doi:10.14720/aas.2020.116.1.1593
Original research article / izvirni znanstveni članek
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
Mahmood YASAMAN \ Hossein ABBASPOUR 1 2, Maryam PEYVANDI \ Mohammad Reza NAGHAVI 3
Received April 06, 2020; accepted June 22, 2020. Delo je prispelo 06. aprila 2020, sprejeto 22. junija 2020.
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
Abstract: The traditional medicinal herb, Hypericum perforatum L. has been popular for its pharmaceutical and coloring wealth since the ancient era. A secondary metabolite from the group of naphthodianthrones in Hypericum spp. named hypericin is responsible for the antidepression, anticancer, and antiviral characteristics of this herb. It has been found that several genes are involved in the biosynthesis pathway of hypericin. The hyp-1 gene is participating in this biosynthesis path through the conversion of emodin to hypericin. The naphtho-dianthrones (hypericin and pseudohypericin) in Hypericum are synthesized through the polyketide pathway. In the plants, the enzyme complexes named polyketide synthase (PKS) catalyzes the reactions of polyketide pathways. The genes HpPKS1 and HpPKS2 are encoding PKS enzyme complexes. In this research, the relative expression of hyp-1, HpPKS1, and HpPKS2 genes was compared in root and leaves of Hypericum perforatum and H. androsaemum L., before and after flowering under urea fertilization at 24, 48 and 72 hours after irrigation. The highest expression level of all three genes was observed after flowering in the samples of H. perforatum that were fertilized 72 hours after irrigation by 1 g l-1 urea (hyp-1 in roots; HpPKS1 and Hp-PKS2 in leaves). The relative expression of hyp-1 in the root was greater than in the leaves, but HpPKS1 and HpPKS2 expression in leaves was higher than in root. The relative expression of all three genes in H. perforatum was higher than in H. androsaemum. By increasing the interval between urea fertilization and irrigation, the relative expression of genes had an increasing trend, also by increasing the amount of urea fertilizer, relative gene expression was increased.
Key words: Hypericum; hypericin; hyp-1 HpPKS1; Hp-PKS2; transcriptional diversity
preučevanje raznolikosti izražanja genov pri dveh vrstah krč-nic (Hypericum spp.) pred in po cvetenju v razmerah različnega gnojenja z dušikom
Izvleček: Šentjanževka (Hypericum perforatum L.) je že od nekdaj popularna kot tradicionalno zdravilno zelišče zaradi svojih farmacevtskih in barvilnih lastnosti. Sekundarni metabolit iz skupine naftodiantronov v vrstah iz rodu Hypericum imenovan hipericin je odgovoren za antidepresivne, anti-kancerogene in antivirusne lastnosti tega zelišča. Ugotovljeno je bilo, da so pri biosintezi hipericina udeleženi številni geni. Gen hyp-1 sodeluje pri tej biosintezi preko pretvorbe emodina v hipericin. Naftodiantrona (hipericin in pseudohipericin) se v šentjanževki sintetizirata po poliketidni poti presnove. V rastlinah katalizira reakcije poliketidne presnovne poti encimski kompleks poliketid sintaza (PKS). Gena HpPKS1 in HpPKS2 kodirata PKS encimski kompleks. V tej raziskavi je bila primerjana relativna ekspresija genov hyp-1, HpPKS1, in HpPKS2 v koreninah in listih vrst Hypericum perforatum in H. androsaemum L., pred in po cvetenju, pri gnojenju z ureo 24, 48 in 72 ur po zalivanju. Največja ekspresija vseh treh genov je bila opažena po cvetenju v vzorcih vrste H. perforatum, 72 ur po tem, ko je bila rastlina fertirigirana z 1 g l-1 uree (hyp-1 v koreninah; Hp-PKS1 in HpPK (v listih). Relativna ekspresija hyp-1 v koreninah je bila večja kot v listih, a ekspresija genov HpPKS1 in HpPKS2 v listih je bila večja kot v koreninah. Relativna ekspresija vseh treh genov je bila v vrsti H. perforatum večja kot v vrsti H. androsaemum. S povečevanjem intervala med gnojenjem z ureo in zalivanjem se je pokazal trend naraščajoče ekspresije genov, kar se je pokazalo tudi s povečevanjem odmerka uree.
Ključne besede: Hypericum; hipericin; hyp-1 HpPKS1; HpPKS2; transkripcijska raznolikost
1	Islamic Azad University, Faculty of Biologica Sciences, North Tehran Branch, Department of Biology, Tehran, Iran
2	Corresponding author, e-mail: abbaspour75@yahoo.com
3	University of Tehran, Agricultural & Natural Resources College, Agronomy and Plant Breeding Department, Karaj, Iran
Acta agriculturae Slovenica, 116/1, 107-114, Ljubljana 2020
M. YASAMAN et al.
Abbreviations: AF: Sampling after flowering; BF: Sampling before flowering; 0: Non-fertilized; 0.5-24: 0.5 g l-1 urea fertilizer was used 24 hours after irrigation; 1-48: 1 g l-1 urea fertilizer was used 48 hours after irrigation. [Hp]: Hypericum perforatum; [Ha]: Hypericum androsaemum. cDNA: complementary DNA; DNA: Deoxyribonucleic acid; ds/m: deciSiemens per meter; g l-1: grams per liter; HpPKS1: Polyketide synthase I; HpPKS2: Polyketide synthase II; ppm: parts per million; RNA: Ribonucleic acid; rRNA: Ribosomal ribonucleic acid; SAS: Statistical Analysis System
Okrajšave: AF: vzorčenje po cvetenju; BF: vzročenje pred cvetenjem; 0: negnojeno; pognojeno s 0,5-24: 0,5 g l-1 uree 24 ur po zalivanju; 1-48:pognojeno z 1 g l-1 uree 48 ur po zalivanju. [Hp]: Hypericum perforatum; [Ha]: Hypericum androsaemum. cDNA: komplementarna DNK; DNA: Deoksiribonukleinska kislina; ds m-1: deci Siemens na meter; g l-1: grami nar liter; HpPKS1: Poliketidna sintaza I; HpPKS2: Poliketidna sintaza II; ppm: delci na miljon; RNA: Ribonukleinska kislina; rRNA: Ribosomalna ribonukleinska kislina; SAS: Sistem statistične analize
1 introduction
Medicinal plants are one of the most important potential sources of drugs that have been used since ancient times. The World Health Organization estimates that more than 80 percent of people use medicinal herbs through traditional or modern ways. Also, many chemical drugs are also made by modeling plant compounds (Samuelsson & Bohlin, 2017). In recent years, the increasing tendency to use medicinal herbs and their compounds have been observed, and currently, more than 40 percent of the drugs used in the advanced western countries are herbaceous origin (Khosh-Khui et al., 1984). Identifying and investigating the chemical compounds of medicinal plants, not only helps to treat diseases more easily and cheaply, but also leads to a decline in drug imports. Iran, with its special climatic conditions, has a vast abundance of local medicinal herbs and is a source of rich potential for these plants.
The genus Hypericum (Hypericaceae family) consists of 496 worldwide species (Nurk et al., 2013; Ruhfel et al., 2013), of which 17 species have been reported from Iran and most of them have antioxidants (Silva et al., 2005), antiviral (Birt et al., 2009), an antidepressant (Butterweck, 2003) and anticancer compounds (Agostinis et al., 2002). Most of these medicinal properties are due to the presence of a group of hydrosoluble secondary metabolites, which are often present in the flowers of this perennial herb (Lazzara et al., 2015). Hypericum perforatum L. is one of the traditional medicinal herbs that has been used since ancient times because of its secondary metabolites and coloring properties. Hypericum is one of the most important sources of dye in dyeing industries and is used for coloring silk and wool in red. The boiling of the vegetative body of Hypericum with greenery leads to the formation of yellow color for the dyeing industry (Duke, 2002; Russo et al., 2014).
Hypericin is the key biochemical compound used to determine the quality of the extract of Hypericum (Dup-pong et al., 2004), and it has been shown that the number of dark glands in the leaf is correlated with hypericin content (Briskin & Gawienowski, 2001). Hypericin is
probably the strongest natural light-sensitive substance (photosensitizer) that has been identified so far, the photosensitizers are used in photodynamic therapy of cancers (Agostinis at al., 2002; Karioti & Bilia, 2010). Although the function of hypericin in Hypericum species is not yet fully understood, it has been suggested that this compound plays a defensive role against herbivorous organisms and plant pathogens (Sirvent et al., 2003; Bruni & Sacchetti, 2009). Through a chemical defense system, the phytophagous insects feeding on H. perforatum leaves produced more antioxidant enzymes under oxidative stress caused by hypericin photosensitization. Hypericin in sunlight interact with oxygen molecules to produce oxygen free radicals and create oxidative stress, which causes phytophagous insects' behavioral avoidance feeding on the plant tissue (Guillet et al., 2000). To determine the possible role of hypericin in the defensive response of H. perforatum, the effects of elicitors such as salicylic acid (SA) and methyl jasmonate (MeJA) on the production of secondary metabolites in H. perforatum were evaluated, which resulted in increased levels of hy-pericin in certain concentrations of SA and MeJA (Sir-vent & Gibson, 2002). Hypericin provides the energy and health for human consumers and considerably enhances the human body's defensive ability through increasing cellular oxygen absorption and vascular respiration (Miskovsky, 2002: Agostinis at al., 2002). Regarding the photodynamic properties of hypericin, this metabolite has therapeutic potential as an antiviral, antiretroviral, and anticancer agent (Zhang et al., 2016, Jendzelovska et al., 2016; Kubin et al., 2005). Hypericin, a valuable poly-cyclic dianthroquinone, is responsible for the antidepression and antiviral characteristics (Rahnavrd, 2017).
Studies have shown that the hyp-1 gene is one of the most important genes involved in the pathway of hypericin biosynthesis, which encodes for phenolic coupling protein, that is catalyzed in vitro and specifically convert emodin to hypericin (Bais et al., 2003; Zhang et al., 2018; Michalska et al., 2010). The production of emo-din anthrone, an anthraquinone which is a precursor for hypericins biosynthesis (Falk, 1999), proceeds through a polyketide pathway that is catalyzed by HpPKS1 and Hp-
84
92 Acta agriculturae Slovenica, 116/1 - 2020
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
PKS2 (Zobayed et al., 2006; Michalska et al., 2010). Recently, it was proposed that probably the function of the Hyp-1 protein is more likely associated with the reserving or carrying of hypericin in the cell than in the real biosynthesis of hypericin (Michalska et al., 2010).
In detail, the octa-^-ketoacyl chain is made from acetyl-CoA plus malonyl-Coa that catalyzed by polyke-tide synthase (PKS). After several steps emodin is made, phenolic oxidative coupling protein (Hyp-1) catalyzes the emodin anthrone production from emodin, then Hyp-1 catalyzes the emodin anthrone conversion to pro-tohypericin, and finally, Hyp-1 catalyzes the formation of hypericin from protohypericin. Therefore the genes hyp-1, HpPKSl, and HpPKS2 are playing important roles in hypericin biosynthesis (Rahnavrd, 2017).
Through enhancing some components of a plant, such as increasing the plant secondary metabolites producing parts consequently will rise the accumulation of active ingredients and bioactive compounds (Jabbari et al., 2011). some environmental factors like nitrogen fertilization play an important role in improving secondary metabolites content. some nutrients (nitrogen and iron) can increase the amount and quality of essential oils in thyme (Jabbari et al., 2011); similarly nitrogen and sulfur have the same role in lemongrass (Zheljazkov et al., 2011). Nitrogen in plants is used to build amino acids and enzymes, which are utilized in the biosynthesis of various bioactive compounds (Nurzynska-Wierdak, 2013). The degree of nitrogen fertilization is the main element for plant biomass accumulation and influences the quantity and proportion of different chemicals of secondary metabolites (Daneshian et al., 2009; Politycka & Golcz, 2004), also at in vitro plant cell or tissue cultures (Mur-thy et al., 2014a; Murthy et al., 2014b). Some researches indicated that nitrogen concentration and NH4+/N03-ratio affect the hypericins in Hypericum spp. (Cui et al., 2010; Murthy et al., 2014a). Also, hypericin content significantly varied depending on the developmental stage. Different harvest stages influence the hypericin content, whereas leaf hypericin content at earlier growth stages was higher than the fruit set stage (Sun et al., 2019). Also, Hypericum triqutrifolium Turra showed a higher accumulation of total hypericin at the vegetative stage than the flowering and fruiting stages of herb (Azeez et al., 2017). According to the results of research to investigate hypericins variation in Hypericum triquetrifolium during plant growth it was observed that hypericin content in leaves was higher at the reproductive stages (flowering), but in stems was higher at the vegetative stages (Ayan & Cirak, 2008). Another research about the ontogenetical variation of hypericin and hyperphorin in H. perforatum revealed that the total hypericin contents decreased as developmental stages progressed (Buter & Buter, 2002).
To produce plant secondary metabolites through in vitro culture, acquiring information about the biosynthesis of the secondary metabolites is essential to improve the production of chemical compounds such as hypericin and hyperphorin (Vattikuti & Ciddi, 2005). Moreover, regarding that the function of a major part of plant genome is unknown so far, the relationship between enzymes, signaling substances, and small molecules is still relatively unknown. To fully understand the regulation of metabolites biosynthesis and purposeful changes in gene expression more research is required (Deepak et al., 2007). The effect of various factors on the expression of the genes involved in the biosynthesis of the pharmaceutical compounds can be investigated by a quantitative real-time PCR (qPCR) approach (Pfaffl, 2001). The production of active ingredients in medicinal plants is controlled by genetic factors. However, limited information exists about the effect of fertilizer treatments on the relative expression profiling of the genes involved in the biosynthesis pathway of active ingredients of medicinal plants.
In the present study, the effects of nitrogen fertilizer at different times after irrigation were investigated on the expression of hyp-1, HpPKS1 (polyketide synthase), and HpPKS2 genes in leaf and root of Hypericum spp., before and after flowering using qPCR. This is the first report about the relative expression of some genes of Hypericum spp. under different levels of root nitrogen supply at different time intervals after irrigation.
2 methods and materials
2.1	PLANT MATERIALS
The experiments were carried out with H. perforatum L. and H. androsaemum L:. Hypericum seeds were provided by the Iranian Biological Resource Center (IBRC), Tehran, Iran. The seeds were planted in pots containing farm soil (5 seeds / 4 l pot). The physicochemi-cal properties of soil were: saturation percentage (32 %), electricity conductivity (1.2 103 ds m-1), pH of paste (7.7), total neutralizing value (8 %), organic carbon (0.22 %), K available (212 ppm), P available (7.6 ppm) and soil texture (sandy clay loam).
2.2	PLANT CULTURE AND FERTILIZERS TREATMENTS
A factorial design based on completely randomized design (CRD) with three replications was used. Every pot with 5 plants was considered as a replication, namely,
Acta agriculturae Slovenica, 116/1 - 2020 85
M. YASAMAN et al.
each treatment included three pots. The urea granular fertilizer was fertilized at 0, 0.5, and 1 mg l-1 in intervals at 24, 48, and 72 hours after irrigating. For RNA extraction, 0.3 g from pooled leaves or roots of three plants of each pot were used. Plant material sampling was accomplished before flowering (200 days after seed planting) and after flowering (300 days after seed planting) stage. Roots/leaves of 5 plants formed the plant material of an experimental unit (a replication of a treatment).
2.3 RNA EXTRACTION, PURIFICATION AND
CDNA SYNTHESIS
Total RNA was extracted from leaf and root samples using the GeneAll RiboEx kit (BioFrontier, Korea) based on the manufacturer's protocol. Agarose gel electrophoresis and NanoDrop 1000 spectrophotometer (U.S. A) were used to determining RNA quality and integrity and checking the RNA quantity respectively. Samples of RNA were treated with RNase-free DNase Kit (Fermentas, Hanover, MD) to remove any contaminating genomic DNA, before cDNA synthesis. First-strand cDNA was synthesized from 5 pg of total RNA treated with DNase I using 200U MMLV reverse transcriptase (GREEN BIO GENE) according to the manufacturers' instructions.
2.4 PRIMER DESIGN AND REAL-TIME PCR
Primer design was carried out using online primer Quest software, the primer sequences for hyp-1, HpPKS1, and HpPKS2 genes are listed in Table 1. According to scientific reports, the 18s rRNA gene was used as the reference gene for data normalization. In the qPCR method, increasing or decreasing of expression quantity of genes is important, which calculated by the delta-delta method (Pfaffl, 2001). The qPCR was performed in a total vol-
ume of 20 pl containing 2 pl of cDNA, 10 pl SYBR Green master mix, and 4 pmol of each primer. The amplification reactions were carried out in a Step-One qPCR System (Applied Biosystem, ABI, USA) under the following conditions: 5 min at 95 °C, 35 cycles of "95 °C for 30 s, annealing temperature (Table. 1) for 30 s and 72 °C for 40 s", and 72°C for 10 s. All amplification reactions were repeated three times under identical conditions and included a negative control. To confirm that the PCR products were produced from cDNA and not genomic DNA, appropriate control reactions (without the existence of reverse transcriptase) were carried out. This experiment was carried out with two biological and three technical repeats.
2.5 STATISTICAL ANALYSIS
The data normality was confirmed through the Kol-mogorov-Smirnov test, then the relative expression levels of the genes were calculated by AACT and the Relative Expression Software Tool (REST) software (Pfaffl, 2001) was used to data analysis. One-way ANOVA and mean comparisons (Duncan's test) was accomplished using SAS software.
3 results
3.1 RELATIVE EXPRESSION OF HYP-1 GENE
Mean comparisons of hyp-1 gene expression revealed significant differences among treatments. The mean expression of hyp-1 gene was lower in control treatments (1.3-fold) compared to the nitrogen supporting treatments. Three the highest relative expressions of hyp-1 belonged to the root of H. perforatum: AF1-72 (13.6-fold), BF1-72 (11.3-fold), AF0.5-72 (10.4-fold). In
Table 1: Primer sequences for hyp-1, HpPKS1, and HpPKS2 genes used in the quantitative real-time PCR for gene expression analysis of Hypericum spp.
Gene		Primer sequence (5'-3')	Annealing temperature	Fragment size
hyp-1	Forward Reverse	TCCTGAGAGGAAGTACAGTGTC AGACGGCCCAGATTCATCA	58	125
HpPKS1	Forward Reverse	GACAGAGGTGTGGAAGAAG GTACATCAACTGCGCCAT	63	112
HpPKS2	Forward Reverse	CCTTCCCTTCCGTGTGTATATG CAGAGGAGAAACTGGAGGAAG	63	184
18srRNA	Forward Reverse	TGTCTGCGATAATGGAACTG ATTCATCATACTCCGCCTTAGC	58	108
92 Acta agriculturae Slovenica, 116/1 - 2020
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
all cases, increasing the interval between urea fertilization and irrigation caused an increasing trend in gene expression level (p < 0.01). Furthermore, in all cases, by increasing the amount of urea fertilizer, the relative gene expression was increased (p < 0.01). In overall, it can be concluded that hyp-1 relative expression in root tissue was greater than in leaf tissues (p < 0.01) (Figure 1).
3.1.1	Leaf
Among the leaf samples, the highest relative expression of the hyp-1 gene belonged to the treatment of [Hp] AF1-72 (10-fold), the second to fourth highest hyp-1 expression was observed in [Hp]AF1-48 (7.6-fold), [Hp] AF0.5-72 (7.5-fold) and [Ha]AF1-72 (7.4-fold) treatments respectively, and the next-highest gene expression was assigned to the treatment [Ha]BF1-72 (4.5-fold). In general, the mean expression level of hyp-1 in H. andro-saemum leaves (3.3-fold) was lower than in H. perforatum leaves (5.1-fold;p < 0.01). The lowest average expression of hyp-1 was observed at before flowering sampled leaves of H. androsaemum (2.3-fold). The mean expression level in after flowering samples (5.1-fold) was higher than in before flowering (3.3-fold), so the effect of time on hyp-1 expression in Hypericum leaves was significant (p < 0.01) (Figure 1).
3.1.2	Root
Among the root samples, the top three hyp-1 relative expressions were [Hp]AF1-72 (13.6-fold), [Hp]BF1-72 (11.3-fold), and [Hp]AF0.5-72 (10.4-fold). Fourth
to sixth the highest hyp-1 expression belonged to [Ha] AF1-72 (9.7-fold) and [Hp]AF1-48 (9.5-fold), [Hp]BF1-48 (8.9-fold) and [Ha]BF1-72 (8.9-fold), respectively. In general, hyp-1 mean expression in H. androsaemum roots (5.5-fold) was lower than in H.perforatum (7.1-fold), and the lowest mean expression level was observed in before flowering samples of H. androsaemum root tissues (5.1fold). The relative expression of hyp-1 in after flowering samples (6.8-fold) was higher than in before flowering samples (5.8-fold), so the effect of time on hyp-1 expression in both Hypericum species roots is significant (p < 0.01) (Figure 1).
3.2 RELATIVE EXPRESSION OF HPPKS1 GENE
Duncan's test for HpPKS1 expression level revealed significant differences among means of treatments. The mean expression of HpPKS1 gene in control treatments (0.7-fold) was lower than in the nitrogen fertilized treatments. The two highest relative expressions of HpPKS1 belonged to leaves of H. perforatum: AF1-72 (9.1-fold) and BF1-72 (8-fold). The third to the seventh mean expressions of HpPKS1 belonged to the following treatments of leaf samples, respectively: [Hp]AF1-48 (6.2fold), [Hp]BF1-48 (6-fold), [Hp]AF0.5-72 (5.6-fold), [Ha]AF1-72 (5.2-fold) and [Hp]BF0.5-72 (5-fold). In all cases, with increasing the interval between urea fertilization and irrigation, the relative expression of HpPKS1 had an increasing trend (p < 0.01). Furthermore, in all cases, by increasing the amount of urea fertilizer, Hp-PKS1 expression was increased (p < 0.01). In overall, it can be concluded that HpPKS1 mean expression in leaf was very greater than in root (p < 0.01) (Figure 2).
Error bars (standard l|| <— deviation) |				i				12-00 -too 2.00	b												
IO.OO 2.00 ooo	f n		d			cd f	t> b d									r					
		0-5		-I					O				S5C 1			O 0.5			SSSK 1		
Ureatgr/lit)	o					O 0.5	1	Urea (ar/Wt)		0.5											
	Before flowerin					After fl	owe ring		Before flowering							After flowering					
	H. perforatum Leaf							H. perforatum Root													
s.oo 6-00 4..CHJ	nnfii			d nil		f h il II	t>	S.OO 6.00 ■i.OO O.OO	J h n					>	b	h n					
						S3R							S3?						S3«		
Urea (gr/lit)	0	0.5		1		0 0.5	1	Urea (gr/lit)	0	0.5			1			O 0.5			1		
	Before flowering					After flowering			Before flowering							After flowering					
	Leaf								H. androsaemum Root												
Figure 1: hyp-1 expression level in different parts of Hypericum leaf and root (r = 3; p < 0.05)
Acta agriculturae Slovenica, 116/1 - 2020 85
M. YASAMAN et al.
3.2.1 Leaf
Among the leaf samples, the top four HpPKS1 expression were belonged to H. perforatum: AF1-72 (9.1fold), BF1-72 (8-fold), AF1-48 (6.2-fold) and BF1-48 (6fold). In general, HpPKS1 expression in H. androsaemum leaves (2.9-fold) was lower than in H. perforatum (4.6fold; p < 0.01).,The lowest mean expression of HpPKS1 was observed at before flowering samples of H. androsaemum leaf tissues (2.5-fold). HpPKS1 mean expression in after flowering samples (4-fold) was higher than in before flowering (3.4-fold; p < 0.01), thus the developmental stage significantly affected HpPKS1 expression level in both Hypericum species leaves (Figure 2).
the top seven HpPKS2 relative expressions belonged to the H. perforatum leaves: AF1-72 (8.4-fold), AF0.5-72 (7.8-fold), BF1-72 (7.6-fold), AF1-48 (6.4-fold), BF1-48 (6.3-fold), AF1-24 (5.3-fold), and BF0.5-72 (5.3-fold). In all cases, with increasing the interval between urea fertilization and irrigation, HpPKS2 expression had an increasing trend (p < 0.01). Similarly, in all cases except two treatment, by increasing the amount of urea fertilizer, HpPKS2 expression was increased (p < 0.01).
In overall, it can be concluded that the relative expression of the HpPKS2 in leaves(3.9-fold) was very greater than in root (1.6-fold;p < 0.01) (Figure 3).
3.3.1 Leaf
3.2.2 Root
Among the root samples, the two highest HpPKS1 expressions have belonged to [Hp]AF1-72 (3.3-fold) and [Ha]AF1-72 (2.6-fold). HpPKS1 mean expression level was approximately equal in two Hypericum species root tissues (1.6-fold). The relative gene expression in after flowering samples (1.8-fold) was higher than in before flowering samples (1.5-fold;p < 0.01) (Figure 2).
3.3 RELATIVE EXPRESSION OF HPPKS2 GENE
Based on Duncan's mean comparisons for HpPKS2 expression level discovered significant differences among various treatments. The mean expression of HpPKS2 gene in control treatments (0.8-fold) was lesser than in the nitogen fertilized treatments. Among all treatments,
Among the leaf samples, the top three HpPKS2 relative expression treatments were [Hp]AF1-72 (8.4-fold), [Hp]AF0.5-72 (7.8-fold), and [Hp]BF1-72 (7.6-fold). In general, HpPKS2 expression in H. androsaemum leaves (2.9-fold) was lower than in H. perforatum leaves (4.8fold; p < 0.01). The lowest HpPKS2 mean expression was observed at the before flowering samples of H. androsaemum (2.5-fold). HpPKS2 mean expression in after flowering samples (4.3-fold) was higher than in before flowering (3.4-fold; p < 0.01), therefore the effect of developmental stage on HpPKS2 expression in both Hyperi-cum species leaves was significant (Figure 3).
3.3.2 Root
Among the root samples, the highest HpPKS2 expression belonged to the treatment of [Hp]AF1-72 (3.1-
Figure 2: HpPKSl expression level in different parts of Hypericum leaf and root (r = 3; p < 0.05) 88 Acta agriculturae Slovenica, 116/1 - 2020
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
Figure 3: HpPKS2 expression level in different parts of Hypericum leaf and root (r = 3; p < 0.05)
fold), then the treatment [Ha]BF1-72 (2.6-fold). The relative expression of the HpPKS2 gene was approximately equal in two Hypericum species root tissues (1.6-fold). HpPKS2 expression in after flowering samples (1.8-fold) was slightly higher than in before flowering (1.5-fold; p < 0.01) (Figure 3).
4 DISCUSSION
Production of secondary metabolites is controlled by the level of genes expression and is significantly influenced by the degree of cell differentiation, environmental conditions and the elements that are present in the plant (Vom Endt et al., 2002; Afrin et al., 2015). Lazzara et al. (2017) with the investigation of the effect of arbuscular mycorrhizal fungi (AFM) and phosphorus availability on the content of some secondary metabolites in Hypericum perforatum, reported that flower hyperforin concentration in mycorrhizal treatment was 17.5 % lower than non-mycorrhizal treatment. In contrast, with the use of AFM under low phosphorus availability, hypericin and pseudochypericin concentrations increased by 166.8 % and 279.2 %, respectively, while no effect of the use of AFM was found under high phosphorus availability. Based on the H. perforatum field study to determine the influence of N and P fertilizers on the flavonoids content, it was concluded that 125kg N ha-1 and 50kg P205 ha-1 proved optimal for high dry herb yield and flavonoids content compared to unfertilized plants (Azizi & Dias, 2004). Also, in the present study, by increasing the amount of nitrogen fertilizer, the relative expression of the genes involved in the hypericin biosynthesis pathway
was increased, which was statistically significant in most cases.
The ultimate steps of hypericin biosynthesis have been proposed to be accompanied by Hyp-1, a phenolic coupling protein, a member of genes encoding plant pathogenesis-related class 10 protein family (PR-10) (Bais et al., 2003; Radauer et al., 2008; Michalska et al., 2010). Like other PR-10 family proteins, hyp-1 looks to be developmentally regulated (Pinto et al., 2005, Liu & Ekramoddoullah, 2006). Also in other research, leaf and intact roots showed the highest expression of hyp-1, while stems and old parts of roots presented significantly lower expression levels, hence, there is variable existence of Hyp-1 protein in leaves at different phases of leaf development. (Karppinen, 2010). In the present study, the relative expression of all three genes studied in most cases in the after-flowering stage was higher than in the before-flowering stage.
Diverse expression levels of hyp-1 in different tissues and organs of Hypericum have been reported. Kosuth et al. (2007) reported absence of differences in hyp-1 expression between leaf margins and leaf inner parts. According to their findings from ex vitro plants, fairly high expression of hyp-1 gene was measured in roots. In the present study, the relative expression difference between root and leaf in the case of the hyp-1 gene was smaller-than that of HpPKS1 and HpPKS2 genes. According to some studies, the HpPKS2 expression and the hypericins content were the highest in the parts containing the dark glands, such as the flower buds, and were low in the parts free of dark glands, such as stem and root. In the case of the hyp-1 gene, the relative expression in the root tissue was higher than the corresponding treatments in the leaf tissue (p < 0.01), but the relative expression of HpPKS1
Acta agriculturae Slovenica, 116/1 - 2020 85
M. YASAMAN et al.
and HpPKS2 genes, in the root tissue, was lower than the corresponding treatments in the leaf tissue. It can be because of that the hyp-1 gene, apart from contributing to the hypericins biosynthesis pathway, has other functions, and probably these biological roles are related to root tissue in Hypericum species. Because of the high expression of HpPKS2 in the reproductive organs and as well in leaf borders, this gene may play a role in the agglomeration of defensive chemicals, such as hypericins (Agostinis et al., 2002; Onelli et al., 2002; Sirvent & Gibson, 2002; Sirvent et al., 2003).
Also, a research was conducted to find suitable sites for the synthesis of hypericin based on the level of hyp-1 gene expression in the early stages of seedling development, and comparing the level of hyp-1 gene expression in different parts of the plant regarding the presence or absence of dark glands. It has been found that hyp-1 copies are found throughout the leaf tissue, but there is no significant difference in the level of gene expression in the margins and the inner parts of the leaf (Karppinen, 2010).
These results showed that hyp-1, HpPKS1, and Hp-PKS2 expression in Hypericum significantly affected by the plant tissues, plant genus, amount and time of urea granular fertilization, and developmental phase of sampling.
5	conclusions
In general, the results showed that using the urea fertilizer significantly affect the relative expression of studied genes, with increasing the urea fertilizer, relative expression of the studied genes increased. Gene expression values after flowering were higher than before flowering. Enhancing the time interval between irrigation and urea fertilizer application, gene expression increases. The gene hyp-1 expression in root was higher than the leaf, but the relative expression of HpPKS1 and HpPKS2 genes in leaf was higher than in roots.
6	references
Afrin, S., Huang, J. J., & Luo, Z. Y. (2015). JA-mediated transcriptional regulation of secondary metabolism in medicinal plants. Science Bulletin, 60(12), 1062-1072. https://doi. org/10.1007/s11434-015-0813-0 Agostinis, P., Vantieghem, A., Merlevede, W., & de Witte, P. A. (2002). Hypericin in cancer treatment: more light on the way. The international journal of biochemistry & cell biology, 34(3), 221-241. http://dx.doi.org/10.1016/S1357-2725(01)00126-1 Ayan, A. K., & Cirak, C. (2008). Variation of hypericins
in Hypericum triquetrifolium Turra growing in different locations of Turkey during plant growth. Natural product research, 22(18), 1597-1604. https://doi. org/10.1080/14786410701838213 Azeez, H. A., Ameen, A. H., & Faqe, S. A. (2017). Variation in production of of Hypericum triqutrifoliu developmental stages. Journal of zankoy sulaimani-A, 19(2), 29-36. https:// doi.org/10.17656/jzs.10608 Azizi, M., & Dias, A. (2004, September). Nitrogen and phosphorus fertilizers affect flavonoids contents of St. John's wort (Hypericum perforatum L.). In Proc. 4th Int. Iran & Russia Conf. Shahrkurd, Iran (pp. 8-10). Retrieved from: http://iirc.narod.ru/4conference/Fullpaper/20003.pdf Bais, H. P., Vepachedu, R., Lawrence, C. B., Stermitz, F. R., & Vivanco, J. M. (2003). Molecular and biochemical characterization of an enzyme responsible for the formation of hy-pericin in St. John's wort (Hypericum perforatum L.). Journal of Biological Chemistry, 278(34), 32413-32422. http:// dx.doi.org/ 10.1074/jbc.M301681200 Birt, D. F., Widrlechner, M. P., Hammer, K. D., Hillwig, M. L., Wei, J., Kraus, G. A., ... & Wiemer, D. F. (2009). Hypericum in infection: Identification of anti-viral and antiinflammatory constituents. Pharmaceutical biology, 47(8), 774-782. http://dx.doi.org/10.1080/13880200902988645 Briskin, D. P., & Gawienowski, M. C. (2001). Differential effects of light and nitrogen on production of hypericins and leaf glands in Hypericum perforatum. Plant Physiology and Biochemistry, 39(12), 1075-1081. http://dx.doi.org/10.1016/ S0981-9428(01)01326-2 Bruni, R., & Sacchetti, G. (2009). Factors affecting polyphenol biosynthesis in wild and field grown St. John's Wort (Hypericum perforatum L. Hypericaceae/Guttiferae). Molecules, 14(2), 682-725. http://dx.doi.org/10.3390/mol-ecules14020682
Buter, K. B., & Buter, B. (2002). Ontogenetic variation regarding hypericin and hyperforin levels in four accessions of Hypericum perforatum L. Journal of Herbs, Spices & Medicinal Plants, 9(2-3), 95-100. https://doi.org/10.1300/ J044v09n02_14
Butterweck, V. (2003). Mechanism of action of St John's wort in depression. CNS drugs, 17(8), 539-562. http://dx.doi. org/10.2165/00023210-200317080-00001 Cui, X. H., Murthy, H. N., Wu, C. H., & Paek, K. Y. (2010). Adventitious root suspension cultures of Hypericum perforatum: effect of nitrogen source on production of biomass and secondary metabolites. In Vitro Cellular & Developmental Biology-Plant, 46(5), 437-444. http://doi.org/10.1007/ s11627-010-9310-y Daneshian, A., Gurbuz, B., Cosge, B., & Ipek, A. (2009). Chemical Components of Essential Oils from Basil (Ocimum basi-licum L.) Grown at Different Nitrogen Levels. International Journal of Natural & Engineering Sciences, 3(3). http://www. ijnes.org/index.php/ijnes/article/view/505/475 Deepak, S. A., Kottapalli, K. R., Rakwal, R., Oros, G., Rangappa, K. S., Iwahashi, H., ... & Agrawal, G. K. (2007). Real-time PCR: revolutionizing detection and expression analysis of genes. Current genomics, 8(4), 234-251. http://doi. org/10.2174/138920207781386960
92 Acta agriculturae Slovenica, 116/1 - 2020
Investigation of gene expression diversity in Hypericum spp. before and after flowering under different nitrogen fertilization levels
Duke, J. A. (2002). Handbook of medicinal herbs. CRC press.
Inc. Boca Raton, Florida. Duppong, L. M., Delate, K., Liebman, M., Horton, R., Romero, F., Kraus, G., ... & Chowdbury, P. K. (2004). The effect of natural mulches on crop performance, weed suppression and biochemical constituents of catnip and St. John's wort. Crop science, 44(3), 861-869. http://doi.org/10.2135/ cropsci2004.0861 Falk, H. (1999). From the photo sensitizer hypericin to the photoreceptor stentorin—the chemistry of phenanthrop-erylene quinones. Angewandte Chemie International Edition, 38(21), 3116-3136. https://doi.org/10.1002/(SICI)1521 -3773(19991102)38:21<3116::AID-ANIE3116>3.0.C0;2-S Jabbari, R., Dehaghi, M. A., Sanavi, A. M. M., & Agahi, K. (2011). Nitrogen and iron fertilization methods affecting essential oil and chemical composition of thyme (Thymus vulgaris L.) medical plant. Advances in Environmental Biology, 433-439. http://www.aensiweb.com/old/aeb/2011/433-438.pdf
Jendzelovská, Z., Jendzelovsky, R., Kuchárová, B., & Fedorocko, P. (2016). Hypericin in the light and in the dark: two sides of the same coin. Frontiers in plant science, 7, 560. http:// dx.doi.org/10.3389/fpls.2016.00560 Karioti, A., & Bilia, A. R. (2010). Hypericins as potential leads for new therapeutics. International journal of molecular sciences, 11(2), 562-594. http://dx.doi.org/10.3390/ ijms11020562
Karppinen K (2010) Biosynthesis of hypericins and hyperforins in Hypericum perforatum (St. John's wort)-precursors and genes involved. Academic dissertation submitted to Faculty of Science, University of Oulu, Oulu. ISBN 978-951-426310-1. http://jultika.oulu.fi/Record/isbn978-951-42-6310-1
Khosh-Khui, M., Shekafandeh, A., & Azarakhsh, H. (1984). Micropropagation of myrtle. Scientia horticulturae, 22(1-2), 139-146. https://doi.org/10.1016/0304-4238(84)90094-3 Kosuth, J., Katkovcinová, Z., Olexová, P., & Cellárová, E. (2007). Expression of the hyp-1 gene in early stages of development of Hypericum perforatum L. Plant cell reports, 26(2), 211217. http://dx.doi.org/10.1007/s00299-006-0240-4 Kubin, A., Wierrani, F., Burner, U., Alth, G., & Grunber-ger, W. (2005). Hypericin-the facts about a controversial agent. Current pharmaceutical design, 11(2), 233-253. http://dx.doi.org/10.2174/1381612053382287 Lazzara, S., Militello, M., Carrubba, A., Napoli, E., & Saia, S. (2017). Arbuscular mycorrhizal fungi altered the hypericin, pseudohypericin, and hyperforin content in flowers of Hypericum perforatum grown under contrasting P availability in a highly organic substrate. Mycorrhiza, 27(4), 345-354. http://dx.doi.org/10.1007/s00572-016-0756-6 Lazzara, S., Napoli, E., & Carrubba, A. (2015). Hypericum spp.: a resource from wild Mediterranean flora for the treatment of mild depression. Bioactive phytochemicals—perspectives for modern medicine, 3, 337-354. Liu, J. J., & Ekramoddoullah, A. K. (2006). The family 10 of plant pathogenesis-related proteins: their structure, regulation, and function in response to biotic and abiotic stresses. Physiological and Molecular Plant Pathology, 68(1-3), 3-13. http://doi.org/10.1016Zj.pmpp.2006.06.004
Michalska, K., Fernandes, H., Sikorski, M., & Jaskolski, M. (2010). Crystal structure of Hyp-1, a St. John's wort protein implicated in the biosynthesis of hypericin. Journal of structural biology, 169(2), 161-171. http://doi.org/10.1016/j. jsb.2009.10.008
Miskovsky, P. (2002). Hypericin-a new antiviral and antitumor photosensitizer: mechanism of action and interaction with biological macromolecules. Current drug targets, 3(1), 5584. http://dx.doi.org/10.2174/1389450023348091 Murthy, H. N., Kim, Y. S., Park, S. Y., & Paek, K. Y. (2014a). Hy-pericins: biotechnological production from cell and organ cultures. Applied microbiology and biotechnology, 98(22), 9187-9198. http://dx.doi.org/10.1007/s00253-014-6119-3 Murthy, H. N., Lee, E. J., & Paek, K. Y. (2014b). Production of secondary metabolites from cell and organ cultures: strategies and approaches for biomass improvement and metabolite accumulation. Plant Cell, Tissue and Organ Culture (PCTOC), 118(1), 1-16. http://dx.doi.org/10.1007/s11240-014-0467-7
Nurk, N. M., Madrinan, S., Carine, M. A., Chase, M. W., & Blattner, F. R. (2013). Molecular phylogenetics and morphological evolution of St. John's wort (Hypericum; Hyperi-caceae). Molecular Phylogenetics and Evolution, 66(1), 1-16. http://doi.org/10.1016Zj.ympev2012.08.022 Nurzynska-Wierdak, R. (2013). Does mineral fertilization modify essential oil content and chemical composition in medicinal plants? Acta Sci Pol Hortorum Cultus, 12(5), 3-16. http://www.acta.media.pl/pl/full/7/2013/0000702013 00012000050000300016.pdf Onelli, E., Rivetta, A., Giorgi, A., Bignami, M., Cocucci, M., & Patrignani, G. (2002). Ultrastructural studies on the developing secretory nodules of Hypericum perforatum. Flora-Morphology, Distribution, Functional Ecology of Plants, 197(2), 92-102. http://doi.org/10.1078/0367-2530-00019
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic acids research, 29(9), e45-e45. http://doi.org/10.1093/nar/29.9.e45 Pinto, M. P., Ribeiro, A., Regalado, A. P., Rodrigues-Pousada, C., & Ricardo, C. P. P. (2005). Expression of Lupinus albus PR-10 proteins during root and leaf development. Biologia plantarum, 49(2), 187-193. http://dx.doi.org/10.1007/ s10535-005-7193-2 Politycka, B., & Golcz, A. (2004). Content of chloroplast pigments and anthocyanins in the leaves of Ocimum basilicum L. depending on nitrogen doses. Folia horticulturae, 16(1), 23-29. http://www.ptno.ogr.ar.krakow.pl/Wydawn/Fo-liaHorticulturae/Spisy/FH2004/PDF16012004/fh1601p03. pdf
Radauer, C., Lackner, P., & Breiteneder, H. (2008). The Bet v 1 fold: an ancient, versatile scaffold for binding of large, hydrophobic ligands. BMC evolutionary biology, 8(1), 286. http://doi.org/10.1186/1471-2148-8-286 Rahnavrd, A. (2017). Genetic and biochemical diversity of Hypericum perforatum L. Grown in the caspian climate of Iran. Applied ecology and environmental research, 15(1), 665-675. http://dx.doi.org/10.15666/aeer/1501_665675 Ruhfel, B. R., Stevens, P. F., & Davis, C. C. (2013). Combined morphological and molecular phylogeny of the clusioid
Acta agriculturae Slovenica, 116/1 - 2020 85
M. YASAMAN et al.
clade (Malpighiales) and the placement of the ancient ro-sid macrofossil Paleoclusia. International Journal of Plant Sciences, 174(6), 910-936. http://dx.doi.org/10.1086/670668 Russo, E., Scicchitano, F., Whalley, B. J., Mazzitello, C., Ciriaco, M., Esposito, S., ... & Mammi, M. (2014). Hypericum perforatum: pharmacokinetic, mechanism of action, toler-ability, and clinical drug-drug interactions. Phytotherapy research, 28(5), 643-655. http://doi.org/10.1002/ptr.5050 Samuelsson, G., & Bohlin, L. (2017). Drugs of natural origin: a
treatise of pharmacognosy (No. Ed. 7). CRC Press Inc. Silva, B. A., Ferreres, F., Malva, J. O., & Dias, A. C. (2005). Phy-tochemical and antioxidant characterization of Hypericum perforatum alcoholic extracts. Food chemistry, 90(1-2), 157167. http://doi.org/10.1016Zj.foodchem.2004.03.049 Sirvent, T., & Gibson, D. (2002). Induction of hypericins and hyperforin in Hypericum perforatum L. in response to bi-otic and chemical elicitors. Physiological and Molecular Plant Pathology, 60(6), 311-320. http://doi.org/10.1006/ pmpp.2002.0410 Sirvent, T. M., Krasnoff, S. B., & Gibson, D. M. (2003). Induction of hypericins and hyperforins in Hypericum perforatum in response to damage by herbivores. Journal of chemical ecology, 29(12), 2667-2681. http://dx.doi. org/10.1023/B:JoEC.0000008011.77213.64 Sun, P., Kang, T., Xing, H., Zhang, Z., Yang, D., Zhang, J., ... & Li, M. (2019). Phytochemical Changes in Aerial Parts of Hypericum perforatum at Different Harvest Stages. Records of Natural Products, 13(1). http://dx.doi.org/10.25135/ rnp.77.18.04.267
Vattikuti, U. M., & Ciddi, V. (2005). An overview on Hypericum perforatum L. Natural Product Radiance, 4(5), 368-381. https://pdfs.semanticscholar.org/2a92/04ef4e20712d0613d 3fdfee5c5bfec002362.pdf Vom Endt, D., Kijne, J. W., & Memelink, J. (2002). Transcription factors controlling plant secondary metabolism: what regulates the regulators?. Phytochemistry, 61(2), 107-114. http://doi.org/10.1016/S0031-9422(02)00185-1 Zhang, X., Jin, B., Zheng, W., Zhang, N., Liu, X., Bing, T., ... & Shangguan, D. (2016). Interaction of hypericin with guanine-rich DNA: Preferential binding to parallel G-Quadruplexes. Dyes and Pigments, 132, 405-411. http://doi. org/10.1016/j.dyepig.2016.05.009 Zhang, Y., Shang, K., Wu, X., Song, S., Li, Z., Pei, Z., & Pei, Y. (2018). Highly efficient green synthesis and photodynamic therapeutic study of hypericin and its derivatives. RSC advances, 8(39), 21786-21792. http://dx.doi.org/10.1039/ c8ra03732a
Zheljazkov, V. D., Cantrell, C. L., Astatkie, T., & Cannon, J. B. (2011). Lemongrass productivity, oil content, and composition as a function of nitrogen, sulfur, and harvest time. Agronomy Journal, 103(3), 805-812. http://doi. org/10.2134/agronj2010.0446 Zobayed, S. M. A., Afreen, F., Goto, E., & Kozai, T. (2006). Plant-environment interactions: accumulation of hyperi-cin in dark glands of Hypericum perforatum. Annals of Botany, 98(4), 793-804. http://doi.org/10.1093/aob/mcl169
92 Acta agriculturae Slovenica, 116/1 - 2020