COBISS: 1.08 Agris category code: L10
CHARACTERIZATION OF EXON 14 AND INTRON 5 OF THE SREBP-1 GENE IN SARDA BREED SHEEP
Giovanni COSSO Cinzia DAGA Sebastiano LURIDIANA Maria Consuelo MURA Sara BODANO Marta PALUDO Maria Luisa DIAZ Giuseppe Massimo VACCA 2, Vincenzo CARCANGIU 2
ABSTRACT
SREBP-1 (Sterol Regulatory Element Binding Protein) is a transcription factor that regulates the expression levels of some genes and plays a central role in energy homeostasis. The aim of the present study was to screen for single nucleotide polymorphisms (SNPs) or insertions/deletions in the exon 14 and intron 5 of the SREBP-1 in Sarda sheep breed. Two-hundred multiparous ewes were randomly chosen from four farms located in Sardinia. From each ewe a blood sample was taken to perform DNA extraction and PCR-SSCP analysis of the fragments above. 20 PCR products for each fragment were sequenced in both directions, then compared and aligned with sequence of Bos taurus (GenBank AAFC03008483). Five nucleotide substitution (G19C, G22A, C52T, G53A and A68G) in the exon 14 and eighteen (C20T, G23A, T25G, G26A, C35G, C39G, A64G, T109C, T179C, G185A, G220A, G229A, G241A, G245A, G250A, C287T, A298T and G300A) in the intron 5 were detected in the sheep sequence compared to cattle. In the intron 5 of sheep SREBP-1 gene no deletion was found. Our data evidenced no variation in exon 14 and intron 5 of the SREBP-1 gene in Sarda sheep contrarily to that found in cattle. However, to extend the knowledge about SREBP-1 gene in this breed of sheep it would be necessary to enlarge the number of samples and to study other parts of this gene.
Key words: sheep / breeds / Sarda sheep breed / molecular genetics / SREBP-1 gene / milk traits
1 introduction
Sterol regulatory element binding proteins (SREB-Ps) are transcription factors that play a key role in the energy homeostasis by promoting glycolysis, lipogenesis, and adipogenesis. SREBPs belong to the original basic helix-loop-helix-leucine zipper family of transcription factors (Eberle et al., 2004). In human, the family consists of two genes: SREBP-1, mapped to chromosome 17 (Hua et al. 1995) and involved in the lipid synthesis (Shimano et al. 1996, 1997), and SREBP-2, mapped to chromosome 22 (Miserez et al. 1997) and involved in regulation of cholesterol biosynthesis (Horton et al. 1998). In human and mouse, the SREBP-1 gene produces two proteins by alternative splicing, SREBP-1a and 1c (Eberle et al. 2004). It has been known that SREBPs regulate gene transcription activation by binding to Sterol Regulatory Element (SRE)
sequences (5'-TCACNCCAC-3') contained in the promoter of their downstream genes, including the Stearoyl-CoA Desaturase (SCD) gene (Shimano 2001). Therefore, differences in expression level and/or mutation(s) in the SREBP gene may affect the expression level of SCD gene, leading to differences in fatty acid composition in the adipose tissue of cattle (Ohsaki et al., 2009). Furthermore, in cattle, mutations in this gene within intron 5 and exon 14, were found to be associated with fat content of milk (Cecchinato et al., 2012; Rincon et al., 2012; Shogo et al., 2007).In sheep, however, the SREBP-1 gene is still little studied and its relationship with production traits is not yet well known. Thus, the aim of this paper was to study the exon 14 and the intron 5 of SREBP-1 gene in order to highlight possible SNPs and their correlation with the milk traits.
1	Dipartimento di Medicina Veterinaria, Universita degli Studi di Sassari, Via Vienna 2, 07100, Sassari, Italia
2	Same address, e-mail: endvet@uniss.it
2 material and methods
2.1	ANIMALS AND SAMPLING
The study has been conducted on 200 ewes of Sarda breed from four farms located in Sardinia. During the day the animals grazed on leguminous and gramineous grasses, moreover they received, as supplement, 300 g/head/day of concentrate commercial food (crude protein 20.4% and 12.5 MJ ME/kg DM) in two doses, during the morning and the evening milking. The sheep were penned at night when they had free access to hay (crude protein 11.1% and 7.2 MJ ME/kg DM), and water. Animals used were 4 to 5 years old, multiparous, lactat-ing and in their third to fifth lactation. A jugular blood sample was collected from each ewe using vacuum tubes with EDTA as an anticoagulant (BD Vacutainer Systems, Belliver Industrial Estate, Plymouth, UK). On day 30 and 60 from lambing individual milk yield has been recorded and for each sample content of fat, protein and lactose were analysed (CombiFoss 6000, Foss Electric, Denmark).
2.2	DNA EXTRACTION AND AMPLIFICATION
Genomic DNA was extracted from whole blood using a commercial DNA extraction kit (Genomic DNA from blood, Macherey-Nagel Germany) and then kept at -20 °C until use. Primers for exon 14 were designed using Primer3-plus software (Ex14 forward : 5'-AGCCAT-GTTGACCGCCTGT-3' and reverse: 5'-GCAGAAACT-CAGCCACACTG-3'); Primers for intron 5 were forward: 5'-CCACAACGCCATCGAGAAACGCTAC-3' and reverse: 5'-GGCCTTCCCTGACCACCCAACTTAG-3' (Barton et al., 2010). An aliquot of 100 ng of genomic DNA was used for the amplification of the exon 14 and the intron 5 of the SREBP-1 gene. The PCR reaction for both fragments were carried out in 25 ^l volume containing 2.5 ^l of 10x PCR Buffer (20 mM Tris-HCl (pH 8.0), 40 mM NaCl, 2 mM Sodium Phosphate, 0.1 mM EDTA, 1 mM DTT, stabilizers, 50% (v/v) glycerol), 0.5 ^l of each primer 10 ^M for exon 14 and 1.25 ^l for intron 5,4 ^l of each dNTP 1.25 mM, 0.75 ^l of MgCl2 50 mM; 1.25U of Taq DNA polymerase (Platinum® Taq DNA Polymerase, In-vitrogen, Carlsbad, CA, USA). PCR conditions were as follows: denaturation at 95 °C for 2.5 min followed by 35 cycles of denaturation at 95 °C for 20s, annealing at 61 °C for 30s, extension at 72 °C for 16s, and a final extension at 72 °C for 10 min (Mastercycler epgradient S, Eppendorf AG, Hamburg, Germany) for the exon 14; denaturation at 94 °C for 2 min followed by 35 cycles of denaturation at 94 °C for 30s, annealing at 60 °C for 30s, extention at
72 °C for 1 min, and a final extension at 72 °C for 7 min (Mastercycler gradient S, Eppendorf AG, Hamburg, Germany) for the intron 5. Electrophoresis of PCR products were performed in 1.5% (w/v) agarose gel (GellyPhor, Euroclone, UK), in parallel with 100 bp DNA marker (Invitrogen, Carlsbad, CA, USA), in 1X TBE buffer at a constant voltage of 100V for 30 min. After ethidium bromide coloration, products were visualized by using of ultraviolet transilluminator (UVItec, Cambridge, UK).
2.3 SSCP ANALYSIS
Aliquots of 4.0 ^l of PCR products, of both fragment of each ewe, were later denatured at 95 °C for 10 min in a 6.0 ^l denaturing solution containing 1 mg/ml xylene-cyanole (SIGMA-ALDRICH Corporation, St. Louis, Missouri, USA), 1 mg/ml bromophenol blue (Pharmacia Biothec, Uppsala, Sweden) and 25 mM EDTA (pH 8) 95% formammide (SIGMA-ALDRIC Corporation, St. Louis, Missouri, USA) and chilled on ice. Single Strand Conformation Polymorphism (SSCP) analysis, has been conducted using the vertical electrophoresis DCodeTM Universal Mutation Detection System for SSCP (BioRad Laboratories, Segrate, MI, Italy). Denatured DNAs were subject to electrophoresis at constant voltage (25W, 1000V, 150 mA), in a 15% acrylamide gel of 40 ml: 40% acrylammide solution (acrylamide/bis-acrylamide 37,5:1) 15 ml; 1X TBE (Tris-borate-EDTA) buffer 8 ml; glycerol 2 ml; Temed (Tetramethylethylenediamine) 40 ^l and 10% APS (Ammonium Persulfate) 200 ^l and pure water 14.76 ml. Running time was 20h; running temperature was 15 °C. The gels were stained with syber gold 1X for 30 min. 20 PCR products of each fragment were purified and sequenced using a commercial service in forward and reverse directions.
2.4 STATISTICAL ANALYSIS.
These data, normally distributed (P > 0.05, Ander-son-Darling'test), were expressed as mean ± standard deviation (SD). Statistical analysis was performed using R-Project software (The R Foundation for Statistical Computing, R-2.13.1 ). ANOVA (one-way) was used to analyse the time variation of milk yield, protein, fat and lactose contents.
3 results
The resulting fragments were of 222bp for exon 14 and 432bp for intron 5 (Fig. 1).
No differences were found in the SSCP analysis for both fragments, as they always showed the same migration patterns. The sequencing confirmed the amplification of the desired gene sections and no differences emerged from the comparison among the obtained sequence. Five nucleotide substitution (G19C, G22A, C52T, G53A and A68G) in the exon 14 and eighteen (C20T, G23A, T25G, G26A, C35G, C39G, A64G, T109C, T179C, G185A, G220A, G229A, G241A, G245A, G250A, C287T, A298T and G300A) in the intron 5 were detected in the sheep sequence compared to cattle (GenBank
AAFC03008483) (Fig 2). After sequence comparison between cattle and Sarda sheep a 89% genetic similarity was revealed. The milk yield, the content of fat, protein and lactose showed no differences in the time of collection.
4 discussion
Identifying the genes responsible for phenotypic variation is important not only to increase our understanding about milk fatty acids synthesis, but also to in-
Exon 14
10	3D	ta	39	iO	70	11	99
.... I .... I .... I .... I .... I .... I .... 1 .... I .... I .... I .... I .... I .... I .... 1 .... I .... I .... I .... I
Bos taurus GGAGTTCTCACATCCCCTGCGGTACCTGCACCTGCTGAACACCTGTTCCGACCTCGCCGCACCTCCTACCTGCACCTTCTCCATCAGCTC Ovis aries ...............C..A........................TA.............G..................
IDS	130
Boa taurus CACCATCCCTGCCACCCCCC Ovis aries ....................
Intron 5
ID	10	30	40	99	EG	70	89	99
.... I .... I .... I .... I .... t .... 1 .... I .... I .... I .... I .... I . . . . I . . . . I . ... I . . . . I . . . . I . . . . I .... I
Bos taurus CTCTGCGCTGAGCCCCTAACACCGTGGCTCTCGCCAAGCAGCCACCTG<^GGAGGAGGACGAAGATGGGGCTGGGCAGACACTCCTCGC Ovis aries ...................T. .A.CA........G .G...................G............. .........
190	110	130	133	149	199	ISO	170	110
.... I .... I .... I .... t .... I .... I .... I ... I .... I .... I ----I ----( .... I .... I .... I .... I .... [ ... t
Bos taurus GCCCCAGCCTCCTCGGGCTTGGCAGCTCTGTTCAGCTGAGCTTCAGGGAAGCCCCGGGTGGCACAGGCTCTTCCAGGTGCTGGGGATTTA Ovis aries .................C. . . .............................................................C
190	300	310	320	239	249	230	260	270
.... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I .... I
Bos taurus GCAGGCGACAGACAGAGATCC'TCCTG'rTGAO'TAGCTGACG'rTCTAGCAGGGTGCGGGGGCGCCAGCAGAGCTGGGTTGGGGTACGCCAGG Ovis aries . . .A.................................A........T...........A. . .A. . .C..................
2 B0	290	300	310	320	330	340
Bos taurus TGCCATAAGTGCTGTGCTGGAGAGAAGAGGGATGGGGGAAGTTGCAAACCTAAGTTGGGTGGTCAGGGAAGGCC Ovis aries ................T..........T.A............................................
Figure 2: Comparative sequence analysis of exon 14 and intron 5 of the SREBP-1 gene between cattle and Sarda sheep
crease milk-fat contents in ruminants (Bionaz and Loor,
2008).	Among the genes indirectly involved in the milk fat synthesis, the SREBP-1 is of great importance because it regulates the transcription of several genes in the mammary gland including the SCD gene (Hoashi et al., 2007). Therefore mutation(s) of the SREBP gene may affect the expression level of SCD, leading to differences in fatty acids composition both in tissue and milk in cattle (Conte et al., 2010). Indeed the 84-bp deletion in intron 5 of the bovine SREBP-1 gene could indirectly contribute to fat quality characteristics in cattle, affecting the level of translation efficiency of SREBP-1 itself (Hoashi et al. 2007; Cecchinato et al., 2012). Moreover mutations in exon 14 of the SREBP-1 gene in cattle determine an influence on milk fat content (Rincon et al., 2012). Our data about Sarda sheep are not in agreement with that found in cattle, because the exon 14 and the intron 5 lack differences in their nucleotide sequences. This could be due intense genetic selection of Sarda breed sheep aimed to improve its milk traits, both for quantity and quality (Carta et al.,
2009).	Indeed this dairy breed produces large amounts of milk, with high fat content (more than 6%). The lack of 84bp deletion within the intron 5 confirmed this, but is not applicable for that found in the exon 14. In fact in our sample of the Sarda breed sheep only CC genotype in position 66 was found, which causes a lower fat concentration in cow's milk (Rincon et al., 2012). Probably the C allele in sheep does not determine an influence such as to diminish fat contents unlike in cattle.
In conclusion our data evidenced that in the analyzed fragments of the SREBP-1 gene in Sarda sheep breed there are no variation, contrarily to that found in cattle. However, in order to deepen the knowledge about SREBP-1 in this sheep, the expansion of sampling and the study of other parts of this gene are necessary.
5 acknowledgement
This work was supported by a grant from Regione Autonoma della Sardegna (L.R.7/2007).
6 references
Barton L., Kott T., Bures D., Rehak D., Zahradkova R., Kottova B. 2010. The polymorphisms of stearoyl-CoA desaturase (SCD1) and sterol regulatory element binding protein-1 (SREBP-1) genes and their association with the fatty acid profile of muscle and subcutaneous fat in Fleckvieh bulls. Meat Science, 85: 15-20 Bionaz M., Loor J.J. 2008. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics, 9: 366
Carta A., Casu S., Salaris S. 2009. Invited review: Current state of genetic improvement in dairy sheep. Journal of Dairy Science, 92: 5814-5833 Conte G., Mele M., Chessa S., Castiglioni B., Serra A., Pagnac-co G., Secchiari P. 2010. Diacylglycerol acyltransferase 1, stearoyl- CoA desaturase 1, and sterol regulatory element binding protein 1 gene polymorphisms and milk fatty acid composition in Italian Brown cattle. Journal of Dairy Science, 93: 753-763 Cecchinato A., Ribeca C., Maurmayr A., Penasa M., De Marchi M., Macciotta N. P. P., Mele M., Secchiari P., Pagnac-co G., Bittante G. 2012. Short communication: Effects of p-lactoglobulin, stearoyl-coenzyme A desaturase 1, and ste-rol regulatory element binding protein gene allelic variants on milk production, composition, acidity, and coagulation properties of Brown Swiss cows. Journal of Dairy Science, 95: 450-454
Eberle D., Hegarty B., Bossard P., Ferre P., Foufelle F. 2004. SREBP transcription factors, master regulators of lipid ho-meostasis. Biochimie, 86: 839-848 Hoashi S., Ashida N., Ohsaki H., Utsugi T., Sasazaki S., Tani-guchi M., Oyama K., Mukai F., Mannen H. 2007. Genotype of bovine sterol regulatory element binding protein-1 (SREBP-1) is associated with fatty acid composition in Japanese Black cattle. Mammalian Genome, 18: 880-886 Hua X., Wu J., Goldstein J.L., Brown M.S., Hobbs H.H. 1995. Structure of the human gene encoding sterol regulatory element binding protein-1 (SREBF1) and localization of SREBF1 and SREBF2 to chromosomes 17p11.2 and 22q13. Genomics, 25: 667-673 Miserez A.R., Cao G., Probst L.C., Hobbs H.H. 1997. Structure of the human gene encoding sterol regulatory element binding protein- 2 (SREBF2). Genomics, 40: 31-40 Ohsaki H., Tanaka A., Hoashi S., Sasazaki S., Oyama K., Tani-guchi M., Mukai F., Mannen H. 2009. Effect of SCD and SREBP genotypes on fatty acid composition in adipose tissue of Japanese Black cattle herds. Animal Science Journal, 80: 225-232
Rincon G., Islas-Trejo A., Castillo A.R., Bauman D.E., German B.J., Medrano J.F. 2012. Polymorphisms in genes in the SREBP1 signalling pathway and SCD are associated with milk fatty acid composition in Holstein cattle. Journal of Dairy Research, 79: 66-75 Shimano H. 2001. Sterol regulatory element-binding proteins (SREBPs), transcriptional regulators of lipid synthetic genes. Progress in Lipid Research, 40: 439-452 Shimano H., Horton J.D., Hammer R.E., Shimomura I., Brown M.S., Goldstein J.L. 1996. Overproduction of cholesterol and fatty acids causes massive liver enlargement in trans-genic mice expressing truncated SREBP-1a. Journal of Clinical Investigation, 98: 1575-1584 Shimano H., Horton J.D., Shimomura I., Hammer R.E., Brown M.S., Goldstein .JL. 1997. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. Journal of Clinical Investigation, 99: 846-885