No.of dividing cells) Total abnormalities = (No. of abnormal dividing cells x 100)/( No. of dividing cells) % of the phase = (No. of dividing cells in phase x 100)/( No. of dividing cells) The percentage of the aberrations = (No. of aberrant cells x 100)/( No. of dividing cells) To determine the genetic variation and genome sta- bility of root tips treated with 5 mM AlCl 3 for different periods, the RAPD and ISSR techniques were used. DNA extraction was carried out three times of each treatment and according to the method of Porebski et al. (1997). Hexadecyl trimethyl ammonium bromide (CTAB) pro- cedure based on the protocol of Porebski et al. (1997) was used. Frozen root tissues (200 mg) were ground using 1000 μl of CTAB buffer. The obtained homogenate was mixed gently with 2 μl of RNAse, incubated at 65 °C for 90 min and centrifuged at 10000 rpm for 5 min. Super- natant was transferred to a new tube, where 500 μl of 24:1 chloroform-isoamyl alcohol were add and mixed well by shaking. The mixture was centrifuged at 10000 rpm for 5 min, and the aqueous phase (top) was quickly measured and isolated. Then, one volume of cold isopropanol was added. Samples were let to sit at – 20 o C for 45-60 min. Samples were centrifuged for 10 min at 12000 and su- pernatant was carefully removed without disturbing the resultant DNA pellet. Then, 700 μl of cold 70 % ethanol were added, inverted once to mix and centrifuged for 1 min at 12000 rpm. The DNA pellet was dried at 55 °C, resuspended in 100 μl of TE buffer and allowed to resus- pend for 1hr at 55 °C before use. A total of ten RAPD and nine ISSR primers (Table 1) were used to analyze genome stability of Al treated roots. The obtained genomic DNA was amplified using Thermal Cycler (Biometra TPersonal Combi, Biometra GmbH, Germany). The RAPD and ISSR reactions were performed in a 25 µl volume containing 12.5 µl of Go Taq® Green Master Mix (Promega, Madison, USA), 3 µl of primer 10 pmol, 6.5 µl of free nuclease water and 3 µl of 100 ng genomic DNA templates. RAPD Primer Primer Sequence (5’---------3’) ISSR Primer Primer Sequence (5’---------3’) OPA-02 TGCCGAGCTG ISSR1 ACACACACACACACACCTG OPA-05 AGGGGTCTTG ISSR2 CACACACACACACACAAAGCT OPA-07 GAAACGGGTG ISSR3 ACACACACACACACACAAG OPA-17 GACCGCTTGT ISSR4 GAGAGAGAGAGAGAGACTG OPat-08 TCCTCGTGGG ISSR5 GAGAGAGAGAGAGAGACTC OPaw-10 GGTGTTTGCC ISSR7 CTCTCTCTCTCTA (CT)6A OPD-1 ACCGCGAAGG ISSR8 TCTTCTTCTTCTG OPD-18 GAGAGCCAAC ISSR9 TGTTGTTGTGC OPJ-15 TGTAGCAGGG ISSR10 GTGGTGGTGGC OPP-13 GGAGTGCCTC Table 1: The applied RAPD and ISSR primers Acta agriculturae Slovenica, 116/2 – 2020 276 A. M. HASSANEIN et al. The program of PCR amplification was applied with initial denaturation cycle at 94 °C for five minutes. The next 40 cycles were carried out using denaturation step at 94 °C for 45 sec, annealing step (optimized for each primer), and elongation step at 72 °C for 1 min. Finally, extension step was performed at 72 °C for 7 min. The ob- tained PCR products were subjected to electrophoresis using 1.5 % or 2 % agarose gel with ethidium bromide (0.5 µg ml -1 ). Run was carried out in 1X TBE buffer at 70 volts. The amplified PCR products were visualized and photographed. Polymorphic, monomorphic, unique, to- tal and molecular weight of each band were determined. Reproducibility was taken in consideration to mini- mize personal errors. In this concern, each primer was used three times under the same PCR conditions. The DNA banding patterns obtained from amplification of the studied genome using RAPD and ISSR primers were analyzed by a computer program; Gene Profiler (version 4.03). Microsoft excel file was prepared for scoring the data as ‘1’ for matched and ‘0’ for the unmatched of DNA band. Monomorphic, polymorphic and unique bands were taken into consideration to calculate polymorphism of each primer to determine the number of events lead- ing to alteration of primer binding sites on the genome under the toxic effect of Al compared to control plants. Dendrograms were generated for cluster analysis accord- ing to Legendre and Legendre (1983) using the Commu- nity Analysis Package Software Program (CAP) Version 4.0 (Richard and Peter, 2007). 3 RESULTS Depending on data of preliminary seed germination and seedling growth, ‘Giza 843’ was found to be the most tolerant but ‘Nobaria 3’ was the most sensitive faba bean cultivar to AlCl 3 . Cultivar ‘Nobaria 3’ recorded the high- est decrease of root growth parameters, where they were 5.71 %, 74.29 % and 77.14 % for root lengths, 53.41 %, 80.68 % and 87.50 % for fresh mass, and 50 %, 75 % and 75 % for dry mass under the treatment with 5, 15 and 25  mmol AlCl 3 , respectively. Under these conditions, ‘Giza 843’ recorded increased fresh (6 %) and dry mass (22 %) but reduced shoot length (3.3 %) when 5 mmol AlCl 3 was used. In addition, ‘Giza 843‘ showed reduced root growth parameters where they were 68.85 % and 72.13 % for root length, 53.76 % and 68.82 % for fresh mass, and 44.44 % and 66.67 % for dry mass of 15 and 25 mmol AlCl 3 , respectively . Aluminum chloride caused a significant decrease in the mitotic activities in treated root tips of ‘Giza 843’ or ‘Nobaria 3’ cultivars (Tables 2 and 4) when they were treated with different concentrations of AlCl 3 for dif- ferent time periods. Data of MI indicate that ‘Giza 843’ was the least affected when root tips were subjected to different concentrations of AlCl 3 for 6 hr. For exam- ple, under the influence of the lowest concentration of AlCl 3 (5 mmol) and the shortest exposure time (6 h), MI of ‘Giza 843‘ (2.70) was higher than that of ‘Nobaria 3’ (1.87). The same was observed when the highest concen- tration of AlCl 3 (25 mmol) was used for 6 hr. MI of ‘Giza 843’ (3.10) was higher than that of ‘Nobaria 3’ (2.60). The lowest MI values were detected when root tips of both cultivars were subjected to different Al concentrations for 24 hr. In ‘Giza 843‘ , complete inhibition of mitotic cell activities was detected when the highest concentration of Al (25 mmol AlCl 3 ) for the longest time of exposure (24 hr) was used. In comparison to that of control (AlCl 3 -untreated plants), the increase in AlCl 3 concentration or exposure time led to significant increase in the values of interphase and it associated with significant increase in total chro- mosomal abnormalities in both cultivars (Table 2 and 4). In addition, while the highest values of interphase were detected under 25 mmol Al for 24 hr, prophase stage was inhibited completely in both cultivars. In ‘Giza 843‘, when the AlCl 3 exposure time was 6 hr, total abnormali- ties increased with the increase of Al concentrations. In additions, when the concentration of AlCl 3 was 5 mmol, total abnormalities increased with the increase of expo- sure time. Under the influence of all AlCl 3 concentra- tions for 6 or 12 h, total abnormalities of ‘Giza 843‘ were lower than those of ‘Nobaria 3’ . While total mitosis and MI drastically decreased under AlCl 3 treatments for 24 h, high total chromosomal abnormalities were detected in both cultivars. The frequency of abnormalities in all mitotic phases increased under AlCl 3 treatments in both cultivars. In both cultivars, the frequency of MN increased under the influence of all AlCl 3 treatments, this increase was lower in ‘Giza 843‘ than ‘Nobaria 3’ (Tables 3 and 5). Cells with one, two or more micronuclei appeared in both cultivars (Fig. 1). All AlCl 3 concentrations induced chromosomal ab- normalities at all stages of mitosis; depended on the used cultivar. While the frequency of C-metaphase in ‘Giza 843‘ was higher than ‘Nobaria 3’ , vice versa was detected in case of C-anaphase (Table 3 and Table 5). On the other side, the frequency star chromosomes in metaphase of ‘Giza 843‘ (Table 3) was lower than that of ‘Nobaria 3’, vice versa was detected during ana-telophase. In addi- tion, under the influence of different AlCl 3 treatments, the frequency of different abnormalities was higher in ‘Nobaria 3’ than ‘Giza 843‘. For example, the frequencies of chromosomal breaks and sticky and disturbed chro- mosomes during metaphase or ana-telophase in ‘No- Acta agriculturae Slovenica, 116/2 – 2020 277 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance Table 2: Cytogenetic analysis of Vicia faba ‘Giza 843’ root tip treated with three concentrations of AlCl 3 for three exposure times. Abbreviations: Mitotic index (MI), total abnor- malities, interphase and mitotic phases (prophase, metaphase and ana-telophase), include normal (Total) and abnormal (Abn.) mitotic phases. Treatment Total mitosis MI (%) % Total abnormal % Interphase % Prophase % Metaphase % Ana-telophase Exposure time (h) AlCl 3 conc. Total Abn. Total Abn. Total Abn. Total Abn. 6 Control 355 7.10±0.36 4.09±0.42 92.9 0.4 35.9 0.4 23.6 1.4 40.5 0 5 mmol 138 2.70±0.40* 59.10±14.40* 97.2 0.6 44.6 11.8 29.7 25.7 25.7 15.8 15 mmol 115 2.30±0.10* 74.50±9.50* 97.6 0.6 63.1 16.7 17.1 17.1 19.8 12.6 25 mmol 157 3.10±0.30* 76.47±0.55* 96.4 0.7 69.1 17.6 11.5 9.4 19.4 9.4 12 5 mmol 53 1.07±0.25* 76.90±14.00* 99.0 0.5 32.6 28.5 28.6 24.5 38.8 22.4 15 mmol 63 1.27±0.15* 67.73±1.05* 98.7 0.6 40.2 18.2 35.1 32.5 24.7 20.8 25 mmol 182 3.60±0.10* 79.47±3.55* 98.4 0.07 43.4 32.4 27.5 28.0 29.1 17.6 24 5 mmol 73 1.47±0.15* 93.37±1.05* 98.5 1.4 38.7 35.5 54.8 54.8 6.5 3.2 15 mmol 75 0.10±0.00* 100.00±0.00* 99.9 3.9 0 0 100 100 0 0 25 mmol 0 0 0 100 0.9 0 0 0 0 0 0 * The mean difference is significant at the 0.05 level. Table 3: Types and percentage (%) of chromosomal abnormalities in Vicia faba ‘Giza 843’ root tip treated with three concentrations of AlCl 3 for three exposure times. Abbrevia- tions: C-metaphase (C-m), sticky (Stick), star, break, disturbed (Dist), and diagonal (Diag), bridge, free, C-anaphase (C-ana), micronuclei (MN) and bi-nucleated cell (BN). Treatment Interphase abnor- malities Metaphase abnormalities Ana-telophase abnormalities Exposure time (h) AlCl 3 conc. MN BN C-m Stick Star Break Dist Stick Bridge Dist Diag Free Break Star C-ana Control 0 0 0 1.3 0 0 0 0 0 0 0 0 0 0 0 6 5 mmol 0.16 0.5 19.8 1.9 2.9 0.9 1.9 1.9 0.9 1.9 5.9 0 0.9 4.9 0.9 15 mmol 0.36 0.04 15.3 0 0 0.9 0 2.7 0 0.9 0.9 0.9 1.8 5.4 0 25 mmol 1.46 0.4 7.2 0 0 0.7 1.4 2.2 0 0 5.7 0 1.4 0 0 12 5 mmol 0.17 0.2 20.4 4.1 0 0 0 8.2 2.1 0 4.1 0 0 6.1 2.1 15 mmol 0.24 0.1 28.6 0 0 2.6 0 2.6 1.3 0 2.6 0 6.5 1.3 2.6 25 mmol 1.22 0 28.0 0 0 0 0 3.8 0 5.5 0 1.6 0 0.5 6.1 24 5 mmol 0.32 0 54.8 0 0 0 0 0 0 0 0 3.2 0 0 0 15 mmol 0.07 0.7 100 0 0 0 0 0 0 0 0 0 0 0 0 25 mmol 0.67 0.3 0 0 0 0 0 0 0 0 0 0 0 0 0 Acta agriculturae Slovenica, 116/2 – 2020 278 A. M. HASSANEIN et al. Table 4: Cytogenetic analysis of Vicia faba ‘Nobaria 3’ root tip treated with three concentrations of AlCl 3 for three exposure times. Abbreviations: Mitotic index (MI), total abnor- malities, interphase and mitotic phases (prophase, metaphase and ana-telophase), include normal (Total) and abnormal (Abn.) mitotic phases. Treatment Total mitosis MI (%) % Total ab- normal % Interphase % Prophase % Metaphase % Ana-telophase Exposure time (h) AlCl 3 conc. Total Abn. Total Abn. Total Abn. Total Abn. 6 Control 355 7.10±0.36 4.09±0.42 92.9 0.4 35.9 0.4 23.6 1.4 40.5 0 5 mmol 91 1.87±0.30* 87.25±5.68* 97.6 2.4 65.7 50.6 27.4 27.3 6.9 4.10 15 mmol 49 1.98±0.12* 78.30±5.85* 96.7 1.4 67.9 20.7 11.3 9.4 20.8 13.32 25 mmol 130 2.60±0.30* 86.00±2.00* 97.4 1.6 41.9 20.3 23.2 18.4 34.9 17.7 12 5 mmol 160 3.20±0.15* 92.77±2.15* 97.6 0.8 52.2 21.7 13.1 8.6 34.7 21.7 15 mmol 110 2.19±0.46* 86.87±0.95* 96.2 2.6 25.9 22.9 22.2 22.2 51.9 24.07 25 mmol 22 0.44±0.03* 95.70±3.55* 97.8 1.3 30.2 27.9 46.5 45.3 23.3 16.3 24 5 mmol 30 0.60±0.20* 93.64±1.70* 98.3 0.7 17.4 17.4 43.5 39.1 39.1 30.4 15 mmol 27 0.54±0.04* 87.00±3.00* 97.5 1.8 42.9 28.5 32.1 28.5 25 34.3 25 mmol 16 0.33±0.08* 97.27±1.80* 99.5 1.7 0 0 3.1 5.2 96.9 63.2 * The mean difference is significant at the 0.05 level. Table 5: Types and percentage (%) of chromosomal abnormalities in Vicia faba ‘Nobaria 3’ root tip treated with three concentrations of AlCl 3 for three exposure times. Abbrevia- tions: C-metaphase (C-m), sticky (Stick), star, break, disturbed (Dist), and diagonal (Diag), bridge, free, C-anaphase (C-ana), micronuclei (MN) and bi-nucleated cell (BN). Treatment Interphase abnor- malities Metaphase abnormalities Ana-telophase abnormalities Exposure time (h) AlCl 3 conc.MN BN C-m Stick Star Break Dist Stick Bridge Dist Diag Free Break Star C-ana Control 0 0 0 1.3 0 0 0 0 0 0 0 0 0 0 0 6 5 mmol 2.44 0.23 6.8 1.4 0 1.4 17.8 1.4 1.4 1.4 0 0 0 0 0 15 mmol 0.91 0.05 0 0 1.9 0 7.5 1.9 0 5.7 1.9 0 5.7 0 0 25 mmol 0.80 0.09 6.1 1.3 0 2.6 7.7 1.3 4 11.3 0.6 0 1.3 0.3 0.6 12 5 mmol 0.71 0.1 0 4.3 0 4.3 0 4.3 0 0 0 4.3 4.3 8.7 0 15 mmol 1.38 0.1 0.9 0.9 0 1.9 18.5 10.2 0 7.4 0.9 0 3.7 1.8 0.9 25 mmol 1.88 0.1 40.6 1.2 0 1.2 2.3 4.7 0 2.3 2.3 1.2 1.2 4.7 0 24 5 mmol 2.40 0.1 30.4 0 4.3 0 4.3 8.7 0 17.4 0 4.3 0 0 0 15 mmol 1.46 0 10.7 0 3.6 7.1 7.1 3.6 0 10.7 0 0 0 0 0 25 mmol 1.45 0.2 5.3 0 0 0 0 63.2 0 0 0 0 0 0 0 Acta agriculturae Slovenica, 116/2 – 2020 279 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance baria 3’ cells were higher those of ‘Giza 843‘. In concern to ana-telophase abnormalities, the frequency of diago- nal chromosomes under different AlCl 3 treatments was higher in ‘Giza 843‘ than in ‘Nobaria 3’ (Tables 3 and 5). In comparison to other chromosomal abnormalities, free chromosomes appeared in low frequency in both culti- vars (Table 3 and Table 5); it never appeared when low concentration of AlCl 3 in combination with short expo- sure time was applied. Root tips treated with 5 mmol AlCl 3 for different pe- riods were subjected to molecular analysis using RAPD (Table 6) and ISSR primers (Table 7). When ten RAPD Figure 1: Chromosomal aberrations in Vicia faba ‘Giza 843 and Nobaria 3’ root tips under the influence of AlCl 3 : interphase (1), prophase (2), metaphase (3), anaphase (4), telophase (5), micronuclei with different sizes and different number (6, 7, 8, 9), binucle- ated cell (10), irregular prophase (11), sticky metaphase (12), star metaphase (13), C-metaphase (14), dis 5rturbed metaphase (15), diagonal metaphase (16), metaphase break (17), sticky anaphase (18), anaphase break (19), anaphase bridge (20), C-anaphase (21), anaphase with free chromosome (22), diagonal anaphase (23), disturbed anaphase (24) and sticky anaphase break (25). The scale bar equals 10 µm. Figure 2: RAPD profile generated by 9 primers using roots of two Vicia faba cultivars treated with 5 mmol AlCl 3 for different peri- ods. Lanes 1, 2, 3 and 4: ‘Giza 843’ for 0 (control), 6, 12 and 24 h, respectively. Lanes 5, 6, 7 and 8: ‘Nobaria 3’ for 0 (control) 6, 12 and 24 h, respectively. M: DNA ladder. Acta agriculturae Slovenica, 116/2 – 2020 280 A. M. HASSANEIN et al. primers were used for amplification of genomic DNA of two faba bean cultivars (‘Giza 843‘ and ‘Nobaria 3’), different profiles were obtained (Table 6; Fig. 2). They expressed 27 and 26 polymorphic, 20 and 20 monomor- phic, 8 and 10 unique out of total 55 and 56 bands when genomes of ‘Giza 843‘ and ‘Nobaria 3’ were amplified, re- spectively. Consequently, while percentage of polymor- phism ranged from 0 % (OPD-18) to 85.72 % (OPA-17) with an average of 61.74 % in ‘Giza 843‘ , they ranged from 20 % (OPD-18) to 90.91 % (OPA-17) with an average of 61.24 % in ‘Nobaria 3’ . The applied ISSR primers on ‘Giza 843‘ genome resulted in amplification of 38 polymorphic out of 69 fragments (55.07 %), they included 18 monomorphic, 9 unique and 38 polymorphic bands (Table 7; Fig. 3). Con- sequently, the percentage of polymorphism in ‘Giza 843‘ PCR products ranged from 25 % (ISSR5 or ISSR10) to 100 % (ISSR9) with an average of 65.36 %; it was higher than that of RAPD primers. When root tips of ‘Nobaria 3’ were subjected to AlCl 3 for different periods using ISSR primers, 72 fragments were amplified including 22 monomorphic, 7 unique and 43 polymorphic bands. Per- centage of polymorphism ranged from 25 % (ISSR5) to 100 % (ISSR9) with an average of 71.59 %; it was higher than that of RAPD primers. Cluster tree based on ten RAPD and nine ISSR primers of ‘Giza 843‘ cultivar resulted in grouping of con- trol plant with others subjected to 5 mmol Al for 6 or 12 h (Fig. 4). On the other side, the dendrogram of ‘Nobaria 3’ included two main clusters; the first cluster contained control plants and others subjected to AlCl 3 for 6 h. The Figure 3: ISSR profile generated by 9 primers using roots of two Vicia faba cultivars treated with 5 mmol AlCl 3 for different periods. Lanes 1, 2, 3 and 4: ‘Giza’ 843 for 0 (control), 6, 12 and 24 h, respectively. Lanes 5, 6, 7 and 8: ‘Nobaria 3’ for 0 (control) 6, 12 and 24 h, respectively. M: DNA ladder. Figure 4: UPGMA based cluster tree of Vicia faba ‘Giza 843’ exposed to 5 mmol AlCl 3 for 6, 12 and 24 h based on ten RAPD and nine ISSR primers. Acta agriculturae Slovenica, 116/2 – 2020 281 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance Table 6: T en RAPD primers, annealing temperature, size of amplified fragments (bp), total number of amplified fragments, number of polymorphic bands and unique bands identi- fied per primer used to access genome stability of two Vicia faba cultivars (Giza 843 and Nobaria 3) under the influence of Al stress. Primer Annealing temperature (°C) Polymorphic bands Monomorphic bands Unique bands Total bands Size range (bp) Polymorphism (%) Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza 843 Nobaria 3 OPA-02 32 4 3 2 2 0 0 6 5 141-753 66.67 60.00 OPA-05 30 4 3 3 3 1 0 8 6 225-1102 62.50 50.00 OPA-07 30 3 2 2 2 1 3 6 7 497-1428 66.67 71.43 OPA-17 30 5 7 1 1 1 3 7 11 162-1811 85.72 90.91 OPat-08 32 2 1 1 1 0 1 3 3 218-958 66.67 55.67 OPaw-10 30 3 4 1 1 1 0 5 5 313-912 80.00 80.00 OPD-1 32 2 2 3 3 3 0 8 5 236-1364 62.5 40.00 OPD-18 30 0 0 4 4 0 1 4 5 292-1278 00.00 20.00 OPJ-15 30 2 2 1 1 0 0 3 3 229-737 66.67 66.67 OPP-13 32 2 2 2 2 1 2 5 6 345-876 60.00 66.67 Total 27 26 20 20 8 10 55 56 61.74 61.24 Table 7: Nine ISSR primers, annealing temperature, size of amplified fragments (bp), total number of amplified fragments, number of polymorphic bands and unique bands identi- fied per primer used to access genome stability of two Vicia faba cultivars (Giza 843 and Nobaria 3) under the influence of Al stress. Primer Annealing temperature (°C) Polymorphic bands Monomorphic bands Unique bands Total bands Size range (bp) Polymorphism (%) Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza 843 Nobaria 3 Giza843 Nobaria3 ISSR1 56 6 7 3 3 1 1 10 11 175-1287 70.00 72.73 ISSR2 60 4 5 1 1 2 0 7 6 239-703 85.71 83.33 ISSR3 58 6 6 1 1 0 1 7 8 206-870 85.71 87.50 ISSR4 50 1 3 2 2 0 2 3 7 167-985 33.33 71.43 ISSR5 50 2 2 6 6 0 0 8 8 188-565 25.00 25.00 ISSR7 38 5 6 1 1 1 1 7 8 804-1376 85.71 87.50 ISSR8 36 5 5 2 2 2 0 9 7 295-1489 77.78 71.42 ISSR9 32 7 6 0 0 3 0 10 6 169-828 100 100 ISSR10 38 2 3 6 6 0 2 8 11 457-1557 25.00 45.45 Total 38 43 18 22 9 7 69 72 65.36 71.59 Acta agriculturae Slovenica, 116/2 – 2020 282 A. M. HASSANEIN et al. second cluster included plants subjected to AlCl 3 for 12 or 24 h (Fig. 5). 4 DISCUSSION When seed were germinated and subjected to AlCl 3 concentrations, they showed retardation of seed germi- nation and seedling growth, which were lower in ‘Giza 843‘ than in ‘Nobaria 3’. Retardation in plant growth under the influence of Al toxicity could be attributed to DNA damage (Achary and Panda, 2010), inhibition of cell division and elongation (De Campos and Vic- cini (2003), stimulation of oxidative stress (Rout et al., 2001), inhibition of water movement through roots, and retardation of root development and the ability of plants to develop symbiosis (Aroca et al., 2007; Belachew and Stoddard, 2017). Consequently, aluminum toxicity exac- erbates the effects of other abiotic stresses (Muktadir et al., 2020). Seedlings were used in this study because they are more susceptible to AlCl 3 than older plants (Thaworn- wong and van Diest, 1974) especially when relatively high concentration of AlCl 3 was used. Aluminum toxic- ity on faba bean cultivars as well as other plant species was reported (Rout et al., 2001; Yi et al., 2010; Altwaty et al., 2016), but its effect varies within plant species and genotypes (Rengel, 1996). To mimic many unfertile acid soils around the globe, 50 mmol AlCl 3 for 72 h was used to test germplasm sensitivity to Al toxicity (Domingues et al., 2013). In our study, high concentrations of Al Cl 3 up to 25 mmol were used for cytogenetic studies. Under these conditions, seedling growth of ‘Giza 843‘ was less influenced by AlCl 3 than ‘Nobaria 3’ . Aluminum chloride caused a significant decrease in mitotic activities of root tip cells of ‘Giza 843‘ and ‘No- baria 3’ . The reduction in MI of ‘Giza 843‘ was lower than that of ‘Nobaria 3’ indicating that ‘Giza 843‘ was more Al-tolerant than ‘Nobaria 3’ . The obtained data indicate that Al Cl 3 induced cell cycle defects in faba bean root cells (Zhang et al., 2009; Yi et al., 2010). The lowest values of MI were detected when the highest concentration of AlCl 3 (25 mmol was used for 24 h leading to the com- plete inhibition of cell division in ‘Giza 843‘. Inhibition of mitotic cell cycle was attributed to the retardation of cell cycle during interphase (Mohandes and Grant, 1972), decline of energy resources (Rost and Morrison, 1984), inhibition of transition from G1 to S and G2 (Vanʹ t Hoff,1985) and binding of Al on DNA molecules (Mat- sumoto et al., 1976). While total mitosis and MI drastically decreased, total abnormalities increased in both cultivars when they were subjected to AlCl 3 for 6 or 12 h. Under these conditions, total abnormalities in ‘Giza 843‘ were lower than those of ‘Nobaria 3’, which may be due to lower abnormalities in prophase and ana-telophase stages, es- pecially under the influence of the lowest exposure pe- riod. Increased exposure time to AlCl 3 for more than 6 h resulted in irregular trends of the obtained data. Under Al stress, cell divisions in faba bean root tips was often associated with reduction in genomic template stability and an increase in RAPD band frequencies (Rout et al., 2001; Taspinar et al., 2018). Hartig and Beck (2006) con- firmed the survival of the stressed cells if they tolerated the occurred mutation (Hartig and Beck, 2006). In both cultivars, while frequency of interphase was very high under the highest Al treatment (25 mmol for 24 h), the prophase was inhibited completely in this study and oth- ers (Yi et al., 2010). The frequency of MN increased under the influence of all AlCl 3 treatments, this increase was lower in ‘Giza Figure 5: UPGMA based cluster tree of Vicia faba ‘Nobaria 3’ exposed to 5 mmol AlCl 3 for 6, 12 and 24 h based on ten RAPD and nine ISSR primers. Acta agriculturae Slovenica, 116/2 – 2020 283 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance 843‘ than ‘Nobaria 3’. Micronuclei formation was used as an effective tool to measure of chromosomal DNA damages and analyzes the mutagenic effect of chemicals (Fenech, 2008). These studies indicated that some of the cells enter the mitotic cell division with damaged DNA (Hartig and Beck, 2006). Under stress conditions, posi- tive correlation was detected between chromosomal ab- normalities and MN, and antioxidant enzymes and lipid peroxidation (Souguir et al., 2011). Since ‘Giza 843’ had less micronuclei and chromosomal abnormalities than ‘Nobaria 3’ under AlCl 3 stress, ‘Giza ‘843‘ was considered more tolerant to Al than ‘Nobaria 3’ cultivar. While several types of chromosomal abnormalities at all stages of mitosis were detected under AlCl 3 treat- ments, they depended on the used cultivar. The most common types of these abnormalities were bridges, lag- gards, fragments and micronuclei as was reported by Yi et al. (2010). Under the influence of different AlCl 3 treatments, frequencies of appearance of different abnor- malities including C-anaphase, star metaphase chromo- somes, and breaks, sticky and disturbed chromosomes during metaphase or anaphase were higher in ‘Nobaria 3’ than those of ‘Giza 843‘. Our data confirmed that Al is a genotoxic and cytotoxic reagent in plant cells leading to chromosomal abnormalities in several forms (Yi et al., 2010). Under the toxic effect of AlCl 3 , changing the fre- quency of primers binding loci increased as cytogenetical events increased; which could be identified by the val- ues of the obtained polymorphism. When ten of RAPD primers were used for amplification of genomic DNA of ‘Giza 843‘ and ‘Nobaria 3’, the polymorphism average 61.74 % in ‘Giza 843‘ and 61.24 % in ‘Nobaria 3’. Link et al. (1995) confirmed that RAPD was useful molecular markers to study genetic variation in faba beans. In our work, application of RAPD technique to detect genetic variation due to Al treatments in faba bean was not rec- ommended. Application of ISSR primers on ‘Giza 843‘ and ‘No- baria 3’ genomes resulted in amplification of 69 and 72 fragments, respectively. ISSR technique was efficiently used for classifying faba bean and other plant species (Abdel-Razzak et al., 2012; Salem and Hassanein, 2017; Hassanein et al., 2018). The calculated polymorphism av- erage of ISSR primers of ‘Giza 843‘ was lower than that of ‘Nobaria 3’ indicating that ‘Giza 843‘ genome was more stable than that of Nobaria 3 under Al stress. The de- tected DNA polymorphism may be due to mismatching at the primer site, appearance of a new primer site and/ or change the distance between two opposite primers. These events may result from point, and chromosomal mutations/abnormalities (Kumar and Rai, 2006). Conse- quently, these events could be detected by cytogenetical techniques (through micronuclei formation and chro- mosomal abnormalities) or molecular techniques such as ISSR (through polymorphism average). Data obtained from both techniques confirmed that Al tolerance of ‘Giza 843‘ was higher than that of ‘Nobaria 3’ . ISSR was efficiently used to detect variation in faba bean (Abdel- Razzak et al., 2012). Combination of cytogenetical and molecular techniques for efficient evaluation of genetic variation in plants was recommended in this study and others (Begum and Alam, 2017; Hossain et al., 2017). Construction of dendrograms depending on the data of molecular techniques and study of their details supplemented us with another evidence confirmed the harmony between cytogenetical and molecular biology techniques as well as seedling growth parameters. The obtained cluster tree of ‘Giza 843‘ grouped of control plant with others subjected to 5 mmol Al for 6 or 12 hr. On the other side, the cluster tree of ‘Nobaria 3’ grouped control plants with only others subjected to 5 mmol AlCl 3 for 6 hr. Comparison between the two obtained dendro- grams, polymorphism and cytogenetical data indicated that ‘Giza 843‘ tolerated Al more than ‘Nobaria 3’ . 5 REFERENCES Abdelhamid M. T., Shokr M. M. B. & Bekheta M. A. (2010). Growth, root characteristics, and leaf nutrients accumula- tion of four faba bean (Vicia faba L.) cultivars differing in their broomrape tolerance and the soil properties in rela- tion to salinity. Communication Soil Science of Plant Analy- sis, 41, 2713–2728. https://doi.org/10.1080/00103624.2010 .518263 Abdel-Razzak H. S., Alfrmawy A. M., Ibrahim H. M. & El- Hanafy A. A. (2012). Genetic diversity in faba bean (Vicia faba L.) using Inter-Simple Sequence Repeat (ISSR) mark- ers and protein analysis. Life Science Journal, 9, 497-503. Achary V. M. M. & Panda B. B. (2010). Aluminium-induced DNA damage and adaptive response to genotoxic stress in plant cells are mediated through reactive oxygen intermedi- ates. Mutagenesis, 25(2), 201-209. https://doi.org/10.1093/ mutage/gep063 Altwaty N. H., El-Sayed O. E., Aly N. A. H., Baeshen M. N. & Baeshen N. A. (2016). Molecular and cytogenetic as- sessment of Dipterygium glaucum genotoxicity. Anais da Academia Brasileira de Ciências, 88, 623–634. https://doi. org/10.1590/0001-3765201620150208 Aroca, R.; Porcel, R. & Ruiz-Lozano, J. M. (2007). How does arbuscular mycorrhizal symbiosis regulate root hydraulic properties and plasma membrane aquaporins in Phaseo- lus vulgaris under drought, cold or salinity stresses? New Phytolologist, 173, 808–816. https://doi.org/10.1111/j.1469- 8137.2006.01961.x Begum K. N. & Alam S. S. (2017). Karyotype, RAPD and ISSR analysis of four specimens in Gynura nepalensis DC. Cy- Acta agriculturae Slovenica, 116/2 – 2020 284 A. M. HASSANEIN et al. tologia, 82(4), 423–428. https://doi.org/10.1508/cytolo- gia.82.423 Belachew, K.Y . & Stoddard, F. L. (2017). Screening of faba bean (Vicia faba L.) accessions to acidity and aluminium stresses. PeerJ. 5, e2963. https://doi.org/10.7717/peerj.2963 Bennet R. J. & Breen CM (1991). The aluminium signal: New dimensions to mechanisms of aluminium tolerance. Plant Soil, 134, 153–166. https://doi.org/10.1007/BF00010728 Darlington C. D. & La Cour L. F. (1976). The handling of chro- mosomes, 6th ed. George Allen and Unwin Ltd., London. De Campos J. M. S. & Viccini L. F. (2003) Cytotoxicity of alu- minum on meristematic cells of Zea mays and Allium cepa. Caryologia, 56, 65–73. https://doi.org/10.1080/00087114.2 003.10589309 Domingues A. M., da Silva F ., Freitas G., Ganança G. F ., Nóbre- ga H., Slaski J. J. & de Carvalho M. A. P . (2013). Aluminium tolerance in bean traditional cultivars from Madeira. Re- vista de Ciências Agrárias, 36(2), 148-156. Duc G, Bao SY, Baum M & Redden B. (2010). Diversity main- tenance and use of Vicia faba L. genetic resources. Field Crops Research, 115, 270-278. https://doi.org/10.1016/j. fcr.2008.10.003 Fenech M. (2008). The micronucleus assay determination of chromosomal level DNA damage. Methods of Molecular Bi- ology, 410, 185-216. https://doi.org/10.1007/978-1-59745- 548-0_12 Gopalan, H.N.B. 1999. Ecosystem health and human wellbe- ing: the mission of the International Program on Plant Bioassays. Mutation Research, 426, 99–102. https://doi. org/10.1016/S0027-5107(99)00048-2 Hartig K. & Beck E. (2006). Crosstalk between auxin, cyto- kinins, and sugars in the plant cell cycle. Plant Biology, 8, 389–396. https://doi.org/10.1055/s-2006-923797 Hassanein A. M., Salem J. M., Faheed F. A. & El-nagish A. (2018). Effect of anti-ethylene compounds on isoenzyme patterns and genome stability during long term culture of Moringa oleifera. Plant Cell Tissue Organ Culture, 132, 201– 212. https://doi.org/10.1007/s11240-017-1326-0 Hossain, A., Afroz, M., Sultana, S. S. & Alam S.S. (2017). Karyotype and RAPD Diversity in Four Varieties of Gos- sypium hirsutum L. Cytologia, 82(5), 535–541. https://doi. org/10.1508/cytologia.82.535 Kanaya N. 1., Gill B. S., Grover I. S., Murin A., Osiecka R., Sand- hu S. S. & Andersson H. C. (1994). Vicia faba chromosomal aberration assay. Mutation Research, 310(2), 231-247. htt- ps://doi.org/10.1016/0027-5107(94)90116-3 Karimaei M. & Poozesh V . (2016). Effects of aluminum toxicity on plant height, total chlorophyll (Chl a+b), potassium and calcium contents in spinach (Spinacia oleracea L.). Interna- tional Journal of Farming and Allied Sciences, 5(2), 76-82. Kotelnikova A., Fastovets I., Rogova O., V olkov D. S. & Stolbova V . (2019). Toxicity assay of lanthanum and cerium in solu- tions and soil. Ecotoxicology and Environmental Safety, 167, 20-28. https://doi.org/10.1016/j.ecoenv.2018.09.117 Kumar G. & Rai P . (2006). Partial genome elimination through micronuclei in soybean (Glycine max). National Academy Science Letters, 29, 417–421. Legendre L. & Legendre P . (1983). Numerical ecology: develop- ments in environmental modelling. Amsterdam, The Neth- erlands, pp 419. https://doi.org/10.1007/978-3-642-69024- 2_56 Link W ., Dexkins C.,, 3. Elsevier, Singh M., Schwall M. & Melschinmer A. E. (1995). Genetic di- versity in European and Mediterranean faba beans germ- plasm revealed by RAPD markers. Theoretical and Applied Genetics, 90, 27-32. https://doi.org/10.1007/BF00220992 Llugany M., Poschenrieder C. & Barcelo J. (1995). Monitor- ing of aluminium-induced inhibition of root elongation in four maize cultivars differing in tolerance to aluminium and proton toxicity. Physiologia Plantarum, 93, 265–271. https://doi.org/10.1111/j.1399-3054.1995.tb02227.x Matsumoto H., Hirasawa E., Torikai H. & Takahashi E. (1976). Localization of absorbed Al in pea root and its binding to nucleic acids. Plant and Cell Physiology, 17(1),127-137. htt- ps://doi.org/10.1093/oxfordjournals.pcp.a075252 May H. M. & Nordstrom D. K. (1991). Assessing the solubili- ties and reaction kinetics of aluminous minerals in soils. In: Soil acidity. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 125–148. https://doi.org/10.1007/978-3-642-74442-6_6 Mohandas T. & Grant W . F. (1972). Cytogenetic effects of 2,4-d and amitrole in relation to nuclear volume and DNA con- tent in some higher plants. Canadian Journal of Genetics and Cytology, 14(4), 773-783. https://doi.org/10.1139/g72- 095 Mohanty S., Das A., Das P . & Mohanty P . (2004). Effect of a low dose of aluminum on mitotic and meiotic activity, 4C DNA content, and pollen sterility in rice, Oryza sativa L. cv. Lalat. Ecotoxicology and Environmental Safety, 59, 70–75. https:// doi.org/10.1016/j.ecoenv.2003.07.017 Muktadir M. A., Adhikari K. N., Merchant A., Belachew K.Y., Vandenberg A., Stoddard F. L. & Khazaei H. (2020). Physi- ological and Biochemical Basis of Faba Bean Breeding for Drought Adaptation. Agronomy, 10, 1345; https://doi. org/10.3390/agronomy10091345 Porebski S., Bailey L. G. & Baum B. R. (1997). Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components.  Plant Mo- lecular Biology Reports, 15, 8–15. https://doi.org/10.1007/ BF02772108 Rengel Z. (1996). Uptake of aluminium by plant cells. New Phytologist, 134, 389–406. https://doi. org/10.1111/j.1469-8137.1996.tb04356.x Richard S. & Peter H. (2007). Community Analysis Package 4.0. Searching for structure in community data. Printed in Lymington, UK. Rost T. L. & Morrison S. L. (1984). The comparative cell cycle and metabolic effects of chemical treatments on root tips meristems. II. Propham, chloropropham and 2,4-dinito- phenol. Cytologia, 49, 61-72. https://doi.org/10.1508/cyto- logia.49.61 Rout G. R., Samantaray S. & Das P. (2001). Aluminium tox- icity in plants: a review. Agronomie, 21, 3–21. https://doi. org/10.1051/agro:2001105 Ryan P ., Ditomaso J. M. & Kochian V . (1993). Aluminium tox- icity in roots: an investigation of spatial sensitivity and the role of the root cap. Journal of Experimental Botany, 44 (2), 437–446. https://doi.org/10.1093/jxb/44.2.437 Salem J. & Hassanein A. M. (2017). In vitro propagation, mi- Acta agriculturae Slovenica, 116/2 – 2020 285 Cytogenetic and molecular studies on two faba bean cultivars revealed their difference in their aluminum tolerance crotuberization, and molecular characterization of three potato cultivars. Biologia Plantarum, 61, 427–437. https:// doi.org/10.1007/s10535-017-0715-x Sivaguru M. & Horst W. J. (1998). The distal part of the tran- sition zone is the most aluminum-sensitive apical root zone of maize. Plant Physiology, 116, 155–163. https://doi. org/10.1104/pp.116.1.155 Souguir D, Ferjani E, Ledoigt G, Goupil P (2011) Sequential effects of cadmium on genotoxicity and lipoperoxidation in Vicia faba roots. Ecotoxicology, 20, 329–336. https://doi. org/10.1007/s10646-010-0582-0 Suso M. J., Gilsanz S., Duc G., Marget P . & Moreno M. T . (2006). Germplasm management of faba bean (Vicia faba L.): Mon- itoring intercrossing between accessions with inter-plot barriers. Genetic Resources and Crop Evolution, 53, 1427- 1437. https://doi.org/10.1007/s10722-005-6844-7 Taspinar M. S., Aydin M., Sigmaz B., Yagci S., Arslan E. & Guleray Agar G. (2018). Aluminum-Induced Changes on DNA Damage, DNA Methylation and LTR Retrotranspo- son Polymorphism in Maize. Arab Journal of Science and Engineering. 43:123–131. https://doi.org/10.1007/s13369- 017-2697-6 Thawornwong N. & Van Diest A. (1974). Influences of high acidity and aluminum on the growth of lowland rice. Plant and Soil, 41 (1), 141–159. https://doi.org/10.1007/ BF00017951 Van’t Hoff J. (1985). Control points within cell cycle. In: The cell division cycle in plants. Edited by: J.A. Bryant and Francis, D. SEB Seminar series 26. Cambridge University Press. Pp 1-13. Yi M., Yi H., Li H. & Wu L. (2010). Aluminum induces chromo- some aberrations, micronuclei, and cell cycle dysfunction in root cells of Vicia faba. Environmental Toxicology, 25, 124–129. https://doi.org/10.1002/tox.20482 Zhang H. M., Zhang S. S., Meng Q. M., Zou J., Jiang W. S. & Liu D. H. (2009.) Effects of aluminum on nucleoli in root tip cells, root growth and the antioxidant defense system in Vicia faba L. ACTA BIOLOGICA CRACOVIENSIA Series Botanica, 51(2), 99-10.