THE SCIENTIFIC JOURNAL OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK S lo v Ve t R es 2 0 21 ; 5 8 (1 ): 1 – 4 1 Slov Vet Res • Ljubljana • 2021 • Volume 58 • Number 1 • 1 – 41158 Volume THE SCIENTIFIC JOURNAL OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK 158 Volume Slov Vet Res • Ljubljana • 2021 • Volume 58 • Number 1 • 1 – 41 The Scientific Journal of the Veterinary Faculty University of Ljubljana SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK Previously: RESEARCH REPORTS OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA Prej: ZBORNIK VETERINARSKE FAKULTETE UNIVERZA V LJUBLJANI 4 issues per year / izhaja štirikrat letno Editor in Chief / glavni in odgovorni urednik: Gregor Majdič Co-Editor / sourednik: Modest Vengušt Technical Editor / tehnični urednik: Matjaž Uršič Assistants to Editor / pomočnici urednika: Valentina Kubale Dvojmoč, Klementina Fon Tacer Editorial Board / uredniški odbor: Vesna Cerkvenik, Robert Frangež, Polona Juntes, Tina Kotnik, Matjaž Ocepek, Ožbalt Podpečan, Ivan Toplak, Milka Vrecl, Veterinar y Faculty University of Ljubljana / Veterinarska fakulteta Univerze v Ljubljani ; Simon Hor vat, Janez Salobir, Biotechnical Faculty University of Ljubljana / Biotehniška fakulteta Univerze v Ljubljani; Andraž Stožer, Faculty of Medicine University of Maribor / Medicinska fakulteta Univerze v Mariboru Editorial Advisers / svetovalca uredniškega odbora: Gita Grecs-Smole for Bibliography (bibliotekarka), Leon Ščuka for Statistics (za statistiko) Reviewing Editorial Board / ocenjevalni uredniški odbor: Antonio Cruz, Institute Suisse du Medicine Equine (ISME), Vetsuisse Fakultat, University of Bern, Switzerland; Gerry M. Dorrestein, Dutch Research Institute for Birds and Exotic Animals, Veldhoven, The Netherlands; Sara Galac, Utrecht University, The Netherlands; Wolfgang Henninger, Veterinärmedizinische Universität Wien, Austria; Nevenka Kožuh Eržen, Krka, d.d., Novo mesto, Slovenia; Louis Lefaucheur, INRA, Rennes, France; Peter O’Shaughnessy, Institute of Comparative Medicine, Faculty of Veterinary Medicine, University of Glasgow, Scotland, UK; Peter Popelka, University of Veterinary Medicine, Košice, Slovakia; Dethlef Rath, Institut für Tierzucht, Forschungsbericht Biotechnologie, Bundesforschungsanstalt für Landwirtschaft (FAL), Neustadt, Germany; Phil Rogers, Grange Research Centre, Dunsany, Co. Meath, Ireland, Ireland; Alex Seguino, University of Edinburgh, Scotland, UK; Henry Staempfli, Large Animal Medicine, Department of Clinical Studies, Ontario Veterinary College, Guelph, Ontario, Canada; Frank J. M. Verstraete, University of California Davis, Davis, California, US; Thomas Wittek, Veterinärmedizinische Universität, Wien, Austria Address: Veterinary Faculty, Gerbičeva 60, 1000 Ljubljana, Slovenia Naslov: Veterinarska fakulteta, Gerbičeva 60, 1000 Ljubljana, Slovenija Tel.: +386 (0)1 47 79 100, Fax: +386 (0)1 28 32 243 E-mail: slovetres@vf.uni-lj.si Sponsored by the Slovenian Research Agency Sofinancira: Javna agencija za raziskovalno dejavnost Republike Slovenije ISSN 1580-4003 Printed by/tisk: DZS, d.d., Ljubljana, March 2021 Indexed in/indeksirano v: Agris, Biomedicina Slovenica, CAB Abstracts, IVSI Urlich’s International Periodicals Directory, Science Citation Index Expanded, Journal Citation Reports – Science Edition https://www.slovetres.si/ SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK Slov Vet Res 2021; 58 (1) Original Research Articles Kirkiłło-Stacewicz K, Nowicki W, Wach J. Telencephalon vascularity in dog (Canis lupus f. familiaris) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Arshed M, Nasir S, Hussain T, Babar MI, Imran M. Comparison efficacy of synthetic chemicals and . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . plant extracts for tick control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .13 Wimalasena S H M P, Heo G-J. The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species isolated from pet turtles and their environment . . . . . . . . . . . . . . . . . . . . . . . .25 Case Report Pavlin D, Nemec A, Lampreht Tratar U, Čemazar M, Brožič A, Serša G, Tozon N. Palliative jaw-sparing treatment of a non- resectable canine oral fibrosarcoma using combination of electrochemotherapy with bleomycin and IL-12 gene electrotransfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..35 Received: 28 March 2018 Accepted for publication: 28 April 2020 Slov Vet Res 2021: 58 (1): 5 –11 DOI 10.26873/SVR-957-2020 UDC 611.813:611.1:612.13:636.7 Original Research Article Introduction A review of the literature shows that the basic morphological publications in the field of vascularization of the brain were provided by Hofman (1) and Jenke (2), where one may find the first information on the construction of the middle cerebral artery in the dog. More information about the construction of the middle cerebral artery and its branches in the dog are found in the publication of Hebermehl (3). The author dealt with the construction of the artery only and discussed the topography of its branches on the surface of the TELENCEPHALON VASCULARITY IN DOG (Canis lupus f. familiaris) Krzysztof Kirkiłło-Stacewicz*, Włodzimierz Nowicki, Jan Wach UTP University of Science and Technology, Faculty of Animal Breeding and Biology, Department of Physiology, Zoophysiotherapy and Animal Feeding, Mazowiecka 28, 85-084 Bydgoszcz, Poland *Corresponding author, E-mail: krzysztof.stacewicz@o2.pl Abstract: The studies of the vascularization of the cerebrum in dog were performed on 80 cerebral hemispheres. It was found that the middle cerebral artery is the strongest vessel supplying blood to the cerebrum. The artery gets divided into ten perma- nent branches. Two olfactory arteries supply the region of the cerebrum located on the border between the old and the new cortex. The other eight supply the region of the new cortex: three branches aiming at the frontal lobe, two branches at the pari- etal lobe and three temporal branches aiming at temporal area. The frontal, parietal and temporal branches descended inde- pendently from the main trunk of the middle cerebral artery or formed a common trunk. Common trunks for respective groups of branches have been described as the rostral, dorsal and caudal middle cerebral artery. In 2.5% of cases there were two inde- pendent branches of the middle cerebral artery extending from the rostral cerebral artery. Key words: brain arteries; dog; vascularity; variability telencephalon, ignoring its variability. The literature concerning the blood supply to the brain describes the dog (4,5). These authors mention that the middle cerebral artery is one of the vessels departing from the arterial circle of the brain. In other predatory species similar studies were carried out in the cat (6), in the raccoon dog (7). In the literature, there are publications outlining in detail the cortical branches of the middle cerebral artery. This problem was described by Chadzypanagiotis in cat (8), the author gives nomenclature for individual cortical branches of the artery. Structured descriptions of the construction and the course of the cortical branches of the middle cerebral artery in some predatory species were presented by Wiland (9). In recent years there have been numerous studies K. Kirkiłło-Stacewicz, W. Nowicki, J. Wach6 that discuss the construction of the middle cerebral artery in various mammalian species. This applies to vessels which isolate as a single branch, for example, in red squirrel (10), in ground squirrel (11), in otter (12) and multiple arteries presented in domestic pig (13). These publications stated that cortical branches of the middle cerebral artery in examined species attained the same areas of the telencephalon. The differences occur in the pattern of descent and division of respective cortical branches of the middle cerebral artery. The pattern of division of the middle cerebral artery is affected by how the species has been classified and the pattern of groove-coverage of the cortex. In mammals on the surface of the cortex there is a different pattern of sulci, which can affect the structure of the cortical branches of the middle cerebral artery (14). In vast literature there seem to be missing a paper on the cortical branches of the middle cerebral artery in dog. Considering the discrepancy resulting from respective descriptions and considering new studies, one has decided to investigate the pattern, the division and variation of cortical branches of the middle cerebral artery in dog and to compare the results with the data reported by other authors. Materials and methods The research was performed on 40 brains in dog, namely a total of 80 cerebral hemispheres received from animal shelters in Bydgoszcz. Ethics approval was not required since animals died because of natural reasons. The animal heads were cut off at the height of the 3rd – 4th cervical vertebrae. The arteries were filled with latex introduced with medical syringe into the common carotid artery. This method was described by Godynicki (15). The heads were fixed in a 5% formalin solution for 3 months, and then decalcified in hydrochloric acid, the skull cavity was opened and brains were taken out. The cerebral hemispheres were photographed and the following were being described: the anatomy, the division pattern and the course of cortical branches of the middle cerebral artery. Results In dog the blood is supplied to the brain with internal carotid arteries (Fig. 1-a) and vertebral arteries. Figure 1: Diagram of the division of the middle cerebral artery on the surface of the cortex in dog 1 – rostral olfactory artery, 2 – caudal olfactory artery, 3 – orbital branch, 4 – inferior frontal branch, 5 – dorsal frontal branch, 6 – rostral parietal branch, 7 – caudal parietal branch, 8 – dorsal temporal branch, 9 – middle temporal branch, 10 – ventral temporal branch, a – internal carotid artery, b – rostral cerebral artery, c- caudal communicating artery, d – Sylvian fissure, e – Presylvian sulcus, f – rostral lateral olfactory sulcus, g – caudal lateral olfactory sulcus, h – rostral Suprasylvian sulcus, i – middle Suprasylvian sulcus, j – caudal Suprasylvian sulcus, k – caudal external Sylvian sulcus, l – middle external Sylvian sulcus, m – coronary sulcus, n – marginal sulcus, o – external marginal sulcus. Telencephalon vascularity in dog (Canis lupus f. familiaris) 7 The internal carotid artery, having entered the skull cavity and penetrated the dura mater, bifurcates into the rostral cerebral artery (Fig. 1-b) and caudal communicating artery (Fig. 1-c) which, together with their symmetrical vessels form an arterial circle of the brain. From the initial section of the rostral cerebral artery towards the cortex there separates the middle cerebral artery. The middle cerebral artery is the strongest vessel supplying blood to the cerebrum. The initial section of the main trunk of the middle cerebral artery goes along the dorsal surface of the optic tract. Then the section gets bended around the piriform lobe and goes through its rostral margin. Further on it runs to the lateral olfactory sulcus and, having passed it, it gets divided. From the initial section of the main trunk of the middle cerebral artery there descend minor central branches supplying blood to olfactory tracts and the piriform lobe. The main trunk of the middle cerebral artery gets divided into a number of cortical branches which run to the specific region of the cerebral hemisphere, supplying blood to specific regions of the brain. The first permanent branches of the middle cerebral artery which supply both the old and the new cortex are olfactory arteries. The rostral olfactory artery (Fig. 1-1), having separated from the main trunk of the middle cerebral artery it creates an arch and runs to the rostral part of the lateral olfactory sulcus it can ascend into in various places. Its terminal branches can also appear again from under the lateral olfactory sulcus and then ascend under the cortex surface. The caudal olfactory artery (Fig. 1-2) ascends into the caudal part of the lateral olfactory sulcus and its terminal branches supply the area of the cortex found under the sulcus. The other branches of the middle cerebral artery supply the areas of the cortex over the lateral olfactory sulcus. On the cortex towards the frontal lobe there spread three thick branches. As the first one there separates the orbital branch (Fig. 1-3) which is located lowest and it goes towards the region of the Presylvian sulcus where its terminal branches reach the coronary sulcus. The ventral frontal branch (Fig. 1-4) vascularizes the middle part of the frontal lobe. The vessel goes through the rostral external Sylvian sulcus and the rostral Suprasylvian sulcus towards the coronary sulcus it passes towards the fornix. The dorsal frontal branch (Fig. 1-5), having separated from the middle cerebral artery at the height of the rostral external Sylvian sulcus, goes up to the region of the cruciate sulcus. The vessel supplies blood to the upper part of the medial surface of the frontal lobe. The next vessel which runs towards the parietal lobe bifurcates into two branches. The rostral parietal branch (Fig. 1-6) runs towards the middle external Sylvian sulcus to the marginal sulcus. The terminal twigs of that vessel supply blood to the area of the cortex found under the ansiform sulcus. The caudal parietal branch (Fig. 1-7) also runs to the region of the marginal sulcus and further on it branches out into smaller vessels. Some of them ascend into the medial Suprasylvian sulcus. The lateral-caudal surface of the cerebral hemisphere is supplied by the branches of the middle cerebral artery which descend from at various heights and they are referred to as temporal branches. The dorsal temporal branch (Fig. 1-8) having left the Sylvian fissure, it runs towards the middle Suprasylvian sulcus and further to the upper margin of the cerebral hemisphere. It is uasually the strongest cortical branch of the middle cerebral artery. The branch supplies blood to the upper part of the cortex. The middle temporal branch (Fig. 1-9) descends a small distance away from the previous branch. The branches of that vessel spread towards the external marginal sulcus. Its terminal branches go onto the surface of the occipital lobe. The ventral temporal branch (Fig. 1-10) runs to the end of the caudal external Sylvian sulcus. Having passed the caudal part of the sulcus, its branches spread towards the caudal Suprasylvian sulcus. Its terminal branches take part in the supply of a part of the occipital lobe. Considering the general pattern of the spread the cortical branches of the middle cerebral artery in dog, one shall note that respective sections of those branches can run inside respective sulci and divide, always running towards the cortex areas described. Analysing the pattern of descent of the cortical branches of the middle cerebral artery in the dog, it was found that from the rostral cerebral artery on 78 (97,5%) cerebral hemispheres there descended a single independent vessel - the middle cerebral artery. Among them on 8 (10%) hemispheres from the main trunk there descended rostrally with a K. Kirkiłło-Stacewicz, W. Nowicki, J. Wach8 common trunk: the orbital branch, the ventral frontal branch and the rostral olfactory artery. The main trunk of the middle cerebral artery, got onto the surface of the cerebral cortex and formed a common descent for the dorsal frontal branch as well as rostral and caudal parietal branches. Caudally from the main trunk of the middle cerebral artery, with a common trunk there separated the dorsal, middle and ventral temporal branches and the independent caudal olfactory artery. (Fig. 1). In another 12 (15%) cases there descended rostrally an independent rostral olfactory artery and a common trunk for the orbital, rostral and dorsal frontal branches. The main trunk got onto the surface of the cerebral cortex from the Sylvian fissure and formed a common descent for rostral and caudal parietal branches. Caudally from the main trunk of the middle cerebral artery, with a common trunk there separated the dorsal, middle and ventral temporal branches, whereas the caudal olfactory artery got separated independently from the main trunk of the middle cerebral artery. On another 12 (15%) hemispheres from the main trunk of the middle cerebral artery there separated rostrally a common trunk for the rostral olfactory artery and for the orbital branch as well as the common descent for the ventral and dorsal frontal branch. The main trunk separated caudally the caudal olfactory artery with a common descent with the ventral temporal branch. The main trunk, having ascended into the Sylvian fissure, on the surface of the cortex it showed a common trunk for rostral and caudal parietal branches as well as for the middle and dorsal temporal branches. On another 14 (17,5%) cerebral hemispheres from the main trunk of the middle cerebral artery departed the independent rostral olfactory artery and a common departure for the ventral and dorsal frontal branches. Caudally from the main trunk there descended the middle and ventral temporal branch through the common trunk with the caudal olfactory artery. The main trunk, having descended into the Sylvian fissure, got onto the surface of the cortex with a common descent for rostral and caudal parietal branches as well as the rostral and dorsal temporal branch. On another 12 (15%) hemispheres from the main trunk the following separated rostrally with a common trunk: the rostral olfactory artery, common trunk for the orbital branch, the ventral frontal branch. The caudal branch was a common descent for the ventral temporal branch and the caudal olfactory artery. The main trunk, having descended into the Sylvian fissure, got onto the surface of the cortex with a common descent for the dorsal frontal branch, rostral and caudal parietal branches as well as the middle and dorsal temporal branch. On yet another 6 (7,5%) cerebral hemispheres from the main trunk rostrally there separated, with a common descent, the orbital branch, the ventral and dorsal frontal branch and the rostral olfactory artery. Caudally from the main trunk of the middle cerebral artery the following separated with a common descent: rostral and caudal parietal branches as well as the ventral, middle and dorsal temporal branches. The caudal olfactory artery departed independently from the main trunk. On another 14 (17,5%) cerebral hemispheres from the main trunk of the middle cerebral artery the following departed rostrally with the common trunk: the orbital branch, the ventral frontal branch and the rostral olfactory artery. Caudally from the main trunk of the middle cerebral artery there descended with the common descent: the dorsal frontal branch, the rostral and caudal parietal branches and the dorsal, middle and ventral temporal branches. The caudal olfactory artery departed independently from the main trunk. On the other 6 (7,5%) hemispheres it was found that from the main trunk of the middle cerebral artery there departed the common trunk for the rostral olfactory artery and the orbital branch, then the common descent for the ventral and dorsal frontal branch. The main trunk got onto the surface of the cortex with a common descent for rostral and caudal parietal branches as well as the dorsal, middle and ventral temporal branch. The caudal olfactory artery departed caudally from the main trunk of the middle cerebral artery as an independent vessel. On the other 2 (2,5%) hemispheres it was found that from the rostral cerebral artery in dog there bifurcated two independent branches of the middle cerebral artery. Among them the first independent branch from the rostral cerebral artery was the rostral olfactory artery, while the second branch was the main trunk of the middle cerebral artery from which there descended rostrally independently: the orbital branch, the ventral and dorsal frontal branch. Caudally from the main trunk there separated an independent caudal olfactory artery and the ventral temporal branch. The main trunk, having descended into the Sylvian fissure, got onto Telencephalon vascularity in dog (Canis lupus f. familiaris) 9 the surface of the cortex with a common descent for rostral and caudal parietal branches as well as the common trunk for dorsal and middle temporal branch (Fig.2). On the other 2 (2,5%) hemispheres it was found that from the rostral cerebral artery in dog there bifurcated two independent branches of the middle cerebral artery. Among them the first independent branch from the rostral cerebral artery was the rostral olfactory artery, while the second branch was the main trunk of the middle cerebral artery from which there descended rostrally independently: the orbital branch, the ventral and dorsal frontal branch. Caudally from the main trunk there separated an independent caudal olfactory artery and the ventral temporal branch. The main trunk, having descended into the Sylvian fissure, got onto the surface of the cortex with a common descent for rostral and caudal parietal branches as well as the common trunk for dorsal and middle temporal branch (Fig.2). Discussion The middle cerebral artery supplies blood to the greatest region of the cerebrum and is the most shaped branch extending from the rostral cerebral 1 - rostral olfactory artery, 2 - caudal olfactory artery, 3 - orbital branch, 4 - ventral frontal branch, 5 - dorsal fron- tal branch, 6 - rostral parietal branch, 7 - caudal parietal branch, 8 - dorsal temporal branch, 9- middle temporal branch, 10 - ventral temporal branch. Figure 2: Independent departure of the anterior olfactory artery and the main trunk of the middle cerebral artery from the rostral cerebral artery artery. In dog the middle cerebral artery supplies the same areas of the brain as in the mammalian species studied so far. The discrepancies concern mostly its division into respective branches. Chadzypanagiotis (8), describing the cortical branches in cat, differentiated between the branches supplying the old cortex, the branches on the border of the old and the new cortex as well as the branches for the new cortex. In dog the arteries supplying the old cortex are minor branches onto the piriform lobe and olfactory tracts. On the border of the old and the new cortex there are found the rostral and caudal olfactory arteries. In dog the rostral olfactory artery in 2.5% of the cases was a vessel which descended independently from the rostral cerebral artery. On the other cerebral hemispheres it was a vessel which got separated independently from the main trunk of the middle cerebral artery in 32.5% of the cases. In 22.5% of the cases it formed a common departure with the orbital branch. On the 35% of the cerebral hemispheres it was one of the branches descending from the common trunk of the middle cerebral artery which gave rise to the orbital branch and the ventral frontal branch. In the other 7.5% cases the rostral olfactory artery demonstrated a common descent with the orbital, ventral and dorsal frontal branches. K. Kirkiłło-Stacewicz, W. Nowicki, J. Wach10 The caudal olfactory artery, on the other hand, in 45% of the cases was a vessel which descended independently from the rostral cerebral artery. On 37.5% the caudal olfactory artery separated with a common descent with the ventral temporal branch. In the other 17.5% hemispheres the caudal olfactory artery was one of the branches of a common trunk for ventral temporal branch. In another 20% of the cases it was one of the branches of the common trunk for the ventral and middle temporal branches. The other cortical branches of the middle cerebral artery can be divided into a group of frontal, parietal and temporal branches. In dog, similarly as in other Carnivora species there occur eight main vessels which supply blood to the area of the new cortex of the cerebrum. Besides, respective cortical branches can de- scend from the main trunk of the middle cerebral artery with a common descent. Such cases of de- scent were reported by Wiland (9), Skoczylas et al. (12) as the rostral, dorsal and caudal middle cerebral artery. In dog the rostral middle cerebral artery has been presented as a common trunk for frontal branches and it occurred in 32.5% of the cases investigated, the dorsal middle cerebral ar- tery was described as a common trunk for pari- etal branches, which was observed in 17.5% of the cases. The caudal middle cerebral artery as a common trunk for temporal branches was found in 25% of the cases. In dog the dorsal middle cerebral artery occurred as the lowest percentage of the cases, however, here the rostral middle cerebral artery dominated. Making a comparison of the present results with those reported by Wiland (9) in American mink, and by Skoczylas et al. (12) in otter one can state the dorsal middle cerebral artery was reported as the lowest percentage of the cases. In dog, similarly as in the other animal species studied, the parietal branches have developed poorest. On the surface of the cerebrum the best developed are the frontal branches of the middle cerebral artery. From the description of the structure of the middle cerebral artery in the publications by Aydin et al. (11), Ozudogru et al. (16), Skoczylas et al. (12) in the ground squirrel, common fox and otter one can see that it is usually a single vessel descending from the rostral cerebral artery. The vessel, having passed the lateral olfactory sulcus, gets divided along its course into respective cortical branches. In the material investigated such a pattern of division of the middle cerebral artery was found in 97.5% of the cases. In dog there were identified the cases of descent from the rostral cerebral artery of two independent arterial trunks in 2.5% of the cases. The second independent branch from the rostral cerebral artery was the rostral olfactory artery. In other mammalian species the presence of two independent descents of the branches of the middle cerebral artery was found in rabbit in 31.4% (17), in wild rabbit (18) in 36.5% of the cases, in raccoon dog (7) in 18.6% of the cases. The present research show that observed in dog the division of the middle cerebral artery into the same branches or their groups, like in the other mammalian species investigated so far is, according to Wiland (19), a result of genetic limitations. References 1. Hofmann M. Zur vergleichenden Anatomie der Gehirn und Ruckenmarksarterien der Verte- braten. Zeitschr Morphol Anthrop 1900; 2: 247– 320. 2. Jenke TW. Die Gehirnarterien des Pferdes, Hundes, Rindes und Schweines verglichen mit denen des Menschen : Diss. Dresden, 1919. 3. Hebermehl KH. Zur Topographie der Ge- hirngeafasse des Hundes. Anat Histol Embryol 1973; 2: 327–53. 4. Wiland C. Variations of the basilar arteries of the brain in dogs. Folia Morphol Wars 1973; 32: 63–70. 5. Tanuma K. A morphological study on the cirle of Willis in the dog. Okajimas Folia Anat Japon 1981; 58: 151–76. 6. Chadzypanagiotis D, Kubasik A. The arteries supplying blood to the brain of a cat. Folia Morphol Wars 1968; 27: 477–87. 7. Brudnicki W, Wiland C, Jabłoński R. Basilar arteries of the brain in raccoon dog (Nyctereutes procyonoides Gray). Arch Vet Pol 1994; 34(1/2): 141–7. 8. Chadzypanagiotis D. Arteries on the surface of the cerebral hemisphere in the cat. Folia Mor- phol Wars 1975; 32: 385–99. 9. Wiland C. Comparative studies of cortical branches of the middle cerebral artery in some predatory species (Carnivora). Sci J ATR Bydg 1991; 44: 1–52. Telencephalon vascularity in dog (Canis lupus f. familiaris) 11 10. Aydin A. The morphology of circulus arte- riosus cerebri in the red squirrel (Sciurus vulgaris). Vet Med 2008; 53(5): 272–6. 11. Aydin A, Ozkan ZE, Yilmaz S, et al. The mor- phology of the circulus arteriosus cerebri in the ground squirrel (Spermophilus citellus). Vet Med 2009; 54(11): 537–42. 12. Skoczylas B, Brudnicki W, Nowicki W, et al. The cortical branches of the middle cerebral ar- tery in the otter (Lutra lutra). Vet Med 2012; 57(6): 282–6. 13. Skoczylas B. Cortical branches of middle cerebral artery in domestic pig (Sus scrofa f. do- mestica). Electron J Pol Agric Univ Vet Med 2000; 3: e1–6. 14. Brauer K, Schaber W. Katalog der sanget- iergehirne. Jena : Gustaw Fisher Verlag, 1970. 15. Godynicki S. Use of LBS 3060 Latex in an- atomic preparations. Folia Morphol Wars 1971; 30(4): 601–3. 16. Ozudogru Z, Can M, Balkaya H. Macro-an- atomical investigation of the cerebral arterial circle (circle of willis) in red fox (Vulpes vulpes Leunno- leus, 1758). J Anim Vet Adv 2012; 11(16): 2861–4. 17. Wiland C. Basilar arteries of the brain in the domestic rabbit. Folia Morphol 1968; 27: 288–95. 18. Brudnicki W, Nowicki W, Skoczylas B, et al. Arteries of the brain in wild European rabbit Oryctolagus cuniculus (Linnaeus, 1758). Folia Biol 2012; 60 (3/4): 189–94. 19. Wiland C. Factors affecting the variability of the brain base arteries in mammals. Zool Rev 1974; 18: 400–16. OŽILJENOST TELENCEFALONA PRI PSIH (Canis lupus f. familiaris) K. Kirkiłło-Stacewicz, W. Nowicki, J. Wach Izvleček: : Študije ožiljenosti možganov pri pseh so bile izvedene na 80 možganskih poloblah. Ugotovljeno je bilo, da je sred- nja možganska arterija najmočnejša žila, ki dovaja kri v možgane. Arterija se razdeli na deset stalnih vej. Dve vohalni arteriji napajata predel možganov, ki se nahaja na meji med staro in novo možgansko skorjo. Ostalih osem arterij oskrbuje področje nove skorje: tri veje, ki potekajo do prednjega režnja, dve veji, ki potekata v parietalni reženj in tri temporalne veje, usmerjene v temporalno področje. Čelne, parietalne in temporalne veje so se razvejale neodvisno od glavnega debla srednje možgan- ske arterije, ali pa so tvorile skupno deblo. Običajna debla za posamezne skupine vej so opisana kot rostralna, dorzalna in kavdalna srednja možganska arterija. V 2,5 odstotkih primerov sta obstajali dve neodvisni veji srednje možganske arterije, ki izhajata iz rostralne možganske arterije. Ključne besede: možganske arterije; pes; ožiljenost; raznolikost Slov Vet Res 2021: 58 (1): 13 – 23 Original Research Article DOI 10.26873/SVR-1052-2020 UDC 616.995.42:615.285:615.015.1 COMPARISON EFFICACY OF SYNTHETIC CHEMICALS AND PLANT EXTRACTS FOR TICK CONTROL Madiha Arshed1, Shabab Nasir2*, Tanveer Hussain1, Masroor Illahi Babar1, Muhammad Imran1 1Department of Biology, Virtual University, 44000, Lahore, 2 Department of Zoology, Government College University, 38040, Faisalabad, Pakistan *Corresponding author, E-mail: flourenceshabab@yahoo.com Abstract: Ticks are considered as harmful and economically important ectoparasites because their infestation seriously af- fects the cattle worldwide. Tick control with synthetic acaricides is not only dangerous for animal and human health but also causes environmental pollution. The present study was designed to evaluate the plant extracts in comparison with synthetic acaricides to control Hyalomma anatolicum. Five different concentrations (50, 100, 250, 500 and 750 ppm) of methanolic plant extracts and acaricides, were employed to evaluate the mortality of ticks after 2, 4, 6, 12, 24 and 48 hrs. Mortality data was an- alyzed through Probit analysis to calculate the median lethal concentration (LC 50 ) and the median lethal time (LT 50 ). Methan- olic extract from Azadirachta indica demonstrated the highest mortality (LC 50 = 38.3 ppm) of ticks as compared to Dalbergia sissoo (LC 50 = 58.76 ppm) and Morus alba (LC 50 = 92.95 ppm). Amongst acaricides, fipronil exhibited highest mortality (LC 50 = 35.01 ppm) when compared with emamectin (LC 50 = 46.87 ppm) and cypermethrin (LC 50 = 37.83 ppm). Higher concentration (750 ppm) of acaricides (fipronil, emamectin and cypermethrin) displayed quicker mortality (LT 50 = 6.53-8.95 hrs) as compare to the plant extracts (LT 50 = 8.49-29.17 hrs). Effects of these treatments were also studied on egg masses and reproductive in- dex (RI) of the surviving ticks. The results revealed a significant, concentration-dependent variation among the egg masses treated with plant extracts and acaricides; and subsequently, their reproductive index values also decreased significantly. Phytochemical analysis of the tested plant extracts revealed presence of flavonoids, steroids, terpenoids, saponins, tannins and phenols in variable quantities. Conclusively, our results describe a significant scope of environment friendly plant extracts for ticks’ management. Key words: plant extracts; synthetic acaricides; tick mortality Introduction Ticks are blood sucking ectoparasites that act as vectors of diseases like rickettsiosis, anaplasmosis, tularemiosis, babesiosis and theileriosis in meat and dairy animals (1,2). The ectoparasites harm the hosts both directly (blood loss and reduction in weight gain) and indirectly (act as vectors for a wide range of viral, bacterial and protozoan pathogens to humans and domestic animals) (3,4). Their infestation leads to weaken the animals with poor growth and result in substantial economic loss (5,6). An estimated loss of 14-19 billion USD per Received: 14 February 2020 Accepted for publication: 6 October 2020 year is reported because of tick borne diseases with a worldwide infection of 80% cattle population (7). The most important pathogen observed is Crimean Congo hemorrhagic fever virus usually associated with ticks of genus Hyalomma. Many outbreaks of this disease have been recorded from Pakistan (7). Various chemical acaricides (chlorinated hydro- carbons, synthetic pyrethroids, organophosphates, formamidines and macrocyclic lactones) are used by pest exterminators to control ticks. But many problems are associated with these acaricides such as acaricidal resistance in ticks and long residual effects in milk and meat that cause health hazards for human beings. These acaricides also contam- inate environment and water, so cause harmful effects to nontarget organisms (8). The chemical M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran14 pesticides are much expensive products and are concerned with ecological threats. So, pesticide us- age has forced scientists to find out less harmful and inexpensive chemicals. They have made great contributions to develop a substitute and found natural products as alternative source of synthetic acaricides (9). The naturally occurring plants are used as ethno-veterinary medicine. Botanical prod- ucts when applied show insufficient adverse effects on non-target organisms as well as on the environ- ment (10) as compared to the synthetic insecticides due to their low toxicity. Pesticidal products of plant origins have been found remarkably effective in the form of antifeedants, repellents, protectants and growth disrupting hormones as other biocides (11). Neem (Azadirachta indica) is extensively distributed in Africa, Asia and other tropical areas of the world. A variety of chemicals (azadirachtin, salannin, me- liantriol, nimocinolide, isonimocinolide and triter- penoids) are present in neem extract. The neem seed extract usage was recognized for poor farm- ers as a potential source to control ticks particu- larly in cattle (12). A. indica is effective to be used for tick control in both dry and humid areas (13). Dalbergia genus has 300 species of which almost 25 species exist in India. Many species of Dalber- gia are considered as vital timber trees, appreciated for their attractive and fragrant wood and are rich in aromatic oils (14). Bark of this tree is employed as antihelmintic, aphrodisiac, antipyretic, abor- tifacient, expectorant and is also used for treat- ment of blood diseases, dysentery and leukoderma, whereas seeds’ oil is employed to treat scabies and the leaves extract has analgesic, antihelmintic and antipyretic properties (15). Morus contains over 150 species and among these, Morus alba L. is dom- inant and indigenous to Pakistan, Nepal, India, China and Japan (16). It is widely cultivated all over the plains of both Pakistan and India, and also on the mountains of Himalaya up to 3,300 m altitude for the purpose of its foliage, as a source of food for silkworms. Its extract represented a strong activity against gram-negative, gram-positive bacteria and fungi due to high pesticidal activity (17). Many re- ports provide information of different plant extracts possessing pesticidal properties and thus could be used against ticks. Plant extracts carry phytochem- ical constituents that have potential to control ticks population as effectively and equally as synthetic acaricides. Besides these, plant products (botani- cal pesticides) are considered environment friendly, safe to non- target organisms, and are inexpensive to be used by livestock owners and farmers. So, the present study was carried out to compare the efficacy of some selected synthetic acaricides and plant extracts. Materials and methods Collection of plant materials Fresh leaves of Azadirachta indica, Dalbergia sissoo, and Morus alba were collected and identi- fied by a botanist. The collected leaves were was- hed thoroughly with tap water and dried under shade for a span of one month. The dried leaves were then chopped and ground to powder form using an electric grinder (Anex Germany, TS-639). Preparation of plants extract The plant extracts were prepared by dissolving 500 grams of powdered material of each selected plants individually in methanol in a beaker at room temperature. The beaker was covered with aluminium foil and stirred daily for seven days. Afterwards, the material was filtered by Whatman No.1 filter paper and the solvent (methanol) was evaporated in rotary evaporator for 30 minutes at 60 ºC. After evaporation, the material was placed overnight in the incubator set at 40 ºC to evaporate remaining methanol. Preparation of stock solution and dilutions Stock solutions of each plant extract was prepared by dissolving 0.5 mg of the extracted material in a few drops of Dimethyl sulfoxide (DMSO) and then topped up with saline to make solutions of 0.25 mg/ ml. The stock solution was then used for preparing different concentrations (50, 100, 250, 500 and 750 ppm) (5). Three different acaricides; emamectin (Tycon 1.9% EC, Four Brothers Group, Pakistan), fipronil (Regent 50 SC, Bayer Pakistan (Pvt.) Ltd.) and cypermethrin (Bulletin 10% EC, Ali Akbar Group, Pakistan) were purchased from the market and different concentrations (50, 100, 250, 500 and 750 ppm) were prepared for bioassay tests (18). Collection and storage of ticks The ticks were collected from rural area of Sa- mundri (31°03′45″N 72°57′15″E), district Faisal- Tick mortality through synthetic acaricides and plant extract 15 abad from buffaloes with forceps having gloves on hands. Ticks were stored in sterile glass bottle with muslin cloth on the top (2). Ticks were then shifted in the department of Zoology, Government College University, Faisalabad for identification (19) and rearing. Hyalomma anatolicum were reared on rabbits for bioassay tests (8). For reproductive index calculation, a total of 20 H. anatolicum were weighed individually after washing with distilled water and drying with filter paper, and were placed in glass tubes covered with muslin cloth. Each glass tube, containing a single mated female H. anatolicum was kept in an incubator set at 28 ºC and 90% RH for oviposition. After 20 days, the eggs laid within the first 3-4 days were counted, weighed and transferred into 5-ml sterile glass tubes for hatching under same conditions (28 ºC and 90% RH). After 25-27 days, the hatched larvae were counted again (20). Adult immersion test (Bioassay) Adult immersion test (AIT) was performed as per the protocol described by Drummond et al. (21). Five replicates of each treatment were used for bioassay tests with 20 ticks in each treatment. Ticks were immersed in the solution (10 ml) at room temperature for two minutes in a 25 ml beaker with gentle agitation. Water was used as control treatment and the treated ticks were recovered from the solution, dried with absorbent paper and were placed in separate plastic specimen tubes (25 mm×50 mm). These tubes were incubated at 28±1°C and 85±5 per cent relative humidity in a biological oxygen demand (BOD) incubator. Ticks treated with different concentrations of the plant extracts and commercial acaricides were compared with the control ticks and the mortality of ticks was observed after 2, 4, 6, 12, 24 and 48 hrs period. The glass tubes with survivors were placed in an incubator (28 ºC and 90% RH) to determine the reproductive index of the ticks. After 20 days, the eggs laid within the first 3-4 days were counted, weighed and transferred into 5-ml sterile glass tubes for hatching under same conditions (28 ºC and 90% RH). After 25-27 days, the hatched larvae were counted again (20). The reproductive index was calculated by following formula according to FAO guidelines, RI = (weight of eggs in milligrams/weight of female in milligrams) x % hatch Phytochemical analysis Phytochemical analysis of the three plant extracts viz., Azadirachta indica (Neem), Dalbergia sissoo (Sheesham) and Morus alba (White mulberry) was carried out for alkaloids, flavonoids, steroids, terpenoids, saponins, tannins and phenols by employing the methods as described by Rosenthaler (22). The powdered leaves were extracted using suitable solvent and necessary reagent added to the right quantity of the extract. Statistical Analysis The percent efficacy (mortality) was calculated by the formula explained by Holdsworth et al. (1); Efficacy (%) = N0 - N/ N0 * 100 Where, N0 is the number of ticks before treatment. N is the number of ticks after treatment. Mortality data was analyzed through ANOVA followed by the post-hoc Tukey’s test to significant factors and probit analysis was employed to calculate median lethal concentration (LC50) and median Lethal time (LT50) by using Minitab – 17 statistical software (23). Results The results of our bioassay experiments describe significant variation among the toxicity values (LC50) of plant extracts and chemical acaricides (non-overlapping confidence intervals) against H. anatolicum and are displayed in table 1. M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran16 Plants Time (hrs) LC50 (95.0% Fiducial Cl) SE χ2 (df=4) p-value Azadirachta indica 2 431.42(398.01–515.02) 0.909 2.123 0.000 4 320.75(299.19–438.02) 0.863 2.596 0.000 6 252.20(199.26–304.26) 0.727 5.477 0.000 12 128.55(80.25–192.80) 0.569 0.161 0.038 24 93.98(0.051–230.92) 0.567 0.235 0.068 48 38.30(0.39–94.08) 0.585 0.454 0.068 Dalbergia sissoo 2 492.5(385.24–552.5) 1.242 0.537 0.001 4 343.69(373.43–451.5) 1.168 0.772 0.000 6 293.80(170.32–352.5) 0.848 2.699 0.000 12 192.50(120.51–292.5) 0.590 0.201 0.010 24 164.68 (103.8–209.5) 0.565 0.202 0.098 48 58.76( 20.5–79.2) 0.565 0.184 0.218 Morus alba 2 501.50(402.79–592.2) 6.209 0.177 0.116 4 395.90 ( 299.8 – 435.2) 2.256 0.339 0.009 6 339.80(279.8–435.2) 0.909 2.123 0.000 12 230.94(192.8–301.5) 0.616 0.148 0.014 24 198.50 (113.5 – 259.5) 0.572 0.018 0.111 48 92.95( 25.60 –135.5) 0.561 0.020 0.260 Fipronil 2 289.12(201.78–368.51) 0.900 0.166 0.000 4 201.109(172.2–290.4) 0.637 0.150 0.008 6 131.68(82.01–159.02) 0.584 0.070 0.021 12 82.54(50.44–102.11) 0.569 0.299 0.024 24 38.30( 0.39–94.08) 0.585 0.454 0.068 48 35.01(10.84–59.02) 0.757 1.472 0.002 Emamectin 2 302.79(207.6–389.9) 0.888 0.061 0.001 4 231.78(190.76–298.5) 0.687 0.174 0.003 6 150.72(88.62–201.76) 0.599 0.293 0.007 12 98.12(50.71–150.45) 0.575 0.219 0.005 24 81.85(12.98–156.55) 0.576 0.031 0.011 48 46.87(17.73–75.60) 0.684 3.377 0.000 Cypermethrin 2 299.14(211.78–392.9) 1.242 0.537 0.001 4 219.80(162.8–307.57) 0.706 0.062 0.001 6 142.82(102.8–216.8) 0.607 0.077 0.008 12 95.74(49.9–122.54) 0.572 0.313 0.028 24 81.85(12.98–156.55) 0.568 0.544 0.088 48 37.83(06.14–74.15) 0.625 0.487 0.010 At minimum exposure time (2hrs), LC50 values of A. indica, D. sissoo and M. alba were 431.42, 492.50, 501.5 ppm and that of fipronil, emamectin and cypermethrin were 289.12, 302.79, 299.14 ppm while after maximum exposure time (48hrs), plant extracts showed 38.30, 58.76, 92.95 ppm and Table 1: LC50 of plant extracts and synthetic acaricides at different exposure periods against H. anatolicum synthetic acaricides showed 35.01, 46.87, 37.83 ppm respectively. The LC50 value 38.30 ppm shown by A. indica after exposure period of 48h was significantly very close to the LC50 values of synthetic acaricides that caused significant mortality of H. anatolicum as compared to D. sissoo and M. alba as shown in table 1. Tick mortality through synthetic acaricides and plant extract 17 Plants Concentration (ppm) LT50 (95.0% Fiducial Cl) SE χ 2 (df=4) p-value A. indica 50 32.31(21.57-63.99) 0.3022 3.644 0.000 100 19.71(12.92-38.10) 0.2489 0.920 0.001 250 16.20(10.61-29.69) 0.2416 0.657 0.000 500 10.91(7.36-16.85) 0.2378 0.602 0.000 750 8.49(5.76-12.30) 0.2365 0.308 0.001 D. sissoo 50 44.44(29.17-94.92) 0.3614 2.199 0.000 100 30.24(20.60- 56.25) 0.3000 0.815 0.0001 250 25.84(17.38-48.82) 0.2736 0.541 0.000 500 20.76(13.95-38.07) 0.2565 0.880 0.000 750 16.97(11.30-30.46) 0.2450 0.401 0.000 M. alba 50 49.50(32.67-106.49) 0.4119 3.019 0.000 100 44.44(29.17-94.92) 0.3614 2.199 0.000 250 38.90(25.73-80.23) 0.3312 2.210 0.000 500 34.85(22.58-75.00) 0.2950 0.923 0.000 750 29.17(18.88-61.94) 0.2721 0.733 0.000 Fipronil 50 22.43(15.67-38.15) 0.2767 1.522 0.0001 100 15.28(11.10-22.74) 0.2634 1.056 0.000 250 11.60(8.68-16.01) 0.2610 0.793 0.000 500 8.31(6.37-10.80) 0.2640 1.659 0.000 750 6.53(4.96-8.42) 0.2599 2.584 0.0001 Emamectin 50 31.01(20.56-62.13) 0.2901 1.546 0.000 100 21.27(14.82-36.10) 0.2694 0.375 0.000 250 14.03(10.19-20.65) 0.2581 0.302 0.0001 500 9.37(7.16-12.35) 0.2629 0.794 0.000 750 7.37(5.65-9.50) 0.2636 3.703 0.000 Cypermethrin 50 29.17(20.31-51.52) 0.3106 2.639 0.000 100 20.66(14.93-32.39) 0.2845 1.420 0.0001 250 15.96(11.67-23.70) 0.2684 1.205 0.000 500 11.60(8.68-16.01) 0.2610 0.793 0.000 750 8.95(6.77-11.85) 0.2591 0.781 0.000 Table 2 represented LT50 values of plant extracts and synthetic acaricides at various concentrations against H. anatolicum. At minimum concentration (50 ppm), LT50 values of plant extracts (A. indica, D. sissoo and M. alba) were 32.31, 44.44, 49.5 hrs and that of acaricides (fipronil, emamectin and cypermethrin) were 22.43, 31.01, 29.17 hrs while at maximum concentration (750 ppm), LT50 values of plant extracts were 8.49, 16.97, 29.17 hrs and that of acaricides were 6.53, 7.37, 8.95 hrs Table 2: LT50 of plant extracts and synthetic acaricides at various concentrations against H. anatolicum respectively. Results also revealed that A. indica could kill H. anatolicum in minimum duration among the employed plant extracts that was statistically similar to the synthetic chemicals. To check the statistical significance of the plants, chemical acaricides, different time intervals (2, 4, 6, 12, 24 and 48 hrs) and concentrations (50, 100, 250, 500 and 750 ppm), the analysis of variance (ANOVA) was applied. M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran18 Source df Sum of Squares Mean Square F p-value Time 5 5198.921 1039.784 938.619 <0.001 Chemicals 2 166.980 83.49 78.16 <0.001 Plant 2 185.311 92.655 75.041 <0.001 Concentration 5 8710.566 1742.113 1618.86 <0.001 Error 735 953.949 1.298 Total 749 15215.727 Table 3: Analysis of variance (ANOVA) results Treatments Conc. ppm Tick wt. (mg) (mean ± SD) Egg mass (mg) (mean ± SD) Fecundity = Egg mass/tick wt. % Hatch RI = Fecundity x % hatch Control dH2O 198.8±9.06 75.8±10.6 0.38 80 30.4 A. indica 50 196.6±10.93 59±8.9 0.300 54 16.2 100 195.4±9.74 40±7.5 0.204 43 8.77 250 187.9±8.96 38±7.1 0.202 32 6.46 500 202.3±11.07 32±7.1 0.158 24 3.79 750 194.6±9.86 25±6.4 0.128 10 1.28 D. sissoo 50 196.6±10.71 63±9.9 0.320 56 17.92 100 195.4±9.76 42±7.4 0.214 43 9.202 250 193.3±8.67 40±7.2 0.206 33 6.80 500 197.1±9.75 38±6.5 0.192 27 5.18 750 194.8±9.58 37±6.2 0.189 13 2.46 M. alba 50 202.8±9.45 65±6.5 0.320 59 18.88 100 197.3±8.51 46±6.6 0.233 46 10.72 250 195.4±9.85 44±6.5 0.225 32 7.2 500 201.1±11.09 43±6.1 0.213 30 6.39 750 196.1±8.91 40±5.8 0.204 14 2.856 Fipronil 50 198.3±10.94 21±8.9 0.105 25 2.63 100 197.7±9.76 16±7.5 0.080 17 1.36 250 188.6±8.96 9±7.1 0.047 8 0.376 500 201±10.97 0±7.1 0 0 0 750 196.4±9.95 0±6.4 0 0 0 Emamectin 50 197.8±10.95 29±9.9 0.146 29 4.23 100 199.6±8.77 18±7.4 0.090 18 0.162 250 189.9±8.65 12±7.2 0.063 4 0.252 500 198.3±10.91 0±6.5 0 0 0 750 198.9±9.55 0±6.2 0 0 0 Cypermethrin 50 202.9±10.48 45±6.5 0.221 29 6.409 100 193.9±9.67 32±6.6 0.165 17 2.805 250 192.5±9.73 23±6.5 0.119 8 0.952 500 201.7±10.44 10±6.1 0.049 3 0.147 750 197.6±9.86 0±5.8 0 0 0 Table 4: Reproductive parameters of control and treated groups of Hyalomma anatolicum Tick mortality through synthetic acaricides and plant extract 19 Phytochemical Plant extracts Azadirachta indica Dalbergia sissoo Morus alba Alkaloids _ _ _ Flavonoids +++ + +++ Steroids ++ _ ++ Terpenoids + ++ ++ Saponins +++ + + Tannins ++ ++ ++ Phenols _ +++ ++ The phytochemical analysis of plant extracts used in our bioassay experiments revealed that saponins and flavonoids showed highest scoring in neem extract while tannins and steroids indicated moderate scores (Table 5). Phenols represented highest scores in Dalbergia sissoo extract, while tannins and terpenoids showed moderate scoring. Phytochemical analysis revealed highest scoring of flavonoids and moderate scoring of steroids, terpenoids, tannins and phenols. Alkaloids were not detected in the extracts of selected plants. Discussion In the present study methanolic extracts of three locally existing plants Azadirachta indica (Neem), Dalbergia sissoo (Sheesham), Morus alba (Shehtoot) and three synthetic acaricides fipronil, emamectin and cypermethrin were employed to evaluate the mortality of H. anatolicum under laboratory conditions. Maximum mortality of H. anatolicum was observed after exposing these ticks for a period Table 5: Phytochemical analysis of plants extracts tested against H. anatolicum (-) Not detected, (+) Low in concentration, (++) Moderate, (+++) High in concentration The results presented in Table 3 revealed that all the three plants, three synthetic acaricides, times and concentrations were significantly different (p-values <0.001). Then we applied Tukey’s test to see which plant and acaricide provide highest mortality. The results revealed that A. indica was statistically significant (p-value = 0.04) from M. alba and D. sissoo and it provided highest mortality. Tukey’s test revealed that fipronil was statistically insignificant (p-value = 0.99) from cypermethrin and significant (p-value = 0.02) differences were noted from emamectin. Tukey’s test was also applied to time intervals, the mortality was found to be statistically significant (p-value = 0.02). For the concentrations with the control, Dunnet’s test was applied. The results of Dunnet’s test showed that the mortality in all the concentrations (50, 100, 250, 500 and 750 ppm) was significantly higher than the control group (water only). The reproductive parameters of ticks treated with different concentrations of plant extracts and synthetic acaricides were shown in table 4. This table showed that all plant extracts and synthetic acaricides showed excellent results in lowering reproductive index at high concentrations (250, 500 and 750 ppm). All three acaricides even with low concentrations were as effective in tick mortality as higher concentrations, however plant extracts were not very effective at lower concentrations (50 and 100 ppm) as shown in table 4. of 48h at 750 ppm concentration and minimum mortality was recorded at least time duration (2h) and concentration (50 ppm). Magadum et al. (24) evaluated the efficacy of Azadirachta indica and Annona squamosa extracts against Rhipicephalus (syn. Boophilus) microplus in India. They observed 71 % efficacy with A. squamosa extracts against the R. microplus by in vivo but in vitro methods showed more efficacy of A. indica extracts than the extracts of A. squamosa. These results are related to the present in vitro outcomes in which A. indica was highly effective against H. anatolicum than D. sissoo and M. alba. In our study, A. indica showed lethal effects against H. anatolicum and these results are related to the investigations of Zaman et al. (25) who evaluated the anti-tick efficacy of combined aqueous herbal extracts of A. indica leaves, Nicotiana tabacum leaves, Calotropis procera flowers and Trachispermum ammi seeds against the Rhipicephalus (Boophilus) microplus using adult immersion, larval packet and ear bag method. They M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran20 stated that the extract exhibited lethal effects on egg laying, hatching and total larval mortality. Parte et al. (26) screened the acaricidal activity of aqueous extracts of Azadirachta indica, Mangifera indica, Polyalthia longifolia, Annona squamosa and Ficus benghalensis against the Rhipicephalus (Boophilus) microplus. They observed that the combination of five plant extracts showed 100 percent mortality as compared to individual plant extracts. Furthermore, they concluded that extended exposure of the target pest to individual plant extract is required to obtain 100 percent mortality. Increased mortality of ticks was also observed in present studies with the increase of exposure time at the same concentration of employed plant extract. Results of M. alba leaves extract exhibited a moderate acaricidal activity against H. anatolicum. Percentage mortality of the test ticks evaluated for a concentration of 750 ppm after periods of 24h and 48h were 50% and 66.67%, respectively. Data represented that mortality of ticks was time and concentration dependent. Mortality increased with the increase of concentration and time of exposure. The results obtained in this study are supported by Dantas et al. (27) who studied the acaricidal activity of crude ethanolic extract and fractions from the leaves of Morus nigra on female cattle ticks Rhipicephalus microplus, using the adult immersion test. The mortality and fertility of females exposed to different concentrations of hexane, chloroform and ethyl acetate fractions, as well as ethanolic extract of M. nigra. The chloroform extract of leaves of M. nigra (25 mg/mL) showed the best results, obtaining 62.6% of inhibition of oviposition, 39.3% of eggs eclosion average and 65.4% of effectiveness. D. sissoo leaves extract showed mean mortality of ticks after 24h and 48h periods as 48.67% and 58.67% respectively. Highest mean mortality of ticks (42.22%) was observed at 750 ppm concentration. Mortality of ticks was found to be dependent on exposure time and concentration of extract applied. These results are in line with those obtained by Singh et al. (28). They evaluated mortality and fecundity of Rhipicephalus (Boophilus) microplus exposed to Sheesham leaf aqueous (SLA) and ethanolic (SLE) extracts. Higher acaricidal activity was recorded in SLA with a lower LC50 (95% CL) value of 1.58% than SLE (5.25%). Synthetic acaricide, cypermethrin showed a remarkable efficacy against H. anatolicum and the mortality was increased with increase in acaricides concentration and exposure periods. The mean mortality of ticks observed after 24h period was 58.00% and mortality recorded after 2 days (48h) was 73.33%. Similar investigation was performed by Khalaf-Allah (29), who reported 100% effectiveness of cypermethrin against R. annulatus up to 7 weeks of post-treatment after which the efficacy was dropped to 98 %. Sajid et al. (30) also investigated the pour-on preparations of cypermethrin which showed a higher in vivo efficacy compared to ivermectin against Hyalomma anatolicum anatolicum at 15 days post-treatment interval. Burridge et al. (31) employed eight acaricides (amitraz, carbaryl, chlorpyrifos, cyfluthrin, fipronil, permethrin, pyrethrin, and selamectin) for their efficacy in the rapid killing of Rhipicephalus sanguineus (Acari: Ixodidae). R. sanguineus was most sensitive to fipronil, carbaryl and cyfluthrin. Our findings also suggest that fipronil possesses greater potential to control ticks and has caused 84% mortality of H. anatolicum when compared with emamectin and cypermethrin. Our results indicated that all plant extracts inhibit oviposition and reduce hatching percentage depending on concentration of extracts. These results are in line with those of Rawani et al. (32) who also noted these deterrent properties in Carica papaya against ticks. Roobakkumar et al. (33) used garlic extract and noted more than 70% mortality in ticks with reduced oviposition and hatching percentage of surviving parents. These results are different from Kalakumar et al. (34) and Borges et al. (35) who noted mortality (more than 60%) but failed to record the inhibition of oviposition and reduction in hatching percentage of ticks with neem extract treatment. Our results are also at par with the results of Shyma et al. (36) who noted 0 to 50% reduction in hatching with neem, calotropis, datura, garlic and papaya plant extracts. Conclusion Plants presented a significant mortality of H. anatolicum but less than that of synthetic chemicals. From above observations it has been concluded that plant extracts could effectively control ticks population when applied on house hold animals as well as farm animals. As synthetic acaricides cause toxicity in environment, affect animal health and may develop resistance in ticks against these chemicals. It is recommended Tick mortality through synthetic acaricides and plant extract 21 to encourage the use of plant extracts instead of synthetic chemicals to control ticks population on animals. These botanical pesticides could efficiently control ticks population without posing any health risk to the animals. References 1. Holdsworth PA, Kemp D, Green P, et al. World association for the advancement of veterinary par- asitology, guidelines for evaluating the efficacy of acaricides against ticks on ruminants. Vet Parasitol 2006; 136(1): 29–43. 2. Ali Z, Maqbool A, Muhammad K, Khan MS, Younis M. Prevalence of Theileria annulata infected hard ticks of cattle and buffalo in Punjab, Pakistan. J Anim Plant Sci 2013; 23(1): 20–6. 3. Ionita M. Cercetari privind ecologia familiei Ixodidae in unele zone ubcarpatice: aspecte epi- demiologice ale parazitozelor ce pot fi transmise de acestea. Bucuresti: USAMV, 2004: 123 p. Teza de doctorat 4. Mitrea IL. Parazitologie si boli parazitare la animale. Bucureşti : Editura Ceres, 2011. 5. Nawaz M, Sajid SM, Ahmed Z, et al. Anti-tick activity of leaves of Azadirachta indica, Dalbergia sissoo and Morus alba against Rhipicephalus mi- croplus (Acari: Ixodidae). Acta Parasitol Glob 2015; 6(1): 60–4. 6. Rajpoot ZI, Hu SH, Chen WJ, Arijo AG, Xiao CW. Importance of ticks and their chemical and im- munological control in livestock. J Zhejiang Univ Sci B 2006; 7(11): 912–21. 7. Jabbar A, Abbas T, Saddiqi HA, Qamar MF, Gasser RB. Tick-borne diseases of bovines in Paki- stan: major scope for future research and improved control. Parasite Vector 2015; 8(1): 283. 8. Gosh S, Tiwari SS, Kumar B. Identification of potential plant extracts for anti-tick activity against acaricide resistant cattle ticks, Rhipicepha- lus (Boophilus) microplus (Acari: Ixodidae). Exp App Acarol 2015; 66(1): 159–71. 9. NRC (National Research Council). The future role of pesticides in U.S. agriculture. Committee on the future role of pesticides in U.S. agriculture, board on agriculture and natural resources and board on environmental studies and toxicology, Commission on Life Sciences. Washington : Na- tional Academy of Sciences, 2000. 10. Grainge M, Ahmed S. Handbook of plants with pest- controlling properties. New York: Wiley and Sons, 1988: 470 p. 11. Kulkarni N. Anti-insect bioactivities of some botanicals: their prospects as component of Inte- grated Pest Control System. In: Shukla PK, Joshi KC, eds. Recent trends in insect pest control to en- hance forest productivity. Jabalpur (M.P.) India : Tropical Forest Research Institute, 2003: 95–137. 12. Schwalback MJ, Greyling JPC, David M. The efficacy of a 10% aqueous Neem (Azadirachta in- dica) seed extract for tick control in Small East Afri- can and Toggenburg female goat kids in Tanzania. S Afr J Anim Sci 2003; 33(2): 83–8. 13. Kalwar MA, Sahito HA, Kalwar BA, Lal M, Fazlani S. Repellency and antifeedant of ticks through ethno plant extracts and ivermectin on buffalo calves. Eur Rev Chem Res 2014; 1(1): 27– 35. 14. Saurabh A, Shekher AM, Gupta S. A review on medicinal plant which may effective in the treat- ment of ulcer or which show antiulcer activities. Int J Biopharm Toxicol Res 2012; 2(1): 266–76. 15. Asif M, Kumar A. Phytochemical investiga- tion and evaluation of antinociceptive activity of ethanolic extract of Dalbergia sissoo (Roxb.) bark. J Nat Sci Bio Med 2011; 2(1): 76. 16. Srivastava S, Kapoor R, Thathola A, Srivas- tava RP. Nutritional quality of leaves of some geno- types of mulberry (Morus alba). Int J Food Sci Nutr 2006; 57(5/6): 305–13. 17. Jha S, Srivastava AK. Antibacterial, antifun- gal and pesticidal activity of plant Morus alba. A novel approach in post-harvest Technology. Int J Agric Sci Res 2013; 1(3): 157–62 18. Opiro R, Osinde C, Okello-Onen J, Akol AM. Tick-repellent properties of four plant species against Rhipicephalus appendiculatus Neuman (Ac- arina: Ixodidae) tick species. E3 J Agric Res Develop 2013; 3(2): 17–21. 19. Estrada-Peña A, Bouattour A, Camicas JL. The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodidae) in Africa and Latin America. Exp Appl Acarol 2006; 38(2-3): 219–35. 20. FAO. Resistance management and inte- grated parasite control in ruminants—guidelines, module 1. ticks: acaricide resistance: diagnosis, management and prevention. Rome : Food and Agriculture Organization, Animal Production and Health Division, 2004. 21. Drummond RO, Crust SF, Trevino JL, Glad- ney WJ, Graham OH. Boophilus annulatus and B. microplus: laboratory tests of insecticides. J Econ Entomol 1973; 66(1): 130–3. M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran22 22. Rosenthaler L. The chemical investigation of plants. In: Kendaal J, Reed J, eds. Monographs on modern chemistry. London : G. Bell and Sons, 1930: 1–12. 23. Finney DJ. Probit analysis. Cambridge : Uni- versity Press, 1971: 333 p. 24. Magadum S, Mondal DB, Ghosh S. Compar- ative efficacy of Annona squamosa and Azadirachta indica extracts against Boophilu smicroplus, Izatna- gar isolate. Parasitol Res 2009; 105(4): 1085–91. 25. Zaman MA, Iqbal Z, Sandhu Z, Abbas RZ, Qamar MF. An overview of plants with acaricidal and anthelmintic properties. Int J Agric Biol 2017; 19(5): 957–68. 26. Parte SG, Patil RD, Patil MA, Patel NS, Cha- van JA. Utilization of herbals for the managements of cattle ticks. Intl J Curr Microbiol Appl Sci 2014; 3: 228–32. 27. Dantas ACS, Freire DP, Souza GR, et al. Ac- aricidal activity of leaves of Morus nigra against the cattle tick Rhipicephalus microplus. Arq Bras Med Vet Zootec 2017; 69(3): 523–8. 28. Singh NK, Jyoti, Vemu B, et al. Acaricidal activity of leaf extracts of Dalbergia sissoo Roxb. (Fabaceae) against synthetic pyrethroid resistant Rhipicephalus (Boophilus) microplus. Res Vet Sci 2016; 106: 1–6. 29. Khalaf-Allah SS. Acaricidal efficacy of cy- permethrine (a new synthetic pyrethroid) against Boophilus annulatus ticks in cattle. Dtsch Tierarztl Wochenschr 1996; 103(11): 463–4. 30. Sajid MS, Iqbal Z, Khan MN, Muhammad G. In vitro and in vivo efficacies of ivermectin and cy- permethrin against the cattle tick Hyalomma ana- tolicum anatolicum (Acari: Ixodidae). Parasitol Res 2009; 105(4): 1133–8. 31. Burridge MJ, Simmons LA, Allan SA. Effi- cacy of acaricides for control of four tick species of agricultural and public health significance in the United States. J Agric Urban Entomol 2003; 20(4): 207–19. 32. Rawani A, Ghosh A, Lashkar S. Aliphatic Amide from Seeds of Carica papaya as mosquito larvicide, pupicide, adulticide, repellent and smoke toxicant. J Mosq Res 2012; 2(2): 8–18. 33. Roobakkumar A, Subramaniam MSR, Babu A. Bioefficacy of certain plant extracts against the red spider mite, Oligonychus coffeae (Nietner) (Ac- arina: Tetranychidae) infesting tea in Tamil Nadu, India. Int J Acarol 2010; 36(3): 255–8. 34. Kalakumar B, Kumar HSA, Kumar BA. Eval- uation of custard seed oil and neem oil as acari- cides. J Vet Parasitol 2000; 14(1): 171–2. 35. Borges LMF, Ferri HP, Silva WJ. In vitro effi- cacy of extracts of Melia azedarach against the tick Boophilus microplus. Med Vet Entomol 2003; 17(2): 228–31. 36. Shyma KP, Gupta JP, Ghosh S, Patel KK, Singh V. Acaricidal effect of herbal extracts against cattle tick Rhipicephalus (Boophilus) microplus us- ing in vitro studies. Parasitol Res 2014; 113(5): 1919–26. Tick mortality through synthetic acaricides and plant extract 23 PRIMERJAVA UČINKOVITOSTI SINTETIČNIH KEMIKALIJ IN RASTLINSKIH EKSTRAKTOV ZA NADZOR NAD KLOPI M. Arshed, S. Nasir, T. Hussain, M. I. Babar, M. Imran Izvleček: Klopi veljajo za škodljive in ekonomsko pomembne ektoparazite, kajti njihova okužba po vsem svetu hudo prizadane govedo na paši. Zatiranje klopov s sintetičnimi akaricidi ni nevarno samo za zdravje živali in ljudi, temveč povzroča tudi onesnaže- vanje okolja. Študija je bila zasnovana z namenom ovrednotenja rastlinskih izvlečkov v primerjavi s sintetičnimi akaricidi za nadzor nad Hyalomma anatolicum. Za oceno umrljivosti klopov po 2, 4, 6, 12, 24 in 48 urah je bilo uporabljenih pet različnih koncentracij (50, 100, 250, 500 in 750 ppm) metanolnih rastlinskih izvlečkov in akaricidov. Podatki o smrtnosti so bili analizirani z analizo Probit za izračun srednje smrtne doze (LC 50 ) in srednjega časa smrti (LT 50 ). Metanolni ekstrakt iz Azadirachta indica je pokazal najvišjo umrljivost (LC 50 =38,3 ppm) klopov v primerjavi z Dalbergia sissoo (LC 50 =58,76 ppm) in Morus alba (LC 50 =92,95 ppm). Med aka- ricidi je imel fipronil največji učinek smrtnosti (LC 50 =35,01 ppm) v primerjavi z emamektinom (LC 50 =46,87 ppm) in cipermetrinom (LC 50 =37,83 ppm). Višja koncentracija (750 ppm) akaricidov (fipronil, emamektin in cipermetrin) je pokazala hitrejšo smrtnost (LT 50 =6,53-8,95 ur) v primerjavi z rastlinskimi ekstrakti (LT 50 =8,49-29,17 ur). Učinke zdravljenj so preučevali tudi na jajčnih masah in obravnavali reproduktivni indeks (RI) preživelih klopov. Rezultati so pokazali pomembno, koncentracijsko odvisno variacijo med jajčnimi masami, obdelanimi z rastlinskimi izvlečki in akaricidi. Posledično so se vrednosti njihovega reproduktivnega indeksa znatno zmanjšale. Fitokemijska analiza preizkušenih rastlinskih izvlečkov je razkrila prisotnost flavonoidov, steroidov, terpeno- idov, saponinov, taninov in fenolov v spremenljivih količinah. Rezultati opravljene raziskave opisujejo pomembne lastnosti okolju prijaznih rastlinskih izvlečkov pri preprečevanju napadov klopov. Ključne besede: rastlinski izvlečki; sintetični akaricidi; smrtnost klopov Slov Vet Res 2021: 58 (1): 25 – 33 Original Research Article DOI 10.26873/SVR-1144-2020 UDC 57.083.1:579.842:615.015.8 THE PRESENCE OF PUTATIVE VIRULENCE DETERMINANTS, TETRACYCLINE AND β - LACTAMS RESISTANCE GENES OF Aeromonas SPECIES ISOLATED FROM PET TURTLES AND THEIR ENVIRONMENT S.H.M.P Wimalasena, Gang-Joon Heo* Laboratory of Aquatic Animal Medicine, Veterinary Medical Center and College of Veterinary Medicine, Chungbuk National University, Chung- dae-ro 1, Seowon-gu, Cheongju 28644, Republic of Korea *Corresponding author, E-mail: gjheo@cbu.ac.kr Abstract: This study aimed to characterize Aeromonas spp. isolated from ten popular species of pet turtles and their envi- ronment to evaluate the potential risk of pet turtles as a source of virulence-associated genes, and tetracycline and β-lactams resistance determinants. Presence of eight virulence genes (ser, aer, exu, lip, fla, ascV, ahyB and gcat), and tetracycline (tetA, tetB and tetE) and β-lactams (bla TEM , bla SHV , bla OXA and bla CTX-M ) resistance genes were evaluated by conventional PCR assays. The aerA gene showed the highest frequency of occurrence (92%), followed by fla (75%), gcaT (68%), ahyB (59%), ser (39%), lip (37%) and ascV (25%) genes. None of the isolates carried amplicon of DNase-associated exu gene. A. hydrophila, A. dharken- sis, A. veronii and A. caviae were carried seven tested virulence genes except for exu while only four virulence genes were de- tected in A. enteropelogenes. Among the 75 tetracycline-resistant isolates, tetA, tetE and tetB genes were detected in 38, 26 and 6 isolates, respectively. Among the tested β-lactam resistance genes, bla OXA and bla TEM genes were detected in 54% and 36% of β-lactam resistant isolates, respectively. No bla CTX-M and bla SHV genes were detected. Our results indicate that pet tur- tle-associated aeromonads, exhibiting potential virulence and antimicrobial (tetracycline and β-lactams) resistance genes, may pose a serious health risk to pet turtle owners, particularly to immunocompromised individuals. Key words: Aeromonas spp.; virulence-associated genes; tetracycline resistance; β-lactams resistance; pet turtle Introduction Mesophilic aeromonads are ubiquitous bacteria that are a component of the normal microbiota of many aquatic animals such as fish, amphibians, and reptiles (1). They can cause ulcerative stoma- titis, pneumonia, dermatitis, and septicemia in rep- tiles under stressful conditions such as trapping, handling and temperature variations of rearing en- vironment (2, 3). Over the years, many studies have been investigated to evaluate the prevalence of Aero- monas species in aquatic animals, mainly food-pro- ducing animals (4, 5). However, a limited number of Received: 6 June 2020 Accepted for publication: 28 September 2020 studies evaluating the distribution of aeromonads in pet turtles have been published up to date (6, 7). The pathogenesis of Aeromonas species in- volves various virulence factors including cytotoxic heat-labile enterotoxin (act), cytotonic heat-labile enterotoxin (alt) and cytotonic heat-stable entero- toxin (ast), aerolysin (aer), lipase (lip), serine pro- tease (ser), elastase (ahyB), DNase (exu), glycero- phospholipid-cholesterol acyltransferase (gcaT), flagellar system (fla) and Type III secretion system (TTSS) effector (ascV). These genes encoding viru- lence factors have been broadly used in determining the potential pathogenicity of Aeromonas species isolated from the environment, foodstuffs, and hu- man clinical samples (1, 8-10). 26 S. H. M. P. Wimalasena, G-J. Heo Recently, antibiotic-resistant aeromonads have been recognized as a serious concern due to their potential health risks to animals and humans (11, 12). Especially, the dissemination of tetracycline and β-lactams resistance aeromonads in the aquatic environment has been widely documented (12, 13, 14). Among many tetracycline resistance genes, the tetE, tetA and tetB genes were frequently identified from Aeromonas species in the aquatic environment (12, 15, 16). Aeromonas species can produce nu- merous β-lactamases for conferring resistance to β-lactams. According to isolation sources, the pre- vious studies have shown the different prevalence of genes encoding β-lactamases in Aeromonas spe- cies. In the aquatic environment, the blaTEM, blaSHV, blaOXA and blaCTX-M β-lactams genes were frequently detected from Aeromonas species (17-19). These resistance genes containing plasmids and transposons are known as mobile genetic elements that can be transferred horizontally among distantly related lineages. Particularly, The aquatic environ- ment is more favorable for the transmission of resis- tant bacteria, thus, Aeromonas species as opportu- nistic pathogens might be dangerous vectors for the spreading of antibiotic resistance genes through the aquatic environment (18, 20). Hence, the present study was conducted to determine the occurrence of antimicrobial resistance genes (tetracyclines and β-lactams) and virulence-associated genes of Aer- omonas species isolated from pet turtles and their environment. Materials and methods Bacterial isolates One hundred and two Aeromonas species iso- lates obtained from ten commercially popular pet turtles species (Chinese stripe-necked turtles Ocadia sinensis, yellow belly sliders Trachemys scripta scripta, river cooters Pseudemys concinna concinna, northern Chinese softshell turtles Pelo- discus maackii, western painted turtles Chrysemys picta belli, peninsula cooters Pseudemys peninsu- laris, African sideneck turtles Pelusios castaneus, common musk turtles Sternotherus odoratus, red belly cooters Pseudemys rubriventris and alliga- tor snapping turtles Macroclemys Temminckii) and their rearing environment was screened to investi- gate the presence of putative virulence, and β-lact- ams and tetracycline resistance genes. These iso- lates have been previously characterized for their antimicrobial susceptibilities, enterotoxin (act, alt and ast) genes and quinolone resistance determi- nants (7, 21). Detection of antibiotic resistance genes Twenty-eight and seventy-five isolates were selected (21) for the detection of β-lactams and tetracycline resistance determinants, respectively. These isolates were tested by PCR assays to detect the genetic determinants associated with resistance to β-lactams (blaTEM, blaSHV, blaOXA and blaCTX-M), and tetracyclines (tetA, tetB and tetE). The primer sets used in PCR amplification are summarized in table 1. PCR amplifications were conducted in 20 µL volumes consisting of 10 µL of Quick Taq® HS DyeMix (Toyobo, Japan), 1 µL of 10 pmol/µL each primer and 1 µL of the template under standard conditions. The PCR products were analyzed by electrophoresis on 2% (wt/vol) agarose gels. Positive controls were implemented with previously characterized enterobacterial strains that harbored the corresponding genes (21, 22). Detection of virulence-associated genes All isolates were subjected to PCR assays to detect the 8 tested virulence genes including ser, aer, exu, lip, fla, ascV, ahyB and gcat. The PCR amplification of the virulence-associated genes was carried out according to the PCR primers and conditions reported previously (Table 1). The PCR mixture of 20 µL contained 10 µL Quick Taq HS DyeMix (Toyobo, Japan), 7 µL PCR water, 1 µL template and 1 µL of each primer. The PCR products were examined by electrophoresis on 1.5% (W/V) agarose gel. Results Bacterial isolates One hundred and two Aeromonas species isolates were isolated from the feces, skin and rearing environments of pet turtles and identified by biochemical and gyrB sequence analyses. Aeromonas enteropelogenes was the predominant species among the isolates (52.9%) followed by A. hydrophila (32.4%), A. dharkensis (5.9%), A. veronii (4.9%) and A. caviae (3.9%) 7. 27The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species ... Gene Target Nucleotide Sequence (5’-3’) Size (bp) Annealing temperature (ºC) Reference aerA Aerolysin F: CTATGGCCTGAGCGAGAAG 431 62 30 R: CAGTTCCAGTCCCACCACT ser Serine protease F: ACCGAAGTATTGGGTCAGG 350 55 13 R: GCTCATGCGTAACTCTGGT fla Flagella F: CCAACCGTYTGACCTC 608 56 36 R: MYTGGTTGCGRATGGT ahyB Elastase F: CACGGTCAAGGAGATCAAC 513 58 13 R: GCTGGTGTTGGCCAGCAGG lip Lipase F: ATCTTCTCCGACTGGTTCGG 382 62 36 R: CCGTGCCAGGACTGGGTCTT exu DNase F: AGACATGCACAACCTCTTCC 323 59 13 R: GATTGGTATTGCCTTGCAAG gcaT Glycerophospholipid- cholesterol acyltransferase F: TCCTGGAATCCCAAGTATCAG 237 65 13 R: GCAGGTTGAACAGCAGTATCT ascV Type III Secretion System F: AGCAGATGAGTATCGACGG 891 58 38 R: AGGCATTCTCCTGTACCAG blaTEM β - lactams resistance F: ATAAAATTCTTGAAGACGAAA 1080 60 22 R: GACAGTTACCAATGCTTAATC blaSHV F: TTATCTCCCTGTTAGCCACC 795 60 R: GATTTGCTGATTTCGCTCGG blaCTX-M F: CGCTTTGCGATGTGCAG 550 52 R: ACCGCGATATCGTTGGT blaOXA F: TCAACTTTCAAGATCGCA 591 60 R: GTGTGTTTAGAATGGTGA tetA Tetracycline resistance F: GTAATTCTGAGCACTGTCGC 1000 62 22 R: CTGCCTGGACAACATTGCTT tetB F: CTCAGTATTCCAAGCCTTTG 400 57 R: CTAAGCACTTGTCTCCTGTT tetE F: GTGATGATGGCACTGGTCAT 1100 62 R: CTCTGCTGTACATCGCTCTT Table 1: Oligonucleotide primers and PCR conditions a used to amplify virulence and antibiotic resistance genes of Aeromonas spp. a PCR thermocycle conditions for each reaction; initial denaturation of 94 ºC for 2 min followed by a total of 35 cycles of amplification. Each cycle consisted of 94 ºC denaturation for 30 s, annealing for 50 s and 72 ºC extension for 10 min. Presence of resistance genes Among the tested β-lactam resistance genes, blaOXA and blaTEM genes were detected in 54% and 36% of β-lactam resistant isolates, respectively. No blaCTX-M and blaSHV genes were detected (Table 2). Among the 75 tetracycline-resistant isolates, tetA, tetE and tetB genes were detected in 38, 26 and 6 isolates, respectively (Table 3). 28 S. H. M. P. Wimalasena, G-J. Heo Isolate Host a β-lactam resistance b β-lactam resistance genes Aeromonas caviae AD14 CSN AMP, AMX, CEP, FOX blaTEM AC50 RC AMP, AMX, CEP, CRO, FOX, IMI blaOXA, blaTEM A. dharkensis AD17 RC AMP, AMX, CEP, CRO, FOX, CTX blaOXA, blaTEM AD18 RC AMP, AMX, CEP, CRO, FOX, CTX blaOXA, blaTEM AD19 RC AMP, AMX, CEP, CRO, FOX blaOXA AD15 CSN AMP, AMX, CEP, FOX, CTX blaOXA A. enteropelogenes AC2 RC AMP, AMX, CEP blaOXA AC6 RC CEP, FOX - AC15 NCS AMP, AMX, CEP, FOX blaOXA AC30 CM CEP, CTX, ATM - AC31 WP CEP, CTX, ATM - AC32 WP CEP, CTX, ATM - AC35 RC CEP, CTX, ATM - AC44 YB AMP, AMX, CRO blaTEM AC45 RC CEP, CRO, ATM - AC53 WP AMP, AMX, CEP, FOX blaOXA AV4 RC AMP, AMX, CEP, FOX blaOXA AD1 CM AMP, AMX, CEP, FOX blaOXA A. hydrophila AH1 RC AMP, CEP - AH11 CSN AMP, AMX, CEP, CRO blaOXA, blaTEM AH13 CSN CEP, CRO, FOX, IMI - AH19 NCS AMP, AMX, CEP, CRO blaOXA AH20 NCS AMP, AMX, CEP blaTEM AH22 YB AMP, AMX, CEP - AH23 YB AMP, AMX, CEP, CRO blaOXA AH25 CM AMP, AMX, CEP, FOX blaTEM AD10 AF AMP, AMX, CEP, FOX blaOXA, blaTEM A. veronii AC52 SN AMP, AMX, CEP, FOX blaOXA, blaTEM Species Number of positive isolates (Subtotal %) tetA tetB tetE Aeromonas enteropelogenes (n = 50) 32 (64) - 8 (2) A. hydrophila (n = 17) 6 (35) - 12 (71) A. dharkensis (n = 4) - 2 (50) 3 (75) A. veronii (n = 3) - 3 (100) 2 (66) A. caviae (n = 1) - 1 (100) 1 (100) Total (%) (n = 75) 38 (51) 6 (1) 26 (35) Table 2: β-lactams resistance profiles of turtle-associated Aeromonas spp. Table 3: Distribution of tetracycline resistance genes among tetracycline resistant Aeromonas species isolated from pet turtles and their environment aHost: CSN= Chinese stripe-necked turtle, YB= yellow belly slider, RC= river cooter, PC= peninsula cooter, NCS= northern Chinese softshell turtle, CM= common musk turtle, WP= western painted turtle, AF= African sideneck turtle, SN= Alligator snapping turtle. bβ-lactams resistance: AMX=Amoxicillin (10 µg), AMP=Ampicillin (10 µg), CEP=Cephalothin (30 µg), CRO=Ceftriaxone (30 µg), FOX=Cefoxitin (30 µg), CTX=Cefotaxime (30 µg), IMI=Imipenem (10 µg) 29The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species ... Species Number of positive isolates (Subtotal %) aerA lip ahyB ser exu fla gcat ascV Aeromonas enteropelogenes (n = 54) 46 (85) 0 21 (39) 0 0 51 (94) 23 (43) 0 A. hydrophila (n = 33) 33 (100) 30 (91) 28 (85) 31 (94) 0 19 (58) 33 (100) 15 (47) A. dharkensis (n = 6) 5 (83) 3 (50) 4 (67) 4 (67) 0 2 (33) 6 (100) 4 (67) A. veronii (n = 5) 5 (100) 3 (60) 5 (100) 3 (60) 0 2 (40) 4 (80) 3 (60) A. caviae (n = 4) 4 (100) 2 (50) 2 (50) 2 (50) 0 3 (75) 3 (75) 4 (100) Total (%) (n = 102) 93 (92) 38 (37) 60 (59) 40 (39) - 77 (75) 69 (68) 26 (25) Distribution of virulence-associated genes The occurrence and frequencies of virulence genes are shown in Table 4. The aerA gene showed the highest frequency of occurrence (92%), followed by fla (75%), gcaT (68%), ahyB (59%), ser (39%), lip (37%) and ascV (25%) genes. None of the isolates carried amplicon of the DNase-associated exu gene. Discussion The Aeromonas spp. under study were multi- drug-resistant turtle-associated bacteria which carried quinolone resistance determinants, as well as enterotoxin genes (7, 21). The isolates were highly resistant to β-lactams especially amoxicil- lin, ampicillin and cephalothin. β-lactam antibiot- ics have used for the treatment of Aeromonas infec- tion during the last decade. However, their efficacy has significantly declined due to the production of β-lactamases by resistant bacterial strains (14, 17, 23). The Aeromonas spp. are naturally resistant to β-lactams because of the expression of chromoso- mal β-lactamases (24). In this study, twenty-eight aeromonads isolates were resistant to the more than one β-lactam an- tibiotics. Among them, 54% and 36% of isolates harbored blaOXA and blaTEM genes. Several previ- ous studies have documented the detection of the blaOXA and blaTEM genes in Aeromonas isolates re- covered from the environment (14, 25) and clinical samples (26) and the prevalence of gene detection varies according to the isolation sources. In Korea, a previous study reported that the blaOXA and blaTEM genes were detected in 3% and 100% of Aeromonas isolates from aquaculture fish [14]. However, a dif- ferent trend was observed in this study which the blaOXA and blaTEM genes were detected in Aeromonas Table 4: Prevalence of virulence-associated genes in Aeromonas species isolates from pet turtles and their environment isolates from pet turtles that suggest a wide distri- bution of β-lactamase genes in Aeromonas isolates from various sources. A much higher level of tetracycline resistance was observed amongst aeromonads in our previous study (7) and 78 of tetracycline-resistant isolates were selected to detect their tetracycline resistance determinants (tetA, tetB and tetE). A. enteropel- ogenes and A. hydrophila harbored tetA and tetE genes while other Aeromonas species harbored tetB and tetE genes. Previous reports indicate that the tetA and tetE determinants are the predominant tetracycline resistance genes in the aquatic envi- ronment (16, 27) and both genes code for an efflux pump that eliminates the drug from the cell 28. The tetA, tetB and tetE genes are located on the plas- mid as well as tetA in the transposon (Tn1721) and tetE is adjacent to the integrons (15). Han et al. (27) has reported that tetE gene was the predom- inant tetracycline determinant in Aeromonas spp. isolated from Korean fish farms and aquariums. However, Kim et al. (29) reported that tetA was the most frequent gene in A. salmonicida strains iso- lated from salmonid farms and private aquariums in Korea. The tetB gene was detected at a low fre- quency, while Jacobs and Chenia. (12) reported a lower prevalence of tetB genes among Aeromonas spp. isolated from the South African aquaculture system. Detection of virulence encoding genes of Aero- monas spp. have been widely applied for evaluat- ing their potential pathogenicity (30, 31). However, the prevalence of virulence-associated genes has rarely been reported in Aeromonas strains from pet turtles (7). In the current study, Aeromonas iso- lates were found to possess genes aerA, lip, ahyB, ser, fla, gcat and ascV, while genes for DNase (exu) was not identified. Especially, none of A. entero- pelogenes isolates harbored lip, ser, exu and ascV 30 S. H. M. P. Wimalasena, G-J. Heo genes. Previous studies have revealed that multi- ple virulence-associated genes are present in Aero- monas isolates and having high heterogeneity in the distribution of virulence-associated genes (10, 30, 31). The pore-forming aerolysin/hemolysin encoded aer gene was the most prevalent in this study which was detected in 92% of the total isolates representing all species of the genus. Several studies have reported the high prevalence of the aer gene in clinical and environ- mental Aeromonas isolates (30, 32). The three enterotoxins act, alt, and ast have been implicated as major virulence factors in diarrhoeal disease which had been investigated in our previous study (7). However, the presence of these toxins might not be enough for virulence (31). The temperature- stable metalloprotease with elastolytic activity (ahyB) and serine protease (ser) play an important role in the invasiveness and establishment of infection (1). In the current study, the ahyB and ser genes were detected in 59% and 39% of isolates, respectively. None of the A. enteropelogenes isolates harbored ser gene. The flagella are important appendages for the initial attachment of bacteria to the gastrointestinal epithelium and involve in the subsequent adherence process and biofilm formation (33, 34). The fla gene-encoded polar flagella were common among the Aeromonas isolates from the aquatic environment. The fla gene was detected in 99% of Aeromonas isolates from diseased eel in Korea (10). The gcaT gene plays a coherent, integrated role in the establishment of pathogenicity of Aeromonas spp. by involving in the regulation and secretion of extracellular glycerophospholipid-cholesterol acyltransferase (13). The gcaT gene was detected in 68% of Aeromonas isolates. Lipases play a role as virulence factors by interacting with leukocytes or by disturbing several immune system functions through free fatty acids produced by the lipolytic activity. Extracellular lipases secreted by Aeromonas spp. actively involve in the alteration of the host plasma membrane and thus increase the severity of infection (35). Among Aeromonas strains isolated in the present study, 91% of A. hydrophila, 60% of A. veronii, 50% of A. dharkensis and 50% of A. caviae isolates were found to have lip gene. Several previous studies reported a high prevalence of lip gene among the Aeromonas isolates from the aquatic environment (10, 36). Type III secretion system (T3SS) plays a crucial role in host- pathogen interactions by injecting effector toxins directly into the cytosol of host cells (37). The acsV gene encodes the T3SS and which was detected in 59% of Aeromonas spp. except for A. enteropelogenes isolates. The presence of ascV gene was previously detected in 68% of Aeromonas spp. isolated from diseased farmed fish and farm environment (38). Besides, the high frequency of ascV gene was reported in human clinical isolates (37). The exu gene is responsible for DNA hydrolysis which was not detected in this study. The absence of exu gene was also reported by Nawaz et al. (13) in A. veronii isolated from catfish in the USA. In contrast, the high prevalence of exu gene was observed in Aeromonas spp. isolated from freshwater lakes in Malaysia (39) and diseased eel in South Korea (10). The specificity of the host or environmental source could be the possible reasons for the absence of exu gene in this study. According to the available literature, this is the first description of these virulence-associated genes in Aeromonas of pet turtle origin. Most of Aeromonas strains isolated from pet turtles and their environment harboring multiple virulence- associated genes have the potential to be pathogenic. Turtle born aeromonads carrying tetracycline and β-lactams resistance determinants can disseminate through the environment. Collectively, which may pose a public health risk to pet turtle owners, particularly to immunocompromised individuals. Acknowledgment This study was supported by the Basic Science Research Program through the National Research Foundation of (KNRF) funded by the Ministry of Education (NRF-2015R1D1A1A01060638) in the Republic of Korea. Authors declare that no any conflict of interest exists. References 1. Janda JM, Abbott SL. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin Micro- biol Rev 2010; 23: 35–73. https://doi.org/10.1128/ CMR.00039-09. 2. Kim KT, Kwak D. A case of Aeromonas hy- drophila infection due to captivity-induced stress in a spectacled caiman (Caiman crocodilus). J Anim Plant Sci 2013; 23 (6): 1761–3. 3. Chen J, Zhu N, Kong L, Bei Y, Zheng T, Ding X, He Z. First case of soft shell disease in chinese soft-shelled turtle (Trionyx sinens) associated with Aeromonas sobria–A. veronii complex. Aquaculture 31The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species ... 2013; 406–407, 62–7. https://doi.org/10.1016/j. aquaculture.2013.05.006. 4. Evangelista-Barreto NS, Vieira RH, Carvalho FCT, et al. Aeromonas spp. isolated from oysters (Crassostrea rhizophorea) from a natural oyster bed, Ceará, Brazil. Rev Inst Med Trop São Paulo 2006; 48: 129–33. 5. Shakir Z, Khan S, Sung K, et al. Molecular characterization of fluoroquinolone-resistant Aer- omonas spp. isolated from imported shrimp. Appl Environ Microbiol 2012; 78: 8137–41. https://doi. org/10.1128/AEM.02081-12. 6. Lupescu I, Baraitareanu S. Emerging diseases associated with” New companion animals”: review in zoonoses transmitted by reptiles. Sci Works Ser C Vet Med 2015; 61: 135–8. 7. Wimalasena SHMP, Shin GW, Hossain S, Heo GJ. Potential enterotoxicity and antimicrobial resis- tance pattern of Aeromonas species isolated from pet turtles and their environment. J Vet Med Sci 2017; 79: 921–6. https://doi.org/10.1292/jvms.16-0493. 8. Khajanchi BK, Fadl AA, Borchardt MA, et al. Distribution of virulence factors and molecular fingerprinting of Aeromonas species isolates from water and clinical samples: suggestive evidence of water-to-human transmission. Appl Environ Micro- biol 2010; 76: 2313–25. https://doi.org/10.1128/ AEM.02535-09. 9. Ottaviani D, Parlani C, Citterio B, et al. Pu- tative virulence properties of Aeromonas strains isolated from food, environmental and clini- cal sources in Italy: a comparative study. Int J Food Microbiol 2011; 144: 538–45. https://doi. org/10.1016/j.ijfoodmicro.2010.11.020. 10. Yi SW, You MJ, Cho HS, Lee CS, Kwon JK, Shin GW. Molecular characterization of Aeromonas species isolated from farmed eels (Anguilla japon- ica). Vet Microbiol 2013; 164: 195–200. https:// doi.org/10.1016/j.vetmic.2013.02.006. 11. Deng YT, Wu Y, Tan AP, et al. Analysis of an- timicrobial resistance genes in Aeromonas spp. iso- lated from cultured freshwater animals in China. Microb Drug Resist 2014; 20: 350–6. https://doi. org/10.1089/mdr.2013.0068. 12. Jacobs L, Chenia HY. Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol 2007; 114: 295–306. https://doi.org/10.1016/j.ijfood- micro.2006.09.030. 13. Nawaz M, Khan SA, Khan AA, et al. Detec- tion and characterization of virulence genes and integrons in Aeromonas veronii isolated from cat- fish. Food Microbiol 2010; 27: 327–31. https:// doi.org/10.1016/j.fm.2009.11.007. 14. Yi SW, Chung TH, Joh SJ, Park C, Park BY, Shin GW. High prevalence of blaCTX-M group genes in Aeromonas dhakensis isolated from aquaculture fish species in South Korea. J Vet Med Sci 2014; 76: 1589–93. https://doi.org/10.1292/jvms.14- 0274. 15. Akinbowale Ol, Peng H, Barton MD. Diver- sity of tetracycline resistance genes in bacteria from aquaculture sources in Australia. J Appl Microbiol 2007; 103: 2016–25. https://doi.org/10.1111/ j.1365-2672.2007.03445.x. 16. Nawaz M, Sung K, Khan SA, Khan AA, Steele R. Biochemical and molecular characterization of tetracycline-resistant Aeromonas veronii isolates from catfish. Appl Environ Microbiol 2006; 72: 6461–6. https://doi.org/10.1128/AEM.00271-06. 17. Henriques IS, Fonseca F, Alves A, Saavedra MJ, Correia A. Occurrence and diversity of integrons and β-Lactamase genes among ampicillin-resis- tant isolates from estuarine waters. Res Microbiol 2006; 157: 938–47. https://doi.org/10.1016/j.re- smic.2006.09.003. 18. Maravić A, Skočibušić M, Šamanić I, et al. Aeromonas spp. simultaneously harboring bla(CTX-M-15), bla(SHV-12), bla(PER-1) and bla(- FOX-2), in wild-growing mediterranean mussel (Mytilus galloprovincialis) from Adriatic sea, Croa- tia. Int J Food Microbiol 2013; 166: 301–8. https:// doi.org/10.1016/j.ijfoodmicro.2013.07.010. 19. Tacão M, Correia A, Henriques I. Resistance to broad-spectrum antibiotics in aquatic systems: anthropogenic activities modulate the dissemina- tion of blaCTX-M-like genes. Appl Environ Micro- biol 2012; 78: 4134–40. https://doi.org/10.1128/ AEM.00359-12. 20. Piotrowska M, Popowska M. The Prevalence of antibiotic resistance genes among Aeromonas spe- cies in aquatic environments. Ann Microbiol 2014; 64: 921–34. https://doi.org/10.1007/s13213-014- 0911-2. 21. Wimalasena SHMP, De Silva BCJ, Hossain S, Pathirana HNKS, Heo GJ. Prevalence and char- acterization of quinolone resistance genes in Aero- monas species isolated from pet turtle in Korea. J Glob Antimicrob Resist 2017; 11: 34–8 https://doi. org/10.1016/j.jgar.2017.06.001. 22. Chung T, Yi S, Kim B, Kim W, Shin GW. Iden- tification and antibiotic resistance profiling of bac- terial isolates from septicaemic soft-shelled turtles 32 S. H. M. P. Wimalasena, G-J. Heo (Pelodiscus Sinensis). Vet Med 2017; 62: 169–77. https://doi.org/10.17221/65/2016-VETMED. 23. Bhaskar M, Dinoop KP, Mandal J. Character- ization of ceftriaxone-resistant Aeromonas spp. iso- lates from stool samples of both children and adults in southern India. J Health Popul Nutr 2015; 33: e26. https://doi.org/10.1186/s41043-015-0036-7. 24. Figueira V, Vaz-Moreira I, Silva M, Manaia CM. Diversity and antibiotic resistance of Aero- monas spp. in drinking and waste water treatment plants. Water Res 2011; 45: 5599–611. https://doi. org/10.1016/j.watres.2011.08.021. 25. Piotrowska M, Przygodzińska D, Matyjew- icz K, Popowska M. Occurrence and variety of β- lactamase genes among Aeromonas spp. isolated from urban wastewater treatment plant. Front Mi- crobiol 2017; 8: e863 https://doi.org/10.3389/ fmicb.2017.00863. 26. Puah SM, Puthucheary SD, Liew FY, Chua KH. Aeromonas aquariorum clinical isolates: antimi- crobial profiles, plasmids and genetic determinants. Int J Antimicrob Agents 2013; 41: 281–4. https:// doi.org/10.1016/j.ijantimicag.2012.11.012. 27. Han JE, Kim JH, Choresca CH, et al. Preva- lence of tet gene and complete genome sequencing of tet gene-encoded plasmid (PAHH01) isolated from Aeromonas species in South Korea. J Appl Microbiol 2012; 112: 631–8. https://doi.org/10.1111/j.1365- 2672.2012.05237.x. 28. Chopra I, Roberts M. Tetracycline antibiot- ics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Micro- biol Mol Biol Rev 2001; 65: 232–60. https://doi. org/10.1128/MMBR.65.2.232-260.2001. 29. Kim JH, Hwang SY, Son JS, et al. Molecular characterization of tetracycline- and quinolone-re- sistant Aeromonas salmonicida isolated in Korea. J Vet Sci 2011; 12: 41–8. https://doi.org/10.4142/ jvs.2011.12.1.41. 30. Chacón MR, Figueras MJ, Castro-Escar- pulli G, Soler L, Guarro J. Distribution of virulence genes in clinical and environmental isolates of Aer- omonas spp. Antonie Van Leeuwenhoek 2003; 84: 269–78. 31. Sha J. Role of various enterotoxins in Aer- omonas hydrophila-induced gastroenteritis: Gen- eration of enterotoxin gene-deficient mutants and evaluation of their enterotoxic activity. Infect Im- mun 2002;70:1924–35. https://doi.org/10.1128/ IAI.70.4.1924-1935.2002. 32. Ghenghesh KS, Ahmed SF, Cappuccinelli P, Klena JD. Genospecies and virulence factors of Aeromonas species in different sources in a north African country. Libyan J Med 2014; 9 (1): e25497. https://doi.org/10.3402/ljm.v9.25497. 33. Kirov SM, Castrisios M, Shaw JG. Aero- monas flagella (polar and lateral) are enterocyte ad- hesins that contribute to biofilm formation on sur- faces. Infect Immun 2004; 72: 1939–45. https:// doi.org/10.1128/IAI.72.4.1939-1945.2004. 34. Umelo E. Identification and molecular char- acterization of two tandemly located flagellin genes from Aeromonas salmonicida A449. J Bacteriol 1997; 179: 5292–9. 35. Pemberton JM, Kidd SP, Schmidt R. Secreted enzymes of Aeromonas. FEMS Mi- crobiol Lett 1997; 152: 1–10. https://doi. org/10.1111/j.1574-6968.1997.tb10401.x. 36. Sen K, Rodgers M. Distribution of six viru- lence factors in Aeromonas species isolated from US drinking water utilities: A PCR identification. J Appl Microbiol 2004; 97: 1077–86. https://doi. org/10.1111/j.1365-2672.2004.02398.x. 37. Vilches S, Urgell C, Merino S, et al. Com- plete type III secretion system of a mesophilic Aer- omonas hydrophila strain. Appl Environ Micro- biol 2004; 70: 6914–9. https://doi.org/10.1128/ AEM.70.11.6914-6919.2004. 38. Carvalho-Castro GA, Lopes CO, Leal CAG, Cardoso PG, Leite RC, Figueiredo HCP. Detection of type III secretion system genes in Aeromonas hydrophila and their relationship with virulence in nile tilapia. Vet Microbiol 2010; 144: 371–6. https://doi.org/10.1016/j.vetmic.2010.01.021. 39. Khor WC, Puah SM. Tan JAMA, Puthucheary S, Chua KH. Phenotypic and genetic diversity of Aeromonas species isolated from fresh water lakes in Malaysia. PLOS ONE 2015; 10 (12): e0145933. https://doi.org/10.1371/journal.pone.0145933. 33The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species ... PRISOTNOST DETERMINANT ZA DOLOČITEV DOMNEVNE VIRULENCE TER GENOV ZA OD- PORNOST NA TETRACIKLIN IN β-LAKTAM VRST Aeromonas IZOLIRANIH IZ LJUBITELJSKIH VRST ŽELV IN IZ NJIHOVEGA OKOLJA S.H.M.P Wimalasena, G-J. Heo Izvleček: Namen študije je bil določiti bakterije Aeromonas spp., izolirane iz desetih priljubljenih vrst hišnih želv in njihovega okol- ja, z namenom ocenjevanja potencialnega tveganje hišnih želv kot vira genov, povezanih z virulenco, ter determinante odpornosti proti tetraciklinom in β-laktamom. Prisotnost osmih virulentnih genov (ser, aer, exu, lip, fla, ascV, ahyB in gcat) ter genov za odpor- nost na tetracikline (tetA, tetB in tetE) in β-laktame (bla TEM , bla SHV , bla OXA in bla CTX-M ) je bila ocenjena s konvencionalnimi testi PCR. Najbolj pogost je bil Gen aerA (92 %), sledili so geni fla (75 %), gcaT (68 %), ahyB (59 %), ser (39 %), lip (37 %) in ascV (25 %). Nobeden od izolatov ni imel pomnoženega gena exu, povezanega z DNAzo. A. hydrophila, A. dharkensis, A. veronii in A. caviae so vsebovali sedem testiranih genov virulence, razen exu, medtem ko so bili v A. enteropelogenih odkriti le štirje virulenčni geni. Med 75 izolati, odpornimi na tetracikline, so bili geni tetA, tetE in tetB odkriti v 38, 26 oziroma 6 izolatih. Med preizkušenimi geni za odpornost proti β-laktamu so bili geni bla OXA in bla TEM odkriti pri 54 % oziroma 36 % izolatov, odpornih proti β-laktamu. V nobenem vzorcu nista bila zaznana gena bla CTX-M in bla SHV . Rezultati študije kažejo, da bakterije Aeromonas spp. iz hišnih želv lahko imajo potencialne virulenčne gene in gene za odpornost proti tetraciklinu in β-laktamom, in lahko potencialno ogrožajo zdravje lastnikov hišnih želv, zlasti imunsko oslabljenih posameznikov. Ključne besede: Aeromonas spp.; geni povezani z virulenco; odpornost na tetracikline; rezistenca na β-laktami; ljubiteljske vrste želv Slov Vet Res 2021: 58 (1): 35 – 41 Case Report DOI 10.26873/SVR-1148-2020 UDC 602.621:616.31-006:615:636.7 PALLIATIVE JAW-SPARING TREATMENT OF A NON-RESECTABLE CANINE ORAL FIBROSARCOMA USING COMBINATION OF ELECT- ROCHEMOTHERAPY WITH BLEOMYCIN AND IL-12 GENE ELECT- ROTRANSFER Darja Pavlin1, Ana Nemec1, Urša Lampreht Tratar2, Maja Čemazar2, Andreja Brožič2, Gregor Serša2, Nataša Tozon1* 1Small Animal Clinic, Veterinary Faculty, University of Ljubljana, Cesta v Mestni log 47, 2Department of Experimental Oncology, Institute of Oncol- ogy Ljubljana, Zaloska c. 2, 3Department of Cytopathology, Institute of Oncology Ljubljana, Zaloska c. 2, 1000 Ljubljana, Slovenia *Corresponding author, E-mail: natasa.tozon@vf.uni-lj.si Abstract: A 15-year- old male castrated English setter was presented for evaluation of a rapidly growing oral mass. Patient’s history was otherwise unremarkable, except of moderate proteinuria of 5 years duration. Clinical examination findings were within normal limits, except of an ulcerated lesion located at the left mandibular canine tooth, which was histologically con- firmed as a high grade infiltrative fibrosarcoma with high mitotic index (61/10 HPF) and multifocal necrotic areas. The client de- clined full staging, so only hematological and biochemistry examinations of blood were performed, which were within normal limits. Furthermore a fine needle aspiration biopsy of regional lymph nodes was performed, which revealed reactive lymph- adenopathy without signs of metastases. After declining other more invasive therapeutic procedures, the clients elected treat- ment with combination of electrochemotherapy and IL-12 electrogene therapy. Four consecutive treatment sessions were per- formed, resulting not only in complete response of the primary tumor, but also in regression of untreated distant metastases, which were diagnosed approximately one month after the initial examination. Furthermore, the percentage of circulating CD8+ cells was increased after each therapy session, indicating possible systemic induction of immune response by IL-12 gene ther- apy. This case shows that this type of therapy can represent an alternative type of both local and systemic treatment in selected tumor cases, where clients seek a less invasive nonsurgical treatment. Key words: dog; fibrosarcoma; electroporation; electrochemotherapy; electrogene therepy; interleukin-12 Introduction Malignant neoplasms of the oral cavity represent approximately 6% of all canine tumors, with fibrosarcoma (FSA) being one of the three most common malignant oral tumors in dogs (1). The most common site of presentation is gingiva, followed by lip, cheek and tongue (1). FSAs are reported to be primarily locally aggressive with a low potential for distant metastases. Gingival tumors can invade the bone and spread to the palate. Early diagnosed tumors (i.e., smaller tumors) are mostly treated by curative-intent surgery (2), which can be combined Received: 16 July 2020 Accepted for publication: 26 August 2020 with radiotherapy in selected cases. However, oral tumors often develop unnoticed until the tumor reaches an advanced stage, when it is often inoperable without causing significant dysfunction and cosmetic changes to the animal. In such cases, different palliative therapeutic approaches may be used, depending on the sensitivity of the tumor. Outcome of any such therapy is usually short-lived, with reportedly high recurrence rates, even over 50% and short survival times (3). Wide margin surgical excision of oral FSA as a sole therapy results in mean survival time (MST) of 12- 24 months (3, 4). Electrochemotherapy (ECT) and gene electro- transfer are techniques, where electric pulses are 36 D. Pavlin, A. Nemec, U. Lampreht Tratar, M. Čemazar, A. Brožič, G. Serša, N. Tozon used to increase cell membrane permeability to en- hance entry of the cytotoxic agents (i.e., electroche- mothrapy, ECT) and plasmid DNA (i.e., gene electro- transfer or electrogene therapy, EGT) into the cells. ECT combined with EGT with plasmid encoding in- terleukin-12 (IL-12) has already been described for the treatment of a small number of naturally occur- ring spontaneous canine oral neoplasms with en- couraging results (5, 6). Important feature of ECT and EGT with plasmid encoding IL-12 is the elicitation of the immune response, which is believed to have systemic effects. IL-12 stimulates cytotoxic T lymphocytes, which are crucial in cancer elimination (7) as they target the tumor cells and eliminate them by the action of perforin and granzyme B (8). Perforin is involved in formation of pores on the membrane of tumor cells, thus enabling the granzyme B to enter the tumor cells where it causes apoptotic tumor cell death (9). Such induction of immune response can be detected using different techniques, including flow cytometry, which utilizes gating different types of peripheral blood mononuclear cells using specific antibodies. The purpose of this case report is to describe a case of a large grade II mandibular gingival FSA in a 15-year-old dog successfully treated with ECT and EGT with plasmid encoding IL-12. Case presentation A 15-year- old male castrated English setter, weighing 22 kg, was presented to the Small animal clinic of Veterinary faculty Ljubljana for evaluation of a rapidly growing oral mass. History of the patient was unremarkable, except persistent moderate proteinuria of 5 years duration, which has been well controlled with appropriate diet and enalapril. Clinical examination findings were within normal limits, apart the large mass at the left mandibular canine tooth. The client declined full staging including head CT scan and diagnostic imaging for possible distant metastases. Therefore only partial staging was performed, including complete blood count with white blood cell count (performed using an automated laser hematology analyzer with species-specific software Advia 120, Siemens, Munich, Germany) and detailed biochemistry panel (performed using automated chemistry analyzer RX- Daytona, Randox, Crumlin, UK). Biochemistry panel consisted of serum concentrations of glucose, urea, creatinine, Na, K, Cl, Ca, total proteins, albumin and serum activity of alkaline phosphatase, alanine aminotransferase and creatine kinase. All parameters were within normal limits except moderate, clinically Figure 1: The figure is showing regression of the tumor mass at different time points. (A) tumor mass at the time of the first therapy. (B) clinical regression of the tumor at 4 weeks after the first therapy and before the second therapy. (C) four months after the first of the tumor therapy the size of the tumor significantlly decreased. (D) seven months after initial therapy complete regression could be seen 37Palliative jaw-sparing treatment of a non-resectable canine oral fibrosarcoma using combination of ... Figure 2: (A) Dental radiograph, occlusal view of the rostral mandibles at initial presentation. Geographic bone loss at the left mandibular incisor and canine teeth was visible on dental radiographs, and permeative pattern of bone loss in the symphyseal region suggested bony involvement of both rostral mandibles (T3b). Clinical assessment of radiographically abnormal (fractures or abrasion) left mandibular incisor teeth was impossible as they were embedded in the tumor mass. Right mandibular third incisor tooth is missing. (B) Dental radiograph, occlusal view of the rostral mandibles at 4 weeks. Radiographically visible severe progression of the osteolysis. Left mandibular second and third incisor teeth had exfoliated since the last visit. There is a total loss of attachment at the left mandibular first incisor tooth and near total loss of attachment at the left mandibular canine tooth, therefore these two teeth were removed (C). The round poorly mineralized structure remained, as it was hidden in the soft tissues of the tumor. (D) Dental radiograph, occlusal view of the rostral mandibles at 10 weeks. Radiographically subjectively decreased osteolysis progression irrelevant thrombocytosis (platelets 575 x 10-9/L, reference value 143-400 x 10-9/L). A detailed oral examination and dental radio- graphs with the dog under general anesthesia were performed, revealing a 4cm x 3cm x 3cm partly ul- cerated proliferative mass at the left mandibular ca- nine tooth (Figure 1). Geographic bone loss at the left mandibular incisor and canine teeth was visible on dental radiographs, and permeative pattern of bone loss in the symphyseal region suggested bony in- volvement of both rostral mandibles (T3b) (Figure 2). At the same time incisional biopsy was performed, and the mass was histologically confirmed as a high grade infiltrative FSA with high mitotic index (61/10 HPF) and multifocal necrotic areas. Fine needle as- piration biopsy of regional lymph nodes was per- formed, revealing reactive lymph nodes. After discussing possible treatment options, including bilateral rostral mandibulectomy in combination with radiotherapy, the client elected ECT and EGT. During the next four months, four therapy sessions were performed (Graph 1). Each session was performed with the dog under short (approximately 30 min) general anesthesia, starting with ECT using intravenous application of bleomycin (Blenoxane, Bristol-Myers, Princeton, USA; 3 mg/ ml) at the dose 0.3 mg/kg, followed by delivery of electric pulses with electric pulses generator Cliniporator™ (IGEA s.r.l., Carpi, Italy). Train of 8 pulses was applied, each pulse of 100 µs duration and amplitude to electric distance ratio of 1300 V/cm and frequency of repetition 1 Hz, using two parallel stainless steel plate electrodes with 6 mm distance between them. This procedure was followed 38 D. Pavlin, A. Nemec, U. Lampreht Tratar, M. Čemazar, A. Brožič, G. Serša, N. Tozon by EGT with peritumoral application of 2 mg of plasmid encoding canine IL-12 (pCMVcaIL-12) into the mucosa. The same generator of electric pulses was used to deliver electric pulses for gene delivery. Two sets of pulses were used, one high- and four low-voltage. High-voltage pulses consisted of 100 µs duration and amplitude to electric distance ratio of 600 V/cm and low-voltage pulses consisted of 100 ms and amplitude to distance ratio of 200 V/cm. Plate electrodes with 6 mm distance between them were used. Tumor regression was observed 4 weeks after the first therapy (Figure 1, Graph 1), although dental radiographs revealed progression of the osteolysis, requiring removal of the left mandibular incisor and canine teeth. After the second session, subjective decrease in osteolysis progression was also noted on dental radiographs. However, one month after the first therapy a subcutaneous metastases in the intermandibular region was diagnosed by cytopathologic examination of fine needle aspirate. In the course of the next three months tumor burden steadily decreased (Graph 1) and re-check at four months after the initial therapy revealed only ongoing mild-moderate necrosis of the treated area. Client reported minimal side effects and an improved quality of life of the dog. At this time point complete remission of both intraoral tumor as well as subcutaneous metastases was reached. The dog was euthanized 8 months after the initial combined therapy due to causes unrelated to the oral tumor and at that time point the dog was without any macroscopic evidence of either oral tumor or metastases in surrounding tissue. Necropsy was declined by the client. At different time points following each therapy (1, 2, 4 weeks and then monthly after remission was achieved), detailed bloodwork was performed, including the same hematological and biochemical parameters as at the initial staging. In addition, flow cytometry was performed on frozen whole blood collected at each visit. The lymphocytes were gated for CD45 (leukocytes), CD3 (lymphocytes T), CD4 (helper T lymphocytes) and CD8 (cytotoxic T lymphocytes) markers and the percentage of each cell population was calculated. The percentage of CD8+ cells temporarily increased after each therapy and decreased in the following weeks (Graph 1). We did not observe any change in the percentage of other cell populations. Furthermore, we used quantitative polymerase chain reaction (qPCR) with specific primers for the pCMVcaIL-12 plasmid to detect the presence of plasmid DNA in the urine, stool and oral mucosa swab samples in order to determine possible shedding of plasmid into the environment. Urine and stool samples were collected one week after each therapy and no plasmid DNA was detected in these samples. Oral mucosa swabs from the area of plasmid injection were collected immediately after the therapy and at different time points thereafter (1, 2 and 4 weeks). In the first sample maximal concentration of IL-12 plasmid detected at the site of injection was 100 ng/mL of plasmid DNA. After one week, the concentration already dropped to 0,5 pg/mL and at later time points no quantity of plasmid could be detected. Graph 1: Percentage of CD8+ cells (●) detected by flow cytometry and tumor growth rate normalised on tumor size at first visit. (▲) The percentage of CD8+ cells temporarily increased after each therapy and decreased in the following weeks after EGT therapy Discussion In this case report we describe effective use of ECT with bleomycin and EGT with canine IL-12 in the treatment of a canine oral FSA with subcutaneous metastases, resulting in complete regression of primary treated tumor as well as untreated distant metastases, which enabled marked prolongation and improved quality of the dog’s life. Oral FSA in dogs are usually fast growing neoplasms, prone to aggressive infiltrative growth. Therefore, the treatment of choice is surgical excision. However, in cases of advanced oral tumors, wide excision may cause significant cosmetic changes and, more importantly, impaired 39Palliative jaw-sparing treatment of a non-resectable canine oral fibrosarcoma using combination of ... function in the treated animal (e.g., mandibular drift after a segmental or total mandibulectomy with glossoptosis and drooling) (2). Prolonged recovery after large surgical resections, combined with usually high costs and poor outcome (high recurrence rate due to infiltrative tumor growth), makes the owners often reluctant to elect such invasive procedures, especially in older animals, as was also the case in the presented case. Based on our previous experience with treating oral and superficial cutaneous tumors in both dogs (10, 11) and cats (12) with either ECT or EGT or combined therapy, we offered this treatment combination as an alternative treatment option. The dog received four therapy sessions in the course of 4 months and was euthanized 8 months after the first session due to tumor unrelated causes. At that time, there was no evidence of local tumor growth (oral cavity, intermandibular area, regional lymph nodes). Given the rapid tumor growth upon presentation (the mass approximately doubled in size in the course of one week before initiation of the treatment), the combined treatment resulted in slower progression of the tumor, with the first evidence of tumor regression 4 weeks after instituting ECT and EGT. With subsequent treatments we were able to induce complete regression of primary lesion, as well as subcutaneous metastases, which resulted in highly improved quality of the remaining life of the animal. The pronounced cytoreductive effect of the com- bined treatment resulting in remission of described FSA can mainly be attributed to the ECT, since pre- vious studies showed excellent local antitumor effect of this type of therapy, resulting in even up to 100% of complete response (CR) rates in certain human tu- mor types (13). In veterinary medicine, a number of studies employed ECT as an antitumor treatment, in which CR rates around 70-80% were accomplished (10,11, 14). On the other hand, experience with IL- 12 EGT as a single treatment in veterinary patients is lacking. The only published study (15) reported less pronounced cytoreductive effect. In contrast to preclinical studies on laboratory animals in which IL- 12 EGT as a single therapy resulted in even 100% eradication of different tumor types (16, 17), study in canine mast cell tumors resulted in only 36% of CR rate (15). It should be emphasized that the presented case exhibited one important distinction to other reports of ECT efficacy, namely distant effect on subcutaneous untreated metastases, which, according to the current knowledge, cannot be attributed to any antitumor effect of ECT. Although it is known, that ECT causes tumor antigen shedding into surrounding tissue and blood due to ECT- induced immunogenic cell death, this is considered inadequate for prevention of the growth of distant tumors, thus resulting in antitumor effect only at local level (18, 19, 20). Therefore the distant effect of the combined therapy in our case can be attributed to immunotherapeutic effects of the procedure. It was already established, both on preclinical level as well as human clinical study, that IL-12 EGT exhibits antitumor effect on distant untreated tumors, distant metastases and even elicits long- term resistance to regrowth of tumors (17, 21). Similar distant effect on lymph node metastases was also seen in other studies, employing IL-12 EGT with or without ECT component (5, 15, 22). Immunological response to therapy was followed by flow cytometry, measuring different population of T lymphocytes. It was shown that dogs with tumors have decreased percentage of circulating CD8+ cells in comparison with healthy dogs (23). In our case the percentage of circulating CD8+ cells was increased after each session, which lasted up to 2 weeks. Therefore, the fluctuation of CD8+ cells in blood could serve as a guideline for timing repetition of the therapeutic procedure. In other studies, CD8+ cells were measured only in tumors, and the results showed the correlation between the increase of these cells in the tumor and better response of these tumors to the treatment in comparison to tumors without the increased infiltration of CD8+ cells (24, 25). It is proposed that intratumoral cytotoxic T lymophocytes migrate into the circulation reaching distant metastases where they can exert their immunological mediated tumor cell death (20). Therefore, the systemic increase of CD8+ lymphocytes could have abscopal effect on distant metastases, which was observed in our case. Therefore, the increase of CD8+ cells in blood could serve also as a predictive factor for the abscopal effect of the therapy. One of the most important aspects of any gene therapy is environmental safety of the procedure. Namely, therapeutic plasmid contains antibiotic resistance gene, which can be horizontally trans- ferred into commensal bacteria present on either treated patient’s skin or in gastrointestinal tract when treating oral tumors (26). To our best knowl- edge, only our research group addressed this aspect of safety of IL-12 EGT in clinical setting (11). In the presented case, persistence of plasmid DNA was 40 D. Pavlin, A. Nemec, U. Lampreht Tratar, M. Čemazar, A. Brožič, G. Serša, N. Tozon monitored, at the site of injection (mucosa) as well as in the feces and urine. Similar to the larger study (11), majority of the plasmid in oral mucosa swabs was detected immediately after application, with abrupt decline of its quantity in the first week and complete disappearance in the course of the second week after the procedure. Furthermore, no plasmid was detected in feces and urine, further confirming the results of our previous study (11), that the IL-12 plasmid cannot be horizontally transferred into the culturable bacteria from the patients, therefore the possibility of any environmental shedding of antibi- otic resistance gene is negligible. Conclusion In conclusion, the combination of ECT with bleomycin and EGT with IL-12 plasmid in the presented case of canine oral FSA exhibited very good local and systemic antitumor effect and was safe for the treated patient. Furthermore, potential for any environmental hazard of this type of gene therapy is negligible. Therefore, this treatment modality can represent an alternative type of therapy in selected cases, where clients seek a less invasive nonsurgical treatment of these tumors. Acknowledgements The authors acknowledge the financial support from the state budget by the Slovenian Research Agency (program no. P3-0003, P4-0053, J3-6796, J4-2546). The research was conducted in the scope of LEA EBAM (French-Slovenian European Associated Laboratory: Pulsed Electric Fields Applications in Biology and Medicine) and is a result of networking efforts within COST TD1104 Action. The authors would like to thank dr. Tanja Švara from Veterinary faculty Ljubljana for histopathologic assessment of biopsy specimens. References 1. Head KW. Histologic classification of the tumors of the alimentary system of domestic animals. Washington : Armed Forces Institute of Pathology, American Registry of Pa- thology, World Health Organization, 2003. (International Classi- fication of Tumors of Domestic Animals, 2nd ser ., Vol. 10) 2. Lommer MJ, Verstraete FJM. Principals of oral oncologic surgery. In: Verstraete FJM, Lommer MJ, eds. Oral and maxillofacial surgery in dogs and cats. Edinburgh : Saunders Elsevier, 2012: 423–30. 3. Frazier SA, Johns SM, Ortega J, et al. Outcome in dogs with surgically resected oral fibrosarcoma (1997–2008). Vet Comp Oncol 2012; 10: 33–43. 4. Gardner H, Fidel J, Haldorson G, Dernell W, Wheeler B. Canine oral fibrosarcomas: a retrospec- tive analysis of 65 cases (1998–2010). Vet Comp On- col 2013; 13: 40–7. 5. Cutrera J, Torrero M, Shiomitsu K, Mauldin N, Li S. Intratumoral bleomycin and IL-12 electrochem- ogenetherapy for treating head and neck tumors in dogs. Methods Mol Biol 2008; 423: 319–25. 6. Cemazar M, Tamzali Y, Sersa G, et al. Electro- chemotherapy in veterinary oncology. J Vet Intern Med 2008; 22: 826–31. 7. Mehrotra PT, Wu D, Crim JA, Mostowski HS, Siegel JP. Effects of IL-12 on the generation of cyto- toxic activity in human CD8+ T lymphocytes. J Im- munol 1993; 151: 2444–52. 8. Maher J, Davies ET. Targeting cytotoxic T lym- phocytes for cancer immunotherapy. Br J Cancer 2004; 91: 817–21. 9. Trapani JA, Smyth MJ. Functional significance of the perforin/granzyme cell death pathway. Nat Rev Immunol 2002; 2: 735–47. 10. Kodre V, Cemazar M, Pecar J Sersa G, Cor A, Tozon N. Electrochemotherapy compared to surgery for treatment of canine mast cell tumours. In Vivo 2009; 23: 55–62. 11. Cemazar M, Ambrozic Avgustin J, Pavlin D, et al. Efficacy and safety of electrochemotherapy com- bined with peritumoral IL-12 gene electrotransfer of canine mast cell tumours. Vet Comp Oncol 2017; 15(2): 641–54. doi: 10.1111/vco.12208. 12. Tozon N, Pavlin D, Sersa G, et al. Electroche- motherapy with intravenous bleomycin injection: an observational study in superficial squamous cell car- cinoma in cats. J Feline Med Surg 2014; 16: 291–9. 13. Mali B, Jarm T, Snoj M, Sersa G, Miklavcic D. Antitumor effectiveness of electrochemotherapy: a systematic review and meta-analysis. Eur J Surg Oncol 2013; 39: 4–16. 14. Spugnini EP, Azzarito T, Fais S, Fanciulli M, Baldi A. Electrochemotherapy as first line cancer treatment: Experiences from veterinary medicine in developing novel protocols. Curr Cancer Drug Tar- gets 2015; 16: 43–52. 15. Pavlin D, Cemazar M, Cör A, Sersa G, Poga- cnik A, Tozon N. Electrogene therapy with interleu- kin-12 in canine mast cell tumors. Radiol Oncol 2011; 45: 31–9. 41Palliative jaw-sparing treatment of a non-resectable canine oral fibrosarcoma using combination of ... I trial of interleukin-12 plasmid electroporation in patients with metastatic melanoma. J Clin Oncol 2008; 26: 5896–903. 22. Cutrera J, King G, Jones P, et al. Safe and ef- fective treatment of spontaneous neoplasms with in- terleukin 12 electro-chemo-gene therapy. J Cell Mol Med 2015; 19: 664–75. 23. O‘Neill K, Guth A, Biller B, Elmslie R, Dow S. Changes in regulatory T cells in dogs with cancer and associations with tumor type. J Vet Intern Med 2009; 23: 875–81. 24. Fridman WH, Pagès F, Sautès-Fridman C, Galon L. The immune contexture in human tu- mours: impact on clinical outcome. Nat Rev Cancer 2012; 12: 298–306. 25. Giraldo NA, Becht E, Remark R, Damotte D, Sautès-Fridman C, Fridman WH. The immune con- texture of primary and metastatic human tumours. Curr Opin Immunol 2014; 27: 8–15. 26. Oliveira PH, Mairhofer J. Marker-free plasmids for biotechnological applications: implications and perspectives. Trends Biotechnol 2013; 31: 539–47. 16. Lucas ML, Heller L, Coppola D, Heller R. IL- 12 plasmid delivery by in vivo electroporation for the successful treatment of established subcutaneous B16.F10 melanoma. Mol Ther 2002; 5: 668–75. 17. Pavlin D, Cemazar M, Kamensek U, Tozon N, Pogačnik A, Serša G. Local and systemic antitumor effect of intratumoral and peritumoral IL-12 electro- gene therapy on murine sarcoma. Cancer Biol Ther 2009; 8: 2114–22. 18. Campana LG, Mocellin S, Basso M, et al. Bleomycin-based electrochemotherapy: clinical out- come from a single institution’s experience with 52 patients. Ann Surg Oncol 2009; 16: 191–9. 19. Calvet CY, Famin D, André FM, et al. Elec- trochemotherapy with bleomycin induces hallmarks of immunogenic cell death in murine colon can- cer cells. Oncoimmunology 2014; 3: e28131. doi: 10.4161/onci.28131 20. Sersa G, Teissie J, Cemazar M, et al. Elec- trochemotherapy of tumors as in situ vaccination boosted by immunogene electrotransfer. Cancer Im- munol Immunother 2015; 64: 1315–27. 21. Daud AI, DeConti RC, Andrews S, et al. Phase PALIATIVNO ZDRAVLJENJE NERESEKTABILNEGA FIBROSARKOMA SPODNJE ČELJUSTI PRI PSU S KOMBINACIJO ELEKTROKEMOTERAPIJE Z BLEOMICINOM IN GENSKEGA ELEKTRO- PRENOSA IL-12 D. Pavlin, A. Nemec, U. Lampreht Tratar, M. Čemazar, A. Brožič, G. Serša, N. Tozon Izvleček: Petnajstleni kastrirani angleški seter je bil na našo kliniko sprejet z namenom pregleda hitro rastoče novotvorbe v ustni votlini. Pes ni imel pomembnejših sočasnih bolezni, razen zmerne proteinurije zadnjih pet let. Fizikalni pregled ni pokazal nikakršnih odstopanj z izjemo ulcerirane novotvorbe na področju levega mandibularnega grabilca. Histološka diagnoza no- votvorbe je bila infiltrativni fibrosarkom visoke stopnje z visokim mitotičnim indeksom (61/10 v polju visoke povečave) in multifoka- lnimi nekrotičnimi področji. Skrbnik psa je zavrnil popolno določitev stadija bolezni, zato smo izvedli le osnovne hematološke in biokemijske preisakve, ki niso pokazale pomembnejših odstopanj. Izvedli smo tudi tankoligelno biopsijo regionalnih bezgavk, ki je pokazala reaktivno limfadenopatijo brez znakov prisotnosti zasevkov. Po predstavitvi vseh možnosti zdravljenja se je lastnik odločil za zdravljenje s kombinacijo elektrokemoterapije in genskega elektroprenosa IL-12. Izvedli smo štiri zaporedne cikluse kombinirane terapije, s katero smo dosegli ne le popolni odgovor primarnega tumorja, pač pa tudi regresijo nezdravljenih odd- aljenih podkožnih metastaz, ki so se pojavile približno mesec dni po začetku terapije. Poleg tega smo po vsaki terapiji ugotovili povečan delež cirkulirajočih CD8+ celic, kar lahko nakazuje na to, da je genska terapija z IL-12 sprožila sistemski imunski odziv. Predstavljeni primer kaže, da lahko kombinacija elektrokemoterapije in genskega elektroprenosa IL-12 predstavlja alternativno obliko tako lokalnega kot sistemskega zdravljenja določenih novotvorb, zlasti v primerih, ko skrbnik živali želi manj invazivne tera- pevtske postopke. Ključne besede: pes; fibrosarkom; elektroporacija; elektrokemoterapija, genski eletroprenos; interlevkin-12 SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK Slov Vet Res 2021; 58 (1) Original Research Articles Kirkiłło-Stacewicz K, Nowicki W, Wach J. Telencephalon vascularity in dog (Canis lupus f. familiaris) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Arshed M, Nasir S, Hussain T, Babar MI, Imran M. Comparison efficacy of synthetic chemicals and plant extracts for tick control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .13 Wimalasena S H M P, Heo G-J. The presence of putative virulence determinants, tetracycline and β-lactams resistance genes of Aeromonas species isolated from pet turtles and their environment . . . . . . . . . . . . . . . . . . . . . . . 25 Case Report Pavlin D, Nemec A, Lampreht Tratar U, Čemazar M, Brožič A, Serša G, Tozon N. Palliative jaw-sparing treatment of a non- resectable canine oral fibrosarcoma using combination of electrochemotherapy with bleomycin and IL-12 gene electrotransfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35