ISSN 15804003
THE SCIENTIFIC JOURNAL OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA
SLOVENIAN VETERINARY RESEARCH
SLOVENSKI VETERINARSKI ZBORNIK
volume
49 4
Slov Vet Res • Ljubljana • 2012 • Volume 49 • Number 4 • 155-203
THE SCIENTIFIC JOURNAL OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA
SLOVENIAN VETERINARY RESEARCH
SLOVENSKI VETERINARSKI ZBORNIK
volume a
49 4
Slov Vet Res • Ljubljana • 2012 • Volume 49 • Number 4 • 155-203
The Scientific Journal of the Veterinary Faculty University of Ljubljana
SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK
Previously: RESEARCH REPORTS OF THE VETERINARY FACULTY UNIVERSITY OF LJUBLJANA Prej: ZBORNIK VETERINARSKE FAKULTETE UNIVERZA V LJUBLJANI
4 issues per year / izhaja štirikrat letno
Editor in Chief / glavni in odgovorni urednik: Gregor Majdič Technical Editor / tehnični urednik: Matjaž Uršič
Assistants to Editor / pomočnici urednika: Valentina Kubale Dvojmoč, Klementina Fon Tacer Editorial Board / uredniški odbor:
Frangež Robert, Polona Juntes, Matjaž Ocepek, Seliškar Alenka, Modest Vengušt, Milka Vrecl, Veterinary Faculty University of Ljubljana / Veterinarska fakulteta Univerze v Ljubljani; Vesna Cerkvenik, Reziduum d.o.o.
Editorial Advisers / svetovalca uredniškega odbora: Gita Grecs-Smole for Bibliography (bibliotekarka), Leon Ščuka for Statistics (za statistiko)
Reviewing Editorial Board / ocenjevalni uredniški odbor:
Ivor D. Bowen, Cardiff School of Biosciences, Cardiff, Wales, UK; Antonio Cruz, Paton and Martin Veterinary Services, Adegrove, British Columbia; Gerry M. Dorrestein, Dutch Research Institute for Birds and Exotic Animals, Veldhoven, The Netherlands; Sara Galac, Utrecht University, The Netherlands; Wolfgang Henninger, Veterinärmedizinische Universität Wien, Austria; Simon Horvat, Biotehniška fakulteta, Univerza v Ljubljani, Slovenia; Nevenka Kožuh Eržen, Krka, d.d., Novo mesto, Slovenia; Louis Lefaucheur, INRA, Rennes, France; Bela Nagy, Veterinary Medical Research Institute Budapest, Hungary; Peter O'Shaughnessy, Institute of Comparative Medicine, Faculty of Veterinary Medicine, University of Glasgow, Scotland, UK; Milan Pogačnik, Veterinarska fakulteta, Univerza v Ljubljani, Slovenia; Peter Popelka, University of Veterinary Medicine, Košice, Slovakia; Detlef Rath, Institut für Tierzucht, Forschungsbericht Biotechnologie, Bundesforschungsanstalt für Landwirtschaft (FAL), Neustadt, Germany; Henry Stämpfli, Large Animal Medicine, Department of Clinical Studies, Ontario Veterinary College, Guelph, Ontario, Canada; Frank J. M. Verstraete, University of California Davis, Davis, California, US; Thomas Wittek, Veterinärmedizinische Universität, Wien, Austria
Slovenian Language Revision / lektor za slovenski jezik: Viktor Majdič
Address: Veterinary Faculty, Gerbičeva 60, 1000 Ljubljana, Slovenia Naslov: Veterinarska fakulteta, Gerbičeva 60, 1000 Ljubljana, Slovenija Tel.: +386 (0)1 47 79 100, 47 79 129, Fax: +386 (0)1 28 32 243 E-mail: slovetres@vf.uni-lj.si
Sponsored by the Slovenian Book Agency Sofinancira: Javna agencija za knjigo Republike Slovenije
ISSN 1580-4003
Printed by / tisk: DZS, d.d., Ljubljana
Indexed in / indeksirano v: Agris, Biomedicina Slovenica, CAB Abstracts, IVSI Urlich's International Periodicals Directory, Science Citation Index Expanded, Journal Citation Reports/Science Edition http://www.slovetres.si/
SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK
Slov Vet Res 2012; 49 (4)
Original Scientific Articles
Farzan R, Rahimi E, Momtaz H. Virulence properties of Shiga Toxin-Producing Escherichia coiisolated
from Iranian raw milk and dairy products.............................................................159
Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B, Končurat A, Šimič B, Rudan N. Content of five trace
elements in different honey types from Koprivnica - Križevci county........................................167
Lenhardt M, Jarič I, Cvijanovič G, Kolarevič J, Gačič Z, Smederevac-Lalič M, Višnjič-Jeftič Ž. Comparison
of morphological characters between wild and cultured sterlet (Acipenser ruthenus L.)........................177
Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D, Krapež U, Dovč A. Detection
of Chlamydiapsittaciin cage birds in Slovenia by Real-Time PCR.........................................185
Starič J, Nemec M, Zadnik T. Bone metabolism markers and blood minerals concentration in dairy cattle during
pregnancy and lactation..........................................................................193
Author Index Volume 49, 2012........................................................................... 201
Slov Vet Res 2012; 49 (4): 159-66 UDC 579.63:616-092:579.842.1/.2:637.1
Original Scientific Article
virulence properties of shiga toxin-producing
ESCHERICHIA COLI ISOLATED FROM IRANIAN RAw MILK
and dairy products
Rahil Farzan1, 2*, Ebrahim Rahimi3, Hassan Momtaz4
1Young researchers club, 2Food Science & Technology, College of Agriculture, 3Department of Food Hygine, College of Veterinary Medicine, 4Department of Microbiology, College of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
Corresponding author, E-mail: rl.farzan@yahoo.com
Summary: Shiga toxin (Stx)-producing Escherichia coli(STEC) strains are a diverse group of food-borne pathogens with various levels of virulence for humans. The main object of the present study was to determine virulence properties of STEC isolated from Iranian raw milk and dairy products. A total number of 300 samples, including sheep's (35), goat's (46), cow's (106), and buffalo's milk (21), soft cheese (42), butter (32) and ice cream (18), was obtained from farm bulk tanks, milk collection centres, and various supermarkets and retailer shops in different regions of Iran. Biochemical and molecular (PCR) method proved 26% of the samples to be E. coli positive, and among them, Stx1 and Stx2genes were detected in 33 and 52 samples, respectively. But, eaeAand sfaSgenes were not found in any of the sample. Beside Stx2, cnfl had the highest prevalence (42 isolates), and beside eaeA and sfaS, fyuA had the lowest prevalence of virulence genes. The results of this study demonstrate that there is a widespread distribution of potentially virulent E. coli strains in the environment and food that may be a cause of concern for human health.
Key words: STEC; Escherichia coli; virulence factors; raw milk
Introduction
Raw, unpasteurized milk is consumed directly by a large number of people in rural areas, and indirectly by a much larger segment of the population via consumption of several types of cheese. One of the main reasons why people prefer raw milk and its products may be their belief in their advantages or higher value compared to pasteurized milk (1). Many microorganisms, coliforms among them, can have access to milk and dairy products, and Escherichia coli are
Received: 15 February 2012
Accepted for publication: 1 August 2012
often used as marker organisms. Detecting and counting of E. coli is used as a reliable indicator of faecal contamination and indicates a possible presence of enteropathogenic and/or toxigenic microorganisms which constitute a public health hazard (2). E. coli, a gram negative bacillus, is naturally present in the gastrointestinal tracts of humans and animals as a part of natural microflora (3). While E. coli typically harmlessly colonizes the intestinal tract, several E. coli clones have evolved the ability to cause a variety of diseases within the intestinal tract and elsewhere in the host (4). Enterohemorrhagic Escherichia coli (EHEC) strains are a subset of Shiga toxin (Six)-producing E. coli (STEC) strains that are
160
R. Farzan, E. Rahimi, H. Momtaz
isolated from human patients and are responsible for severe clinical symptoms, including diarrhea, hemorrhagic colitis, and hemolytic-uremic syndrome. These diseases are directly related to the virulence genes present in the causative agent (5,6). Four of the most commonly assayed virulence factors of STEC are the two phage-encoded cytotoxins, called Shiga toxin 1 and 2 (encoded by the Stxl and Stx2genes, respectively), the protein intimin (encoded by the chromosomal gene eae), which is responsible for the intimate attachment of the bacteria to intestinal epithelial cells, and the plasmid-encoded enterohaemolysin, also called enterohaemorrhagic E. coli haemolysin (EHEC-HlyA), encoded by the ehxA gene (3,7). Shiga toxin-producing E. coli can be transmitted through different routes, including food and water, person-to-person contact, and animal-to-person contact. Most human infections are caused by consumption of contaminated food. Domestic animals and wild ruminants, in particular cattle, are considered the main reservoir of STEC and the main source of contamination of the food supply (8,9). The presumed route of E. coli contamination of raw milk is via faecal contamination during milking (10). However, direct excretion of the organisms from the infected udder has also been reported (11).
There is a lack of information on virulence properties of Shiga Toxin-producing Escherichia coli contaminating Iranian milk and dairy products. Therefore, the main goal of the present study was to evaluate these properties.
Material and methods
Sample collection and identification of E. coli
From March 2010 to March 2011, raw bovine (n= 106), caprine (n= 46), ovine (n= 35) and buffalo (n= 21) milk samples were collected from farm bulk tanks and milk collection centres from several regions throughout Iran. Bovine and buffalo milk samples were collected in the above mentioned time period, whereas ovine and caprine milk samples were only available in the lactating periods of ewes and goats (i.e. from March through May, and from September to November of the subsequent year) within the same time frame. At each site, sampling of milk was performed according to the International
Dairy Federation guidelines (IDF) (12). Samples (100 mL each, in sterile glass containers) were transported to the laboratory at ca. +4oC within 6-12 h after sampling.
Among dairy products, 42 samples of soft cheese, 32 samples of soft butter and 18 samples of soft ice-cream, all made of raw milk, were purchased at the supermarkets in the city of Shiraz, Isfahan and Shahrekord. All samples were kept under refrigeration and in plastic bags. Their information about dates of production and of assigned shelf-life was not presented. Dairy product samples were collected over a period of six months between May and November 2010, and were analyzed on the day of acquisition. Samples were transported under refrigeration (+4 to +6oC) in thermal boxes containing ice packs and were tested immediately after collection. A 25g portion of each sample was blended with 225 mL of nutrient broth (Merck, Germany) for two minutes, and at normal speed, using a Stomacher lab blender, and incubated at +37oC for 24h. A 1 mL sample of the nutrient broth culture was mixed with 9 mL of MacConkey broth (Merck, Germany) and further incubated at +37oC for 24h. One loop of each tube was streaked on MacConkey agar (Merck, Germany).
Four colonies from each plate with typical E. coli morphology were selected and examined by biochemical tests, including hydrogen sulphide, citrate, urease and indole.
All E. coli colonies were confirmed by molecular (PCR) method, determined by amplification of 16S rRNA gene region of E. coli as described by Sabat et al. (13). The identification of E. coli O157: H7 was also performed with the method described by Fode-Vaughan et al. (14). PCR conditions were optimized for DPCR by recommendations reported previously. The PCR conditions for amplification of Stx1 and Stx2 were the same as used for pmoA.
DNA isolation
Bacterial strains were grown overnight and at +37oC in the trypticase soy agar (TSA- Merck, German). One colony was suspended in 100 ^L of sterile distilled water. The suspension was being boiled for 13 min, then frozen and subsequently centrifuged at 14,000 rpm for 15 min to pellet the cell debris (15). The supernatant was used as a template for amplification reaction.
Virulence properties of Shiga Toxin-Producing Escherichia co//isolated from Iranian raw milk and dairy products
161
Polymerase chain reaction (PCR)
The PCR assays, specific primer sequences and the predicted size of the amplified products for different pathogenic gene coding regions were employed as previously described (16-20). Details are shown in Table 1. For cycling, a DNA thermo-cycler (Eppendorf Mastercycler, Eppendorf-Nethel-
Hinz GmbH, Hamburg, Germany) was used. The amplified products were visualized by ethidium bromide staining after gel electrophoresis of 10 ^L of the final reaction mixture in 1.5% agarose. Strains of E. coli O157:K88ac:H19, CAPM 5933 and E. coli O159:H20, CAPM 6006 were used as positive controls.
Table 1: Sequences and predicted lengths of PCR amplification products of the oligonucleotide primers used in this study
Reference	Product size (bp)	Primer sequences (5'-3')	Primers name	Pathogenic factor
(16)	1105	ATCTTATACTGGATGGGATCATCTTGG GCAGAACGACGTTCTTCATAAGTATC	CNF1a CNF1b	Cytotoxic necrotizing factor 1 (cnfl)
(17)	543	AATCTAATTAAAGAGAAC CATGCTTTGTATATCTA	CNF2f CNF2r	Cytotoxic necrotizing factor 2 (cnf2)
(18)	366	AAATCGCCATTCGTTGACTACTTCT TGCCATTCTGGCAACTCGCGATGCA	Stx1f Stx1r	Shiga toxin 1 (six!)
(18)	282	CGATCGTCACTCACTGGTTTCATCA GGATATTCTCCCCACTCTGACACC	Stx2f Stx2r	Shiga toxin 2 (stx2)
(19)	629	TGCGGCACAACAGGCGGCGA CGGTCGCCGCACCAGGATTC	EAE1 EAE2	Enteropathogenic attachment & effacement (eaeA)
(16)	430	AAATCACCAAGAATCATCCAGTTA AAATCTCCTGCAATCATCCAGTTTA	Cdt 1 Cdt 2	Cytolethal distending factor (cdtB)
(16)	720	ATGGCAGTGGTGTCTTTGGTG CGTCCCACCATACGTGCTCTTC	PapA-f PapA-r	P-Fimbriae (papA)
(16)	240	GTGGATACGACGATTACTGTG CCGCCAGCATTCCCTGTATTC	SfaS-f SfaS-r	S-Fimbriae adhesion (sfaS)
(16)	880	TGATTAACCCCGCGACGGGAA CGCAGTAGGCACGATGTTGTA	fyuA-f fyuA-r	Yersiniabactin (fyuA)
(16)	300	GGCTGGACATCATGGGAACTGG CGTCGGGAACGGGTAGAATCG	AerJ-f AerJ-r	Aerobactin (iutA)
(16)	290	GGTGTGGTGCGATGAGCACAG CACGGTTCAGCCATCCCTGAG	TraT-f TraT-r	Serum survival (traT)
(20)	432	CAATGCAGATGCAGATACCG CAGAGATGTCGTTGCAGCAG	Hly F Hly R	Haemolysin (hlyA)
Results
Eventually, 78 E. coli strains (representative of 78 different colony morphologies) (26%) were isolated from 300 samples (Table 2). Colony confirmation was performed by biochemical and molecular (PCR) methods. According to the obtained results, most pollution is related to cow's milk.
PCR assays were successfully developed for detection of twelve different virulence genes of
genomic DNA of E. coli isolates from milk and dairy products. Agarose gel electrophoresis of PCR products revealed various bands that represent each virulence gene. In our research, 33 and 52 of E. coli isolates had Stxl and Stx2, respectively. By colony counting, 93.5% of independent isolates of Stx-positive E. coli was detected among 78 E. coli isolates; and, Stx1 and Stx2 genes were detected in 33 and 52 isolates, respectively. But, eaeA gene was not found in any of the samples.
162
R. Farzan, E. Rahimi, H. Momtaz
The prevalence of samples containing Six-positive and other virulence genes-positive E. coli is shown in Table 2. The prevalence of virulence genes was evaluated. 38.4% of the isolates contained only one virulence gene, 26.9% contained two, and, 34.6% contained three or more virulence genes. None of the samples in this study was positive on
E. coli O157:H7 (the prevalence of eaeA gene was 0.0%). Our study showed that cow's milk (41.5%), cheese and ice cream (16.6%) had the highest prevalence of STEC. PCR-amplification and individually amplified fragments of gene detection were subjected to agarose gel electrophoresis (Figure 1 and 2).
Table 2: Distribution of virulence factor genes in E. coli isolated from raw milk and dairy products
Sample	Sample No.	E.coli positive (%)	stxI	stxII	eaeA	cnfl	cnJ2	iutA	cdtB	papA	hlyA	traT	sJaS	JyuA
Sheep milk	35	6 (17.1)	3	4	-	3	3	3	1	3	1	4	-	2
Goat milk	46	7 (15.21)	3	4	-	2	2	2	1	4	1	5	-	1
Cow milk	106	44 (41.5)	16	35	-	26	12	12	9	18	5	14	-	6
Buffalo milk	21	6 (28.5)	1	3	-	4	2	2	1	1	2	1	-	-
Cheese	42	7 (16.6)	6	5	-	2	1	1	1	4	2	1	-	1
Butter	32	5 (15.6)	3	1	-	4	3	3	-	-	1	4	-	-
Ice cream	18	3 (16.6)	1	-	-	1	-	-	1	-	-	-	-	-
Total	300	78 (26.0)	33	52	-	42	23	23	14	30	12	29	-	10
M 1234? 67
700 500 400

M 1 2 3 4 5 6 7
	|
	mm
1000	
750	—
500	mm
Figure 1: Agarose gel electrophoresis of PCR products amplified with PCR method for the cnf2 (543 bp), Stxl (366 bp), Stx2 (282 bp), cdtB (430 bp), papa (720 bp), iutA (300 bp) and traT (290 bp) genes in E. coli isolated from raw milk and dairy products
Figure 2: Agarose gel electrophoresis of PCR products amplified with PCR method for the cnfl (1105 bp), fyuA (880 bp) and hlyA (432 bp) genes in E. coli isolated from raw milk and dairy products
Virulence properties of Shiga Toxin-Producing Escherichia co//isolated from Iranian raw milk and dairy products
163
Discussion
Milk and dairy products can harbor a variety of microorganisms and can be an important source of food-borne pathogens. The presence of food-borne pathogens in milk is due to direct contact with contaminated sources in the dairy farm environment and to udder excretion of an infected animal. There are several reasons to be concerned about the microbial quality of dairy products: first, outbreaks of disease in humans have been traced back to the consumption of unpasteurized milk, and also to pasteurized milk; second, unpasteurized milk is consumed directly by dairy producers, farm employees, their families and neighbours, and raw milk advocates; third, unpasteurized milk is consumed directly by a large segment of population via consumption of several types of cheese produced from unpasteurized milk (21,22).
Nowadays, public health concern associated with microbial food safety is on the increase since E. coli is not only regarded as an indicator of faecal contamination but more likely as an indicator of poor hygiene and insufficient sanitary practices during milking. Furthermore, Shiga toxin-producing strains of Escherichia coli (STEC) are now recognized as an important agent of diarrhea and other foodborne-related illnesses through ingestion of contaminated food (23,24). Hence, the prevalence of Shiga toxin-producing E. coli isolated from milk and dairy products is evaluated in the present study. Our results indicate that 78 (26%) of 300 Iranian milk and dairy samples were contaminated with E. coli. 93.5% were found to be positive on two target genes, Stx1 and Stx2. To our knowledge, the main reason for such high prevalence of E. coli and their virulence factors in milk and dairy products arises from contamination with faeces. Yet other reasons are: failure to comply with relevant rules, unsanitary milking, failure to control the staff of milking room and factories and/or workshops producing butter, ice cream and cheese, and finally, the use of raw animal milk for the production of dairy products.
The data of this study is older than the recent survey conducted for detection of prevalence and antimicrobial resistance of E. coli O157 isolated from Iranian traditional cheese, ice cream and yoghurt. The study reports about E. coli O157 being detected in 9 (3.1%) of the 290 samples tested, 5 isolated from traditional cheese and
4 isolated from traditional ice cream samples, whereas E. coli O157: H7 was not detected in any of the samples (25). One reason for this difference may be due to differences in the areas under study and the number of samples. Yet another study was conducted to investigate the presence of E. coli O157 and E. coli O157: H7 strains, and the presence of virulence genes Stx1, Stx2, eaeA and ehlyA isolates derived from some Iranian traditional dairy products and minced beef meat. E. coli non-O157, E. coli O157: NM and E. coli O157:H7 were isolated from 7%, 1.5% and 0.5% of the traditional butter, cream and kashk (a dairy product, similar to sour cream), respectively. Also, all E. coli O157:H7/NM isolates were positive on eaeA and Stx1 and/or Stx2, and one E. coli O157:H7 isolate was positive on ehlyA. Of the 3 Stx-positive isolates, one and two isolates contained Stx1 and Stx2, respectively (26).
Globally, several other studies reported the prevalence of E. coli and virulence properties of dairy products. For example in Italy, a polyphasic approach was evaluated for the detection of eight staphylococcal enterotoxin (SE)-encoding genes (sea, sec, sed, seg, seh, sei, sej, set) and the Escherichia coli genes were most commonly associated with the virulence factors (eae, elt, ipaH, Stx) in traditional soft cheese, produced artisanally from raw milk in the Lombardy region. The results indicate that some of the artisanal cheese examined may constitute a potential hazard for the consumer health (27). According to the study of raw milk cheese production in Kerman, Iran, Stxgenes were detected in 6.4% of the samples, but STEC strains were isolated in only 5 of them (4%) (28). Another study from Iran shows that about 21.8% of E. coli isolates from cattle were positive on ehxA, Stx1 , and/or Stx2 genes (29), but our study indicates that Stxl and cnfl with incidences of 42.3% and 53.84% had the highest frequency rate of virulence genes of E. coli isolates from raw milk samples. The results offer an answer to why food contamination from animal faecal sources is so common in Iran.
Yet another study of lamb food chain shows that all three virulence genes, eae, Stxl, and Stx2 were the most prevalent genes in slaughterhouses (69%), processing plants (32%) and butcheries (910%) (30), but our results indicate that Stx2 and cnfl had the highest prevalence of E. coli virulence genes in raw milk and dairy products.
164
R. Farzan, E. Rahimi, H. Momtaz
Detection of bacteria in milk samples is still important, especially in more rural areas as it is easily available and economical. Due to bad climate conditions in some geographical places of Iran, oxen, ewes and goats have unsatisfactory survival conditions, so buffaloes present the main milk source for people. Buffalo's milk hygiene is therefore essential for human health, especially in arid and desert areas.
In United States, Van Kessel et al. (31) detected Shiga toxin genes enrichments in 15.2% of the bulk tank milk samples and in 51.0% filters by real-time PCR. These data confirm those from earlier studies showing significant contamination of bulk tank milk by zoonotic bacterial pathogens, and also, that the consumption of raw milk and raw milk products present a health risk. In Spain, occurrence of STEC in 'Castellano' cheese, a non-cooked and hard or semi-hard Spanish cheese made from ewe's milk, was reported. According to the report, three STEC strains were detected in two samples (2.4%) of 'Castellano' cheese, one with 2.5 and the other one with 12 month-ripening period. From those STEC isolates, two were identified as E. coli O14 and one third presented an O-specific polysaccharide not-groupable serologically (ONG) (32). In Bangladesh, the prevalence of Shiga toxin (Stx)-producing Escherichia coli was found in different types of food samples, and their genetic relation to STEC strains previously isolated from animal sources was investigated. In this study, approximately 10% of raw milk and 8% of fresh juice samples were positive for Stx (33).
All these data lead to conclusion that milk and dairy products represent a potential hazard for consumers, due to the potential presence of Shiga-toxin-producing E. coli, because of neglected sanitary measures during manufacture, handling and distribution of such fresh foods. Consequently, food manufacturers and specialists should design comprehensive programmes as good manufacturing practices (GMP) and implementation of HACCP system to ensure food free from the pathogens. In addition, effective heat treatments of food, providing information to food handlers and consumers, as well as implementation of strict hygienic measures during manufacture, storage and sale of these products are of significant importance in improving the quality of food and safeguarding the consumers against infections with such organisms. On the other hand, since many people still drink raw milk,
especially in rural areas, this emphasises the need for educational efforts about health risks associated with consumption of raw, unpasteurized milk.
Acknowledgements
Our greatest appreciations go to Dr. M.D. Rahimian and Mr. M. Momeni for their valuable cooperation. Besides, this study could not have been conducted without the assisstance of Islamic Azad University Shahrekord Branch in Iran.
Reference
1.	Altalhi AD, Hassan SA. Bacterial quality of raw milk investigated by Escherichia coli and isolates analysis for specific virulence-gene markers. Food Control 2009; 20: 913-7.
2.	Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol 2004; 2: 123-40.
3.	Law D. Virulence factors of Escherichia coli O157 and other Shiga toxin-producing E. coli. J Appl Microbiol 2000; 88: 729-45.
4.	Vidal M, Kruger E, Durän C, et al. Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol 2005; 43: 5362-5.
5.	Bettelheim KA. Enterohaemorrhagic Escherichia coli O157:H7: a red herring? J Med Microbiol 2001; 50: 201-2.
6.	Elliott EJ, Robins-Browne RM, O'Loughlin EV, et al. Nationwide study of haemolytic urae-mic syndrome: clinical, microbiological, and epi-demiological features. Arch Dis Child 2001; 85: 125-31.
7.	Gyles CL. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci 2007; 85: E45-62.
8.	Erickson MC, Doyle MP. Food as a vehicle for transmission of Shiga toxin-producing Escherichia coli. J Food Prot 2007; 70: 2426-49.
9.	Caprioli A, Morabito S, Brugere H, et al. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res 2005; 36: 289-311.
10.	Hussein HS, Sakuma T. Prevalence of shi-ga toxin-producing Escherichia coli in dairy cattle and their products. J Dairy Sci 2005; 88: 450-65.
11.	Lira WM, Macedo C, Marin JM. The incidence of Shiga toxin-producing Escherichia coli
Virulence properties of Shiga Toxin-Producing Escherichia co//isolated from Iranian raw milk and dairy products
165
in cattle with mastitis in Brazil. J Appl Microbiol 2004; 97: 861-6.
12.	IDF Standard 50C. Milk and milk products-guidance on methods of sampling. Brussels, Belgium: International dairy Federation, 1995.
13.	Sabat G, Rose P, Hickey WJ, et al. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl Environ Microbiol 2000; 66: 844-9.
14.	Fode-Vaughan KA, Maki JS, Benson JA, et al. Direct PCR detection of Escherichia coli O157:H7. Lett Appl Microbiol 2003; 37: 239-43.
15.	Reischl U, Youssef MT, Kilwinski J, et al. Real-time fluorescence PCR assays for detection and characterization of Shiga toxin, intimin, and enterohemolysin genes from Shiga toxin-producing Escherichia coli. J Clin Microbiol 2002; 40: 2555-65.
16.	Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis 2000; 181: 261-72.
17.	Blanco M, Blanco JE, Blanco J, et al. Polymerase chain reaction for detection of Escheri-chia coli strains producing cytotoxic necrotizing factor type 1 and 2 (CNF1 and CNF2). J Microbiol Methods 1996; 26: 95-101.
18.	Brian MJ, Frosolono M, Murray BE, et al. Polymerase chain reaction for diagnosis of en-terohemorrhagic Escherichia coli infection and hemolytic-uremic syndrome. J Clin Microbiol 1992; 30: 1801-6.
19.	Heuvelink AE, van de Kar NC, Meis JF, et al. Characterization of verocytotoxin-producing Escherichia coli O157 isolates from patients with haemolytic uraemic syndrome in Western Europe. Epidemiol Infect 1995; 115: 1-14.
20.	Idress M, Mussarat U, Badshah Y, et al. Virulence factors profile of drug-resistant Escher-ichia coli isolates from urinary tract infections in Punjab, Pakistan. Eur J Clin Microbiol Infect Dis 2010; 29: 1533-7.
21.	Oliver SP, Jayarao BM, Almeida RA. Food-borne pathogens in milk and the dairy farm environment: food safety and public health implications. Foodborne Pathog Dis 2005; 2(2):115-29.
22.	Collins CH, Lyne PM, Grange J. Collins and Lyne's microbiological methods. 7th ed. Oxford: Butterworth-Heinemann, 1995.
23.	Zschöck M, Hamann HP, Kloppert B, et al. Shiga-toxin-producing Escherichia coli in faeces of healthy dairy cows, sheep and goats: preva-
lence and virulence properties. Lett Appl Microbiol 2000; 31: 203-8.
24.	Hayes MC, Ralyea RD, Murphy SC, et al. Identification and characterization of elevated microbial counts in bulk tank raw milk. J Dairy Sci 2001; 84: 292-8.
25.	Rahimi E, Shekarchian Chaleshtori S, Parsaei P. Prevalence and antimicrobial resistance of Escherichia coli O157 isolated from traditional cheese, ice cream and yoghurt in Iran. Afr J Microbiol Res 2011; 5: 3706-10.
26.	Rahimi E, Momtaz H, Hosseini Anari MM, et al. Isolation and genomic characterization of Escherichia coli O157:NM and Escherichia coli O157:H7 in minced meat and some traditional dairy products in Iran. Afr J Biotech 2012; 11: 2328-32.
27.	Bernini V, Sgarbi E, Bove CG, et al. A polyphasic approach to detect enterotoxigenic Staphylococcus aureus and diarrheagenic Es-cherichia coli in raw milk Italian cheeses by multiplex PCR. J Food Prot 2010; 73: 2281-4.
28.	Mansouri-Najand L, Khalili M. Detection of shiga-like toxigenic Escherichia coli from raw milk cheeses produced in Kerman-Iran. Vet Arh 2007; 77: 515-22.
29.	Mazhaheri Nejad Fard R, Behzadian Nezhad G. Evaluation of ehxA, stxl, and stx2 virulence gene prevalence in cattle Escherichia coli isolates by multiplex PCR. Arch Razi Ins 2005; 60: 55-66.
30.	Osés SM, Rantsiou K, Cocolin L, et al. Prevalence and quantification of Shiga-toxin producing Escherichia coli along the lamb food chain by quantitative PCR. Int J Food Microbiol 2010; 141: S163-9.
31.	Van Kessel JA, Karns JS, Lombard JE, et al. Prevalence of Salmonella enterica, Listeria monocytogenes, and Escherichia coli virulence factors in bulk tank milk and in-line filters from U.S. dairies. J Food Prot 2011; 74: 759-68.
32.	Caro I, Garcia-Armesto MR. Occurrence of Shiga toxin-producing Escherichia coli in a Spanish raw ewe's milk cheese. Int J Food Microbiol 2007; 116: 410-3.
33.	Islam MA, Mondol AS, Azmi IJ, et al. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh. Food-borne Pathog Dis 2010; 7: 1381-5.
166
R. Farzan, E. Rahimi, H. Momtaz
VIRuLENTNOST SEVA BAKTERIJE ESCHERICHIA COLI, KI IZLOČA ŠIGA TOKSIN, IZOLIRANE IZ SUROVEGA MLEKA IN MLEČNIH IZDELKOV
R. Farzan, E. Rahimi, H. Momtaz
Povzetek: Sevi bakterije Escherichia coli, ki izločajo šiga (Stx) toksin (STEC), so raznolika skupina patogenov, ki jih lahko najdemo v hrani in so različno nevarni za človeka. Glavni cilj raziskave je bil določiti virulentnost STEC, izoliranih iz surovega mleka in mlečnih izdelkov v Iranu.
Skupno število 300 vzorcev, ki so vključevali mleko ovac (35), koz (46), krav (106) in bivolov (21), mehki sir (42), maslo (32) in sladoled (18), je bilo pridobljenih iz zbiralnih rezervoarjev na kmetijah, zbirnih centrov za mleko, različnih trgovin in od trgovcev na drobno iz različnih področij Irana. Biokemijske in molekularne metode (PCR) so pokazale, da je bilo 26 % vzorcev pozitivnih na E. coli in med njimi smo gene Stx1 in Stx2odkrili v 33 oziroma 52 vzorcih. Genov eaeA in sfaSnismo našli v nobenem vzorcu. Poleg gena Stx2 je imel najvišjo prevalenco (42 izolatov) gen cnfI, poleg genov eaeA in sfaS pa je imel najnižjo prevalenco izmed virulentnih genov gen fyuA. Rezultati raziskave kažejo na to, da so potencialno virulentni sevi E. colivokolju zelo razširjeni in da je hrana lahko vzrok za okužbo ljudi.
Ključne besede: STEC; Escherichia coli, virulentni faktorji; surovo mleko
Slov Vet Res 2012; 49 (4): 167-75 UDC 615.9:546.3:638.165.8
Original Scientific Article
CONTENT OF FIVE TRACE ELEMENTS IN DIFFERENT HONEY
types from koprivnica-krizevci county
Nina Bilandzic1, Maja Dokic1, Marija Sedak1, Ivana Varenina1, Bozica Solomun Kolanovic1, Ana Koncurat2, Branimir Simic3, Nevenka Rudan4
1Laboratory for residue control, Department for Veterinary Publish Health, Croatian Veterinary Institute, Zagreb; laboratory for Culture Media Preparation and Sterilisation, Krizevci Veterinary Institute, Krizevci; 3Faculty of Food Technology and Biotechnology, 4Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia
Corresponding author, E-mail: bilandzic@veinst.hr
Summary: Multifloral and unifloral honeys [black locust (Robinia pseudoacacia L.), chestnut (Castanea sativa Mill.), lime (Tilia spp.), indigobush (Amorfa fruticoza L.) and rapeseed (Brassica napus)] were collected from Koprivnica-Krizevci County in northwestern Croatia during 2010 and 2011. The concentrations of Cd, Pb, Hg, As and Cu were determined and mean levels of elements (mg/kg) in honey samples measured were: in multifloral 1.26 for Cd, 163 for Pb, 135 for As, 1.35 for Hg and 11.7 for Cu; in black locust 1.52 for Cd, 182 for Pb, 23.2 for As, 0.46 for Hg and 7,697 for Cu; in lime 2.92 for Cd, 340 for Pb, 116 for As, 0.74 for Hg and 7,798 for Cu. Significant differences in Hg and Cu levels were observed between honey types. Average Cu levels found in lime and black locust honey types were much higher than those reported in other European countries. The highest element contents measured in different honey types were: Cd 4.0 mg/kg and As 502 mg/kg in rapeseed, Hg 6.11 mg/kg in chestnut, Pb 2,159 mg/kg in black locust and Cu 79,167 mg/kg in indigobush. Lead concentrations measured in all honey types were much higher than levels obtained in Italy, Slovenia, Poland, Romania and Turkey. These indicate that special attention should be paid to ensuring positions of hive in zones of bee forage that are more distant from highways and railways. The results presented indicate a differentiation of the trace element content of honeys of different botanical origin obtained from the same area.
Key words: different honey types; metals; As; Cd; Cu; Hg; Pb
Introduction
Honey is a sweet natural product, produced by honeybees (Apis mellifera) that collect nectar from flowers and turn it into a product considered to be a delicious food and known to be a healthier nutritional choice than sugar (1). It is mainly composed of fructose and glucose (65 %) and water (18 %), while protein contents are low (2). The mineral content in honey is low and ranges from about 0.04 % in pale honeys to 0.2 % in dark honeys (3). Honeybees are estimated to forage on plants growing over a relatively large area (more than 7 km2) and when
Received: 5 April 2012
Accepted for publication: 31 August 2012
going from flower to flower, are also in contact with air, water and soil, branches and leaves. Therefore, honey is the result of a bio-accumulative process useful for collecting information about the environment and may be considered a bioindicator of environmental pollution (4).
The great variability of the trace element content in different honey types is closely related to botanical and geographical origin with regards to soil and climate characteristics (5). Environmental pollution factors that may contribute to the presence of metals in honey may be caused by non-ferrous metallurgy, industrial smelter and factories, leaded petrol, and agrochemicals such as cadmium-containing fertilizers, and organic mercury and arsenic-based pesticides still in use in some countries (6, 7).
168
N. Bilandžič, M. Dokič, M. Sedak, I. Varenina, B. Solomun Kolanovič, A. Končurat, B. Šimič, N. Rudan
In addition to the environmental importance, the determination of trace metals is important regarding to quality control of honey and because the fact that today's total production of honey in the world is increasing. The European Union is the world's largest consumer of honey (1, 8).
In the past decade, different trace metals content have been determined in different honey types in European countries: France (9), Italy (10-12), Slovenia (13, 14), Poland (15), Czech Republic (16), Romania (6), Spain (17-19) and Turkey (20-23). In most of these studies, the botanical influence on honey composition has been neglected and only the differences among regions and the geographical origin of honey have been tested.
In Croatia, the most common unifloral honey types are black locust (Robinia pseudoacacia L.), chestnut (Castanea sativa Mill.) and lime (Tilia spp.), while the unifloral honeys indigobush (Amorfa fruticoza L.) and rapeseed (Brassica napus) are rarer. Unifloral honeys originating from Lavandula stoechas and Salvia officinalis are also rare and are indicative of the southern geographical origin in the country.
The aim of the present study is to examine the concentrations of the toxic trace metals Cd, Pb, Hg, As and Cu in different honey types collected in the same geographical region, in Koprivnica-Krizevci County in northwestern Croatia.
Materials and methods
Sample collection
A total of 14 different honey type samples were collected: 3 multifloral, 5 black locust (Robinia pseudoacacia L.), 3 lime (Tilia spp.), 1 chestnut (Castanea sativa Mill.), 1 indigobush (Amorfa fruticoza L.) and 1 rapeseed (Brassica napus). Honey samples were produced and collected during 2010 and 2011 from individual beekeepers near the towns Križevci, Durdevac, Koprivnica and Virovitica in Koprivnica-Križevci County (Table 1).
Koprivnica-Križevci County covers an area of about 1,746 km2 and the urban centres Križevci, Durdevac, Koprivnica and Virovitica each have populations of 20,000 to 55,000. The region is relatively clean, as economic activities are primarily agricultural with cultivated fields and woods, and a high representation of vineyards. The region has no pronounced industrial activities and vehicular traffic is rather low in comparison with European standards and the more populated, urbanized and industrialized Centre region around the capital city, Zagreb.
Following collection, honey samples (500 g) were placed into clean glass bottles, labelled and brought to the laboratory and stored at 4-8°C until analysis.
Table 1: Geografical and botanical origin of honey samples
Sample no.	Sample identification	Honey type (common name)	Geographical origin	Year
1	BL 1	Black Locust	Durdevac	2010
2	BL 2	Black Locust	Durdevac	2011
3	BL 3	Black Locust	Durdevac	2011
4	BL 4	Black Locust	Koprivnica	2011
5	BL 5	Black Locust	Križevci	2011
6	L 1	Lime	Durdevac	2011
7	L 2	Lime	Durdevac	2010
8	L 3	Lime	Koprivnica	2011
9	MF 1	Multifloral	Koprivnica	2011
10	MF 2	Multifloral	Durdevac	2011
11	MF 3	Multifloral	Križevci	2011
12	C	Chestnut	Durdevac	2010
13	I	Indigobuch	Virovitica	2010
14	R	Rapeseed	Koprivnica	2010
Content of five trace elements in different honey types from Koprivnica-Krizevci county
169
Standard preparation
Acid used, HNO3 and HCl were of analytical reagent grade (Kemika, Croatia). Ultra high purity water processed through a purification system NIRO VV UV UF 20 (Nirosta d.o.o. Water Technologies, Osijek, Croatia) was used for all dilutions. Calibrations were prepared with element standard solutions of 1 g/l of each element (Perkin Elmer, USA). Stock solution was diluted in HNO3 (0.2 %). In the preparation of Hg standards, 1 ml of HNO3 conc., 0.1 ml 10 % K2Cr2O7, and 0.1 ml HCl conc. were added to all working standards and prepared in brown glass volumetric flasks. As matrix modifiers in each atomization for As, Cd, Cu and Pb, 0.005 mg Pd(NO3)2 and 0.003 mg Mg(NO3)2 (Perkin Elmer, USA) were used.
Plastic and glassware were cleaned by soaking in diluted HNO3 (1/9; v/v) and by subsequent rinsing with high purity water and drying prior to use.
Sample preparation
Honey samples (0.5 g) were digested with 4 ml HNO3 (65 % v/v) and 2 ml H2O2 (30 % v/v) with a Multiwave 3000 microwave closed system (Anton Paar, Germany). A blank digest was carried out in the same way. The digestion programme began at a power of 500 W, ramped for 1 min and hold for 4 min. The second step began at a power of 1000 W ramped for 5 min and hold for 5 min. The third step began at a power of 1400 W, ramped for 5 min and hold for 10 min. Digested samples were diluted to a final volume (50 ml) with double deionised water.
Determination of metals
Atomic absorption spectrometry by AAnalyst 800 and AAnalyst 600 (Perkin Elmer, USA) equipped with an AS 800 and AS 600 autosamplers (Perkin Elmer, USA) was used for measurement of As, Cd, Cu and Pb concentrations. Argon was used for graphite furnace measurements. Pyrolytic-coated graphite tubes with a platform were used. The atomic absorption signal was measured in peak area mode against a calibration curve.
Mercury in honey samples were quantified using the AMA-254 (Advanced Mercury Analyzer, Leco, Poland) without acid digestion by direct
combustion of the sample in an oxygen-rich atmosphere. The operating parameters for working elements are presented in Table 2.
Detection limits for the five metals were determined as the concentration corresponding to three times the standard deviation of twenty blanks. All samples were run in batches that included blanks, a standard calibration curve, two spiked honey samples, and one duplicate. In order to determine the method accuracy and to calculate the recovery percentage, ten honey samples were spiked with known amounts of Cd, Pb, As, Hg and Cu analytical standards.
Data analysis
Statistical analysis was performed using the software package Statistica 6.1 (StatSoft® Inc., USA). One-way analysis of variance was used to test for differences in honey metal concentrations. Data were log-transformed to improve normality prior to analysis to meet the underlying assumptions of the analysis of variance; the values given are therefore geometric means. The differences between the metal concentrations in different honey types were analyzed using the t-test. A probability level ofp < 0.05 was considered statistically significant.
Results and Discussion
In this study, concentrations of heavy metals and Cu were determined in six different honey types from the same geographical origin under the same climatic conditions.
The quality of data was checked by analysis of the recovery rate with spiked honey samples for Cd, Pb, Hg As and Cu and showed good accuracy, with recovery rates for metals of 95.9 % to 99.2 % (Table 3). The limits of detection (LODs, mg/kg) were: Cd 1.0, Pb 4.7, Hg 0.1, As 5.0 and Cu 1.2. The concentrations of the five elements in multifloral and unifloral honey samples are reported in Table 4. Statistical analyses by one-way ANOVA showed a significant difference in Cu levels (p<0.01). However, no significant differences were observed in Cd, As, Hg and Pb levels. It has to be point out that element levels results presented for honey types chestnut, rapeseed and indigobush is for one sample only.
170
N. Bilandžič, M. Dokič, M. Sedak, I. Varenina, B. Solomun Kolanovič, A. Končurat, B. Šimič, N. Rudan
In the present study, Cd content in all honey samples range from 1 to 5 pg kg-1. No significant differences were observed between different honey types. Literature values for different honey type originating from European countries are given in Table 5. Cadmium multifloral levels observed were similar to contents obtained in different geographical regions of Turkey (23), Macedonia (3.63 mg/kg; 24) and to previously reported levels in multifloral honey samples from different regions in Croatia (1.51 mg/kg; 25). In general, Cd levels in all honey types were 2 to 10 times lower than those reported in Italy (12) and Turkey (21, 22) and more
than 100 times lower than the high Cd levels found in mixed flower honey from Bologna, Italy (11).
Lead is one of the most widespread metal pollutants and, like Cd, can reach humans through air, water and food. This metal had no beneficial role in human metabolism and produces a progressive toxicity and can cause health disorders such as fatigue, sleeplessness, hearing and weight loss. A provisional tolerable weekly intake (PTWI), as acceptable levels of major toxic elements that can be ingested on a weekly basis and may accumulate in the body established by WHO (The World Health Organization) and FAO (Food and Agriculture
Table 2: Instrumental conditions for atomic absorption spectrometry and mercury analyzer and graphite furnace program (temperature and time) for Pb, Cd, Cu, As and Hg determination in honey samples
Conditions for graphite furnace atomic absorption spectrometry				
	Lead	Cadmium	Copper	Arsenic
Wavelength (nm)	283.3	228.8	324.8	193.7
Argon flow (ml/min)	250	250	250	250
Sample volume (|l)	20	20	20	20
Modifier volume (|l)	5	5	5	5
Heating pogram tempetature °C (ramp time (s), hold time (s))				
Drying 1	110 (1, 30)	110 (1, 30)	110 (1, 30)	110 (1, 30)
Drying 2	130 (15, 30)	130 (15, 30)	130 (15, 30)	130 (15, 30)
Ashing	900 (10, 20)	700 (10, 20)	1200 (10, 20)	1600 (10, 20)
Atomisation	1850 (0, 5)	1550 (0, 5)	2000 (0, 5)	2000 (0, 5)
Cleaning	2450 (1, 3)	2450 (1, 3)	2450 (1, 3)	2450 (1, 3)
Conditions for determination on mercury analyzer	
Wavelength (nm)	253.65
Drying time (s)	60
Decomposition time (s)	150
Wait time (s)	45
Weight / volume of sample	100 mg / 100 ml
Working range	0.05 - 600 ng
Element	Spiked value (mg/kg)	Measured value (mg/kg)	Recovery ( %)
Cd	10	9.67 ± 0.33	96.7
Pb	50	48.9 ± 6.45	97.8
Hg	10	9.92 ± 0.14	99.2
As	10	9.59 ± 0.27	95.9
Cu	50	49.4 ± 5.23	98.8
Table 3: Trace metal concentrations and recoveries in spike honey samples
Content of five trace elements in different honey types from Koprivnica-Krizevci county
171
Table 4: Concentrations of trace elements Cd, Pb, As, Hg and Cu (mg/kg) in honey samples of different botanical origin from Koprivnica-Krizevci County
Sample	Cd	Pb	As	Hg	Cu
identification	(mg/kg)	(mg/kg)	(mg/kg)	(mg/kg)	(mg/kg)
BL 1	4.0	270	11.0	0.90	318
BL 2	1.0	134	10.1	0.62	1091
BL 3	1.0	62.1	12.2	0.13	1272
BL 4	2.0	2159	499	0.53	124
BL 5	1.0	41.3	10.0	0.51	665
Geometric mean	1.52	182	23.2	0.46	515 ab
L 1	5.0	303	512	0.75	47.5
L 2	2.0	364	11.1	1.21	195
L 3	2.5	358	279	0.45	86.1
Geometric mean	2.92	340	116	0.74	92.7 ac
MF 1	2.0	438	185	2.41	10.1
MF 2	1.0	134	118	0.83	12.1
MF 3	1.0	73.2	112	1.22	13.2
Geometric mean	1.26	163	135	1.35	11.7 bc
C	1.0	1637	30.1	6.11	53.4
I	1.0	159	11.1	1.62	154
R	4.0	180	502	1.11	29.2
Significant differences between honeys: a BL:L p < 0.05; b BL:MF p < 0.01; c L:MF p < 0.01;
Table 5: Overview of the element contents in different honey types from different countries
	Country Honey type (reference)			
Element (Pg/kg)	Italy MF1-mixed floral (11) C-chestnut (11) MF2- multifloral (12) MF3- multifloral (10)	Slovenia MM-monofloral (13)	Spain MM-multifloral + monofloral (18)	Turkey MF1 -multifloral (21) MF2 -multifloral (22) MF3-multifloral (23)
Cd	MF1 305 C < 50 MF2 4.25	-	-	MF1 10.9 - 21.2 MF2 1.1 - 17.9 MF3 0.38 - 2.03
Pb	MF1 620 C < 50 MF2 76.4	MM 1.86 - 4.3	-	MF1 17.6 - 32.1 MF1 8.4 - 106 MF3 1.54 - 36.7
Hg	MF2 < 2	-	-	-
As	MF2 6.59	MM 1.24 to 1.49	-	-
Cu * mg/kg	MF1 890 C < 50 MF2 647 MF2 0.31*	MM 1.4 to 2.7 *	MM 0.1-1.73*	MF1 0.25 - 1.1* MF2 0.23 - 2.41* MF3 9.97 - 29.5
172
N. Bilandžič, M. Dokič, M. Sedak, I. Varenina, B. Solomun Kolanovič, A. Končurat, B. Šimič, N. Rudan
Organization): Cd (7 mg/kg b.w.), Pb (25 mg/kg b.w.), As (15 mg/kg b.w.) and Hg (5 mg/kg b.w.) (26-28). In 2000 the maximum residue limit (MRL) values of 0.1 mg/kg for Cd and 1 mg/kg for Pb were proposed for the European Union. However, until today there are no established MRL values for heavy metals in honey. In Croatia there is not established maximum permitted levels for the Cd, Hg, Pb, As and Cu. According to the published data, only in Macedonia maximum permitted value for Cd and Cu in honey is set to be 0.03 mg/kg for Cd and 1 mg/kg for Cu (24, 29). In the present study, obtained mean concentrations of Cd and Pb were below MRL values proposed by EU.
Lead contents decreased in the following order: chestnut > black locust > lime > multifloral > rapeseed > indigobush. The lowest and highest Pb concentrations obtained were 159 mg/kg in indigobush honey and 2,159 mg/kg in black locust honey. Mean Pb concentrations measured in black locust, lime and multifloral honeys were much higher (in some cases for more that 4,000 times) than levels obtained in other countries: Italy (12), Poland (70 mg/kg; 15), Turkey (21, 22) and Romania (0.07 mg/kg; 6). However, only in multifloral honey were Pb levels for 3.8-time lower than those found in mixed flower honey from Italy (11). With regards to fact that studied region has no pronounced industrial activities and vehicular traffic is rather low it is not clear why higher concentrations of Pb were determined. It is only be assume that may be due to the position of hives in zones near highways and railways during, which is often the case. Other factor that may contribute is that in soils, and suspended air particulates, concentrations of Pb were influenced by distance from highway and direction of prevailing winds. Also it is demonstrated that Pb accumulation in and on plants next to highways were caused principally by aerial deposition and not by, at least to any great extent, absorption by the plant from contaminated soil (30). On the other hand, Pb is relatively unavailable to plants when the soil pH level is above 6.5. In case of pH values less than 6.5 there is actual increase of Pb uptake by the plant itself from soil. Recent study of soil metal content in Croatia shown that Pb is present in much higher amounts in soil (25.3-27.0 pg/g d.w.) than for example Cd (0.2 pg/g d.w.) (31).
In this study, As levels ranged from the lowest level of11.1 mg/kg in indigobush honey to 502 mg/ kg in rapeseed honey. In comparison to the very few literature data, As levels obtained were higher
than those found in Siena County, Italy (12), but more than 9 time lower than levels in Slovenia (13).
Environment pollution by mercury may be caused by industrial activities, mining and combustion and pollution from agricultural sources (32). Several reports were available for Hg concentrations in honey samples. Mercury levels ranged from 50 to 212 mg/kg in contaminated and from 1 to 3 mg/kg in uncontaminated areas in Slovakia (33). In multifloral and other honey types examined in Siena County in Italy, Hg levels were lower than the quantification level of 2 mg/kg (12). In the present study, Hg ranged from a minimal of 0.13 mg/kg in black locust honey to a maximum of 6.11 mg/kg in chestnut honey.
As an essential element, Cu may influence growth, skin pigmentation, bone mineralisation, gastrointestinal and heart function. However, Cu may also generate toxic effects such as dermatitis, liver cirrhosis and neurological disorders, while acute Cu poisoning causes symptoms of nausea, vomiting and abdominal and muscle pain (34). The provisional permitted daily intake for Cu determined in an average adult with 60 kg body weight is 3 mg (35). Copper can enter the food chain and also honey through the mineralisation of crops and due to its application on a large number of crop pests as a fungicide, bactericide and herbicide in the vicinity of the hives locations (36).
In the present study, Cu concentrations ranged from the lowest concentration of 10.1 mg/kg measured in multifloral honey to the highest of 1,272 mg/kg in black locust honey. Mean Cu levels determined in multifloral honey were significantly lower than those of lime and black locust honey types (p < 0.01, both). Also, significantly higher Cu concentration was determined in black locust than in lime honey (p < 0.05). Differences in the element content between different honey types have also been reported in previous studies (12, 16, 23, 37).
In previous studies, upper Cu limit determined in other parts of the world was around 2 mg/g (38). Average Cu levels found in multifloral honey (11.7 mg/kg) were more than 25 lower than those reported in previous studies from Italy (10, 11, 12), and more than 110 and 230 times lower than the highest level measured in Turkey (21, 22), Spain (18) and Slovenia (13). Also, the mean Cu level determined were more than 90 times lower than previously obtained results for multifloral honey samples from different regions in Croatia (1074 mg/kg; 25). On the other hand, the results
Content of five trace elements in different honey types from Koprivnica-Krizevci county
173
obtained were similar to levels found in the Black Sea region in Turkey (23).
Copper levels determined in chestnut honey in this study are higher than those from Bologna, Italy (11) but for 8 times lower than those found in chestnut honey from Anatolia, Turkey (0.42 mg/ kg; 39). On the other hand, Cu levels determined in monofloral honeys black locust and lime was lower that those found in Slovenia (13) and Spain (18). A soil metal study in Croatia showed low Cu levels raging form 10 to 25.4 pg/g d.w. in region studied (31).
The quantities of heavy metals in honey are usually so small that even 100 g eaten daily would not contribute appreciably to dietary requirements. However, if in the environment is increased one or more elements these increased content of it in honey which then has a significant impact. As a result of present study, trace element levels of Pb and Cu determined in multiflora! honey were lower than in unifloral honey black locust, lime and chestnut honeys obtained in the same geographical region. Accordingly, these results represent a differentiation of the trace element content in honeys of different botanical origin obtained from the same geographical region.
Acknowledgments
The authors wish to acknowledge Mirjana Hren and Tamara Nekic for their assistance in sample preparation.
References
1.	Vanhanen LP, Emmertz A, Savage GP. Mineral analysis of mono-floral New Zealand honey. Food Chem 2011; 128: 236-40.
2.	Silva LR, Videira R, Monteiro AP, Valentáo P, Andrade PB. Honey from Luso region (Portugal): physicochemical characteristics and mineral contents. Microchem J 2009; 93: 73-7.
3.	Fernández-Torres R, Pérez-Bernal JL, Bello-López MA, Callejón-Mochón M, Jiménez-Sánchez JC, Guiraúm-Pérez A. Mineral content and botanical origin of Spanish honeys. Talanta 2005; 65: 686-91.
4.	Conti ME, Botre F. Honeybees and their products as potential bioindicators of heavy metals contamination. Environ Monit Assess 2001; 69: 267-82.
5.	Bogdanov S, Haldimann M, Luginbühl W, Gallmann P. Minerals in honey: environmental, geographical and botanical aspects. J Apic Res 2007; 46: 269-75.
6.	Bratu I, Georgescu C. Chemical contamination of bee honey: identifying sensor of the environment pollution. J Cent Eur Agric 2005; 6: 95-8.
7.	Rashed MN, El-Haty MTA, Mohamed SM. Bee honey as environmental indicator for pollution with heavy metals. Toxicol Environ Chem 2009; 91: 389-403.
8.	Ma L. International comparison of the export competitiveness of Chinese honey. Asian Agric Res 2009; 1: 17-20.
9.	Devillers J, Dore JC, Marenco M, Poirier-Duchene F, Galand N, Viel C. Chemometrical analysis of 18 metallic and non metallic elements found in honeys sold in France. J Agric Food Chem 2002; 50: 5998-6007.
10.	Conti ME. Lazio region (central Italy) honeys: a survey of mineral content and typical quality parameters. Food Control 2000; 11: 459-63.
11.	Buldini PL, Cavalli S, Mevoli A, Sharma JL. Ion chromatographic and voltametric determination of heavy and transition metals in honey. Food Chem 2001; 3: 487-95.
12.	Pisani A, Protano G, Riccobono F. Minor and trace elements in different honey types produced in Siena County (Italy). Food Chem 2008; 107: 1553-60.
13.	Golob T, Doberšek U, Kump P, Nečemer M. Determination of trace and minor elements in Slovenian honey by total reflection X-ray fluorescence spectroscopy. Food Chem 2005; 91: 593-600.
14.	Kropf U, Korošec M, Bertoncelj J, et al. Determination of the geographical origin of Slovenian black locust, lime and chestnut honey. Food Chem 2010; 121: 839-46.
15.	Przybylowski P, Wilczyñska A. Honey as an environmental marker. Food Chem 2001; 74: 289-91.
16.	Lachman J, Kolihova D, Miholova' D, Košata J, Titera D, Kult K. Analysis of minority honey components: Possible use for the evaluation of honey quality. Food Chem 2007; 101: 973-9.
17.	Terrab A, Recamales AF, Hernandez D, Heredia FJ. Characterization of Spanish thyme honey by their physicochemical characteristics and mineral contents. Food Chem 2004; 88: 537-42.
18.	Hernández OM, Fraga JMG, Jiménez AI, Jiménez F, Arias JJ. Characterization of honey from
174
N. Bilandžič, M. Dokič, M. Sedak, I. Varenina, B. Solomun Kolanovič, A. Končurat, B. Šimič, N. Rudan
the Canary Islands: Determination of the mineral content by atomic absorption spectrophotometry. Food Chem 2005; 93: 449-58.
19.	Garcia JCR, Rodriguez RI, Crecente RP, Garcia JB, Martin SG, Latorre CH. Preliminary chemometric study on the use of honey as an environmental marker in Galicia (northwestern Spain). J Agric Food Chem 2006; 54: 7206-12.
20.	Tuzen M. Determination of some metals in honey samples for monitoring environmental pollution. Fresenius Environ Bull 2002; 11: 366-70.
21.	Tuzen M, Soylak M. Heavy metal levels in microwave digested honey samples from middle Anatolia, Turkey. J Food Drug Anal 2005; 3: 343-7.
22.	Tuzen M, Silici S, Mendil D, Soylak M. Trace element levels in honeys from different regions of Turkey. Food Chem 2007; 103: 325-30.
23.	Silici S, Uluozlu O D, Tuzen M, Soylak M. Assessment of trace element levels in rhododendron honeys of Black sea Region, Turkey. J Hazard Mater 2008; 156: 612-8.
24.	Stankovska E, Stafilov T, Šajn R. The content of cadmium in honey from the republic of Macedonia. Ekol Zaš Živ Sred 2006/2007; 10: 11-7.
25.	Bilandžic N, Dokič M, Sedak M, et al. Determination of trace elements in Croatian floral honey originating from different regions. Food Chem 2011; 128: 1160-4.
26.	WHO. Evaluation of certain food additives and contaminants. 33rd Report of the Joint FAO/WHO Expert Committee on Food Additives. Geneva, Switzerland: World Health Organization, 1989. (Technical Report Series No. 776)
27.	WHO. Evaluation of certain food additives and contaminants. 53rd Report of the Joint FAO/WHO Expert Committee on Food Additives. Geneva, Switzerland: World Health Organization, 2000. (Technical Report Series No. 896)
28.	64th Meeting of the Joint FAO/WHO Expert Committee on Food Additives. Summary of evaluation performed by the Joint FAO/WHO Expert Committee on Food Additives (JECFA). Rome: FAO/WHO, 2005.
29.	Stankovska E, Stafilov T, Šajn R. Monitoring of trace elements in honey from the Republic of Macedonia by atomic absorption spectrometry. Environ Monit Assess 2008; 142: 117-26
30.	Holmgren GG, Meyer MW, Chaney RL, Daniels RB. Cadmium, lead, copper, and nickel in agricultural soils of the United States of America. J Environ Qual 1993; 22: 335-48.
31.	Halamič J, Miko S. Geochemical atlas of the Republic of Croatia. Zagreb: Croatian Geological Survey, 2009.
32.	Zhang I, Wong MH. Environmental mercury contamination in China: sources and impacts. Environ Int 2007; 33: 108-21.
33.	Toporcak J, Legath J, Kul'kova J. Levels of mercury in samples of bees and honey from areas with and without industrial contamination. Vet Med 1992; 37: 405-12.
34.	Olivares M, Uauy R. Limits of metabolic tolerance to copper and biological basis for present recommendations. Am J Clin Nutr 1996; 63: 846-52.
35.	53rd meeting of the Joint FAO/WHO Expert Committee on Food Additives. Summary and conclusions performed by the Joint FAO/ WHO Expert committee on food additives (JECFA). Rome, Italy: FAO/WHO, 1999.
36.	Provenzano MR, El Bilali H, Simeone V, Baser N, Mondelli D, Cesari G. Copper contents in grapes and wines from a Mediterranean organic vineyard. Food Chem 2010; 72: 89-95.
37.	Nečemer M, Košir IJ, Kump P, et al. Application of total reflection X-ray spectrometry in combination with chemometric methods for determination of the botanical origin of Slovenian honey. J Agric Food Chem 2009; 57: 4409-4414.
38.	Cantarelli AM, Pellerano RG, Marchevsky EJ, Camina JM. Quality of honey from Argentina: study of chemical composition and trace elements. J Argentine Chem Soc 2008; 96 (1/2): 33-41.
39.	Kucuk M, Kolayli S, Karaoglu S, Ulusoy E, Baltaci C, Candan F. Biological activities and chemical composition of three honeys of different types from Anatolia. Food Chem 2007; 100: 526-34.
Content of five trace elements in different honey types from Koprivnica-Krizevci county
175
VSEBNOST pETIH ELEMENTOV V SLEDOVIH V RAZLIČNIH VRSTAH MEDU IZ OKROŽJA KOPRIVNICA-KRIŽEVCI
N. Bilandžic, M. Dokic, M. Sedak, I. Varenina, B. Solomun Kolanovic, A. Končurat, B. Šimic, N. Rudan
Povzetek: V okrožju Koprivnica-Križevci na severozahodnem delu Hrvaške so bili med leti 2010 in 2011 zbrani vzorci medu, nabrani na več rastlinah, ali sortnega medu robinje (Robinia pseudoacacia L.), kostanja (Castanea sativa Mill.), lipe (Tilia spp.), gr-maste amorfe (Amoria fruticoza L.) in kapusnice (Brassica napus). Koncentracije vsebnosti Cd, Pb, Hg, As in Cu ter srednje vrednosti elementov (Mg/kg) v vzorcih medu so bile: v medu, nabranem na več rastlinah: 1,26 za Cd, 163 za Pb, 135 za As, 1,35 za Hg in 11,7 za Cu, v medu z robinje: 1,52 za Cd, 182 za Pb, 23,2 za As, 0,46 za Hg in 7,697 za Cu ter v medu z lipe 2,92 za Cd, 340 za Pb, 116 za As, 0,74 za Hg in 7,798 za Cu. Opažene so bile značilne razlike v nivoju Hg in Cu med vrstami medu. Povprečna raven Cu v medu lipe in robinje je bil bistveno višji kot v ostalih evropskih državah. Najvišja izmerjena vrednost elementov v različnih vrstah medu je bila: Cd 4,0 Mg/kg in As 502|jg/kg v medu kapusnice, Hg 6,11 Mg/kg v medu kostanja, Pb 2,159 Mg/kg v medu robinje in Cu 79,167 Mg/kg v medu grmaste amorfe. Vsebnosti svinca, izmerjenega v vseh vrstah medu, so bile bistveno višje kot izmerjene vsebnosti v Italiji, Sloveniji, Poljski, Romuniji in Turčiji. Podatki kažejo na to, da je potrebno pozorneje izbrati lokacije čebelnjakov v področjih, kjer čebele nabirajo med. Pomembno je tudi, da so oddaljena od avtocest in železnic. Rezultati kažejo na razlike v vsebnosti elementov v sledovih v vzorcih medu, ki imajo različno botanično poreklo, pridobljeno na istem področju.
Ključne besede: različni tipi medu; kovine; As; Cd; Cu; Hg; Pb
Slov Vet Res 2012; 49 (4): 177-84 UDC 639.3:636.04:597.423
Original Scientific Article
comparison of morphological characters between
wild AND cultured STERLET (ACIPENSER RUTHENUS L.)
Mirjana Lenhardt1, Ivan Jaric2*, Gorcin Cvijanovic2, Jelena Kolarevic3, Zoran Gacic2, Marija Smederevac-Lalic2, Zeljka Visnjic-Jeftic2
1Institute for Biological Research, University of Belgrade, Despota Stefana 142, institute for Multidisciplinary Research, University of Belgrade, Kneza Viseslava 1, 11000 Belgrade, Serbia; 3Nofima Marina, 6600 Sunndals0ra, Norway
'Corresponding author, E-mail: ijaric@imsi.rs
Summary: Sterlet (Acipenser ruthenus L.) populations in the Danube River had experienced severe decline during the 20th century, and have become dependant on stocking measures in significant area of their distribution. Despite the current wide use of stocking, there are few studies dealing with efficiency of stocking efforts, especially with impact of rearing conditions on fitness of released individuals. This study tried to assess existence of morphological changes in reared sterlet that could impact their swimming performance and thus reduce survival of stocked fish. Wild sterlet (n=45) from the Danube River were compared with sterlet from aquaculture (n=20), originating from wild Danube spawners. Statistical comparison of 15 morphological traits revealed that samples significantly differed in 11 traits, as well as that reared sterlet had significantly shorter pectoral fins and stockier body than those from the wild. Additional investigation is needed to determine if these morphological differences could affect adaptability and survival of reared sterlet after their release into the river. Period of adaptation in lotic environment, prior to stocking, could probably alleviate the influence of aquaculture rearing on the fitness of released fish.
Key words: sturgeon; Acipenseridae; Danube River; Fulton factor; pectoral fin; biometry
Introduction
Populations of sterlet (Acipenser ruthenus L.) in the Danube River have experienced serious decline during the 20th century (1), and sterlet has been almost extirpated from the German and Austrian section of the Danube River, where its presence depends on continuous stocking efforts (2). It has a limited distribution in the basin of the Middle and the Lower Danube (3), and there are ongoing stocking activities with the majority of fish released by Hungary, and to a small extent by Slovakia and Bulgaria (4-6). Estimated quantity of
Received: 12 May 2012
Accepted for publication: 2 October 2012
stocked juveniles in Hungary declined from 10-100 thousands of annually released specimens during the 1980s to only sporadic stocking activities in 1990s and 2000s (3). According to Guti and Gaebele (3), there were 60.000 specimens released in 2002 in the Hungarian section of the Danube River.
While the stocking has been employed as a sturgeon management and rehabilitation tool for several decades, only limited information exists about the long-term effects of stocking on natural sturgeon populations (7). Significant attention of the scientific community was recently focused on the negative genetic effects of stocking on the wild sturgeon populations (8, 9), while the impact of aquaculture rearing conditions on fitness of
178
M. Lenhardt, I. Jaric, G. Cvijanovic, J. Kolarevic, Z. Gačic, M. Smederevac-Lalic, Ž. Višnjic-Jeftic
stocked individuals was not addressed in greater extent. Hatchery-cultured fish typically encounter conditions very different from those encountered by their wild counterpart, which may result in behavioural, morphological, and physiological differences (10). Hanson et al. (11) provided one of the first evidences from the wild that the morphology is correlated with the swimming activity. Swimming performance is probably the main trait determining fitness in many species of fish and other aquatic animals (12).
Although the comparisons of the morphology between the reared and wild salmon stocks have been already conducted by a number of authors (13-15), such investigations are still lacking for sturgeon species. The effect of the hatchery rearing on body morphology tends to increase with the time the fish spent in the hatchery (14). In this study, we tried to determine possible morphological differences between the reared and wild juvenile sterlet.
Materials and methods
Sample origin and rearing conditions
A total number of 45 sterlet were caught by professional fishermen during November 2002 in the Serbian part of the Danube River, near Belgrade (44° 50' 36.85"N, 20° 25' 15.83"E), with the average total length 32.3±2.0 cm. Age of sterlet was determined from pectoral fin spine sections using a method of Stevenson and Secor (16), modified further by Lenhardt et al. (17). Average monthly temperatures of the Danube water during that period were: April 11.4° C, May 19.2° C, June 22.4° C, July 25.1° C, August 21.6° C, September 19.3° C, October 13.3° C and November 8.6° C. Sterlet were frozen immediately following the capture and biometric measurements were performed on defrosted material. Analysis of pectoral fin sections showed that all wild specimens were young-of-the-year. Since the late April and early May is the spawning period for sterlet in the Danube, specimens were approximately 6 months old at the time they were captured. Diet analysis, performed by Lapkina et al. (18), showed that in July it consisted mainly of chironomids, while the leeches were dominant in August and September (70% and 100%, respectively). Daily growth in weight was 1.8 g / day in July, and 2.2 g / day in September (18).
Sterlet (n=20) reared in aquaculture (Rideg & Rideg fish farm) at Homokmegy, Hungary (46° 29' 43.28"N, 19° 04' 03.75"E), with the average total length 33.4±1.4 cm, were also used for the analysis. These specimens originated from artificially fertilized eggs of adult specimens (6 females and 4 males), which were taken from the natural population in the Danube River, near Budapest. Hatching was performed between 15 and 17 April 2004, and specimens were reared on the average temperature of approximately 20° C, due to the use of underground water of the same temperature for basins supply. Fish were initially fed with tubifex worms and, thereafter, only dry feed was used. Specimens were fed ad libitum. In early October sterlet were moved to an outdoor basin with the ambient temperature. The main purpose for sterlet rearing at this farm is ornamental fish production for aquariums and ponds. Before the biometric analysis was performed on 3 November 2004, live specimens were placed in a water tank and anaesthetized with few drops of oleum caranfilium in water. These specimens were about 200 days old.
The distance between the sites of origin of the two fish samples (i.e., the wild fish and the broodstock that the aquaculture specimens originated from) was around 460 km of the river flow. Nevertheless, sterlet are known to move regularly over long distances of 300 km or more (19), and the recent genetic studies confirmed that the Danube sterlet should be considered as a single, panmictic population (20). As a result, we believe that the distance between the two locations produced no bias with regard to the genetic background of the studied specimens.
Since the cultured sterlet were measured fresh, while those from the wild were frozen prior to measurements, additional experiment was conducted to determine if the freezing has an impact on morphological measurements. Fifteen specimens were kept frozen for one month, and morphological measurements were performed on both fresh and defrosted material. Mann-Whitney U test showed that there were no significant differences (p>0.05) in any of the measured characteristics.
Comparison of morphological characters between wild and cultured sterlet (Acipenser ruthenus L.)
179
Laboratory and statistical analysis
In addition to body mass (M) and total length (Lt), biometric analyses of wild and cultured sterlet included 15 morphometric traits, nine of them in the head region, and three meristic traits (Figure 1). Morphological variable distributions were evaluated using the Kolmogorov-Smirnov test for normality, as well as with the Shapiro-Wilk test, due to to the small sample size. As they lacked normality of distribution, Mann-Whitney U test was applied.
It is usual to standardize morphometric measurements related to the head region as a proportion relative to head length, and those not related to the head region as proportions of the total length, if the growth is isometric (21-24). Therefore, a regression analysis was performed on studied specimens using allometric growth formula y = ax6, described by Huxley (25), where a and b (slope -relative growth rates of variables) are constants. In isometric growth, the growth curve has a slope b=1. When slope b is smaller than the isometric slope, it is identified as a negative allometric growth, while it is identified as positive when b>1.
Hypothesis about the equality of slopes of the pectoral fin length related to Lt, between wild and reared specimens, was determined by formula t = (b1 - b2)/Sb1b2 where b1 and b2 are regression coefficients of the two samples, and Sb1 b2 is a standard error of the difference between regression coefficients (Figure 2) (26).
Fulton's body condition (FC) was estimated as FC = (M / Lt3) x 100 and Kolmogorov-Smirnov test was used to compare FC between groups (26, 27).
Results
Wild specimens ranged in M between 83.5 and 278.2 g and in Lt between 30 and 37.7 cm. Cultured specimens ranged in M between 80 and 136 g, and in Lt between 30.2 and 36.7 cm. Allometric growth formula y=aX (25) showed that wild sterlet displayed negative allometric growth in seven morphometric traits and positive allometric growth in one trait, "Head width at barbel base". Reared sterlet displayed negative allometric growth in 10 morphometric traits (Table 1). As a result, four traits that had isometric growth within both groups were standardized prior to statistical analysis, while the comparison of the remaining
traits was performed using original measurements (see Table 1).
Wild and cultured specimens differed significantly (P<0.05) in eight morphometric traits, as well as in one meristic trait (Table 1). Wild sterlet revealed a significantly higher value of the regression slope for pectoral fin length (Lt; Figure 2), and the average length of pectoral fin, expressed as a percentage of the total body length, was 16.1% and 14.1% for wild and reared sterlet, respectively. Six length related traits (measurements 4-9 in Figure 1) were significantly larger in wild specimens, while two width related traits (distance between the eyes and head width at the base of the barbel) were significantly larger in cultured specimens.
Range of body mass was wider in the sterlet from wild population (145.8±38.4 g) than in the reared specimens (111.2±15.7 g). Fulton's body condition in wild specimens (0.42±0.06) was significantly higher than in the cultured ones (0.30±0.02; Kolmogorov-Smirnov test P<0.01).
Discussion
Significantly smaller number of ventrolateral scutes in cultured sterlet, obtained in this study, could be explained by different water temperatures during early rearing. The scute number in sturgeon may vary due to water temperature during early rearing (28), and retarded growth during larval development (i.e., due to a low temperature) can result in a higher number of serial features, such as scutes, because they are allowed more time to form (29).
Cultured specimens in this study had a significantly shorter pectoral fin (P<0.05). This is in accordance with findings of other authors (30,31) that cultured fish exhibit shorter fins than the wild fish of similar size. Kalmykov et al. (32) found three sterlet subpopulations within the Lower Volga which showed correlation between the water velocity and the pectoral fin length: in the Volga River sections with water velocities 0.36-0.76m/s, 0.76-1.00m/s and 0.84-1.23m/s, length of pectoral fins (expressed as a percentage of the total body length) was 15.59-15.69, 16.32 and 16.51-16.58, respectively.
Fulton's body condition for wild sterlet (with Lt ranging from 14.2 cm to 42.5 cm) varied from 0.27 to 0.79 throughout an annual cycle, with the highest value recorded in June (33). In
180
M. Lenhardt, I. Jaric, G. Cvijanovic, J. Kolarevic, Z. Gačic, M. Smederevac-Lalic, Ž. Višnjic-Jeftic
Table 1: Mean values ± SD of 15 morphometric characters and three meristic traits, correlation coefficients (R2) and slopes (b) and results of Mann-Whitney U test, for the studied wild and cultured sterlet samples
Morphometric and meristic traits (see footnote)	Wild (n= R2	sterlet 45) b	Cultured sterlet (n=20) R2 b		MannWhitney U test P	Wild sterlet (n=45) mean±SD	Cultured sterlet (n=20) mean±SD
Standard length	0.88	1	0.84	0.82	0,702134	26.5±1.7	26.4±1
Fork length	0.91	0.99	0.81	0.84	0,622832	28.5±1.8	28.5±1.1
Preanal length	0.87	1	0.77	0.81	0,000793	19.3±1.3	18.1±0.7
Predorsal length	0.81	1	0.86	0.89	0,000569	20.6±1.3	19.3±0.9
Prepectoral length	0.58	0.92	0.53	0.95	0,000710	7.6±0.6	7.1±0.4
Pectoral fin length	0.91	1	0.81	1	0,000000*	5.2±0.4	4.7±0.2
Head length	0.66	0.89	0.46	0.87	0,000154	7.4±0.4	6.9±0.4
Preorbital length	0.54	0.91	0.59	1	0,000884	3.7±0.4	3.5±0.3
Preoral length	0.75	1	0.76	1	0,098007**	4.4±0.5	4.2±0.3
Prebarbel length	0.56	1	0.57	1	0,120252**	2.9±0.3	2.7±0.3
Mouth width	0.67	0.91	0.64	0.8	0,827056	1.3±0.1	1.3±0.06
Distance between eyes	0.57	0.9	0.7	0.84	0,029066	1.7±0.1	1.8±0.08
Maximum head width	0.68	1	0.68	1	0,332208**	3.3±0.3	3.1±0.2
Head width at barbel base	0.69	1.1	0.72	0.72	0,004776	1.5±0.1	1.6±0.06
Head width at mouth level	0.49	0.84	0.5	0.95	0,213410	2.4±0.2	2.3±0.1
No. of dorsal scutes					0,180403	13.6±0.6	13.1±1.1
No. of lateral scutes					0,837093	61.8±3.9	62.1±1.8
No. of ventrolateral scutes					0,000002	14.2±0.9	13±0.9
* Variable standardized prior to statistical comparison as a proportion of the total length ** Variables standardized prior to statistical comparisons as a proportion relative to head length
Figure 1: Sterlet morphometric and meristic traits used in analysis: 1 -Total length, 2 - Standard length, 3 -Fork length, 4 - Pre-anal length (from tip of rostrum to anterior margin to anus), 5 - Predorsal length, 6 - Prepec-toral length, 7 - Head length, 8 - Pre-orbital length, 9 - Pectoral fin length, 10 - Distance between eyes, 11 - Maximum head width, 12 - Mouth width, 13 - Head width at mouth level, 14 -Head width at barbel base, 15 - Preo-ral length, 16 - Prebarbel length, 1a -Number of dorsal scutes, 2a - Number of lateral scutes, 3a - Number of ven-trolateral scutes
Comparison of morphological characters between wild and cultured sterlet (Acipenser ruthenus L.)
181
Figure 2: Pectoral fin length of the two groups (wild and reared sterlet), presented as a function of the total length. Regression: Y lt . = -0.2748 + 0.1504
°	cultured
x; Ywild = -0.394 + 0.1734 x; ellipses represent 95% confidence limits
the analysis of six months old sterlet reared in warm water culture, the average value of the FC was 0.45±0.07 (ranging from 0.34 to 0.55; M. Prokeš, pers. comm.). Data obtained within this study showed that the wild specimens had a higher value of FC (0.42) than the cultured ones (0.30). This could be explained by the transfer of cultured sterlet to an outdoor basin with a lower temperature one month before sampling, as well as by a significant daily increase in wild sterlet weight during August and September, caused by a diet based on leeches (18).
There is a need for research that would be focused on the best conditions of sterlet rearing. As stated by Vehanen and Huusko (34), a simple hatchery environment may delay or modify the development of morphometric characteristics that are important in a natural river environment. Differences caused by the aquaculture environment might be probably alleviated if individuals could be released in certain small and confined parts of the natural habitat, before the actual stocking, to enable their adaptation to natural conditions. Chebanov et al. (35) presented a comprehensive system of guidelines for sturgeon hatcheries, including those for the juvenile rearing for release into natural waterbodies. According to these guidelines, the key parameters that would have to be taken into consideration are the illumination regime that mimicks a natural photoperiod, thermal regime, sufficient water flow and the use of live feeds (35). Holčik et al. (6) recommended that all juveniles
reared in the fish farms should be adapted to the conditions in natural water bodies before their stocking, mostly through feeding with natural diet and residing in facilities with lotic environment.
Comprehensive literature exists about morphological divergence between cultured and wild juvenile salmon, and results indicated that it may affect the success of cultured specimens after their release into the wild (13, 14, 36, 37). Wild Atlantic smolts differed in the shape from hatchery-reared smolts, and this difference was less pronounced but still statistically significant when wild adults were compared with hatchery-reared adults after a year spent in the sea (14). Furthermore, Svasand et al. (37) reviewed morphological and behavioural differences between reared and wild individuals of the Atlantic cod and European lobster, while Arechavala-Lopez et al. (38) found a clear morphological differentiation between farmed and wild individuals in a number of Mediterranean fish species. According to Sara et al. (39), the key parameters that influence morphology of reared fish are stock density, container volume, reduced swimming performance and the food quality. Although there were some attempts to assess the performance of the stocked specimens of sturgeon species, such as the one that compared the growth between the wild and stocked European sturgeon (Acipenser sturio) juveniles (40), such studies are unfortunately still scarce. This study was the first attempt to compare morphology of the wild and reared sterlet, and it revealed the presence
182
M. Lenhardt, I. Jaric, G. Cvijanovic, J. Kolarevic, Z. Gačic, M. Smederevac-Lalic, Ž. Višnjic-Jeftic
of morphological differences. Nevertheless, this investigation had a number of limitations, especially when bearing in mind a small, but still realistic possibility that the analyzed specimens from the wild could originate from stocking activities in Hungarian section of the Danube. Such problems could be alleviated by further studies, which would involve assessment of a more representative sample and also include comparisons of adult individuals. Additional research should also deal with the assessment of inter-annual differences between cohorts in a culture system, as well as of differences among wild populations living in conditions with different water velocities.
Acknowledgements
This study was supported by the Ministry of Education, Science and Technological Development of the Republic Serbia, Project No. 173045. The authors would like to thank Mr. Arpad Rideg for providing specimens from aquaculture in Hungary, Mr. Slobodan Batas for collecting fish from the wild, as well as to two anonymous referees for providing helpful comments and suggestions. Any experiments within this study comply with the current laws of the countries in which they were performed.
References
1.	Lenhardt M, Jaric I, Kalauzi A, Cvijanovic G. Assessment of extinction risk and reasons for decline in sturgeon. Biodivers Conserv 2006; 15: 1967-76.
2.	Reinartz R. Sturgeons in the Danube river. Vienna: International Association for Danube Research, 2002.
3.	Guti G, Gaebele T. Long-term changes of sterlet (Acipenser ruthenus) population in the Hungarian section of the Danube. Opuscula Zoologica Budapest 2009; 40(2): 17-25.
4.	Raikova G, Zivkov M, Vassilev M, Miloshev G, Uzunova E. Action plan for sturgeons in Bulgarian parts in the Danube river and Black sea. Report of the Ministry of the Environment and Waters. Sofia : Ministry of the Environment and Waters, 2004: 189 str.
5.	Guti G. Past and present status of sturgeons in Hungary. In: Proceedings of the 36th International Conference of IAD. Vienna: Austrian
Committee Danube Research / IAD, 2006: 143-7.
6.	Holcik J, Klindova A, Masar J, Meszaros J. Sturgeons in the Slovakian rivers of the Danube rver basin: an overview of their current status and proposal for their conservation and restoration. J Appl Ichthyol 2006; 22(Suppl. 1): 17-22.
7.	Ramsar declaration on global sturgeon conservation. J Appl Ichthyol 2006; 22(1): 5-11.
8.	Jager HI. Genetic and demographic implications of aquaculture in white sturgeon (Acipenser transmontanus) conservation. Can J Fish Aquat Sci 2005; 62: 1733-45.
9.	Ludwig A. A sturgeon view on conservation genetics. Eur J Wildl Res 2006; 52: 3-8.
10.	Beecham RV, Minchew CD, Parsons GR. Comparative swimming performance of juvenile pond-cultured and wild-caught channel catfish. North Am J Fish Manag 2007; 27: 729-34.
11.	Hanson KC, Hasler CT, Suski CD, Cooke SJ. Morphological correlates of swimming activity in wild largemouth bass (Micropterus salmoides) in their natural environment. Comp Biochem Physiol A 2007; 148: 913-20.
12.	Plaut I. Critical swimming speed: its ecological relevance. Comp Biochem Physiol A 2001; 131: 41-50.
13.	Swain DP, Riddell BE, Murray CB. Morphological differences between hatchery and wild populations of coho salmon (Oncorhynchus kisutch): environmental versus genetic origin. Can J Fish Aquat Sci 1991; 48(9): 1783-91.
14.	von Cramon-Taubadel NV, Ling EN, Cotter D, Wilkins NP. Determination of body shape variation in Irish hatchery-reared and wild Atlantic salmon. J Fish Biol 2005; 66: 1471-82.
15.	Solem 0, Berg OK, Kj0snes AJ. Inter-and intra-population morphological differences between wild and farmed Atlantic salmon juveniles. J Fish Biol 2006; 69: 1466-81.
16.	Stevenson JT, Secor DH. Age determination and growth of Hudson River Atlantic sturgeon, Acipenser oxyrinchus. Fish Bull 1999; 97: 153-66.
17.	Lenhardt M, Cakic P, Kolarevic J, Mickovic B, Nikcevic M. Changes in sterlet (Acipenser ruthenus L.) catch and length frequency distribution in the Serbian part of the Danube River during the twentieth century. Ecohydrol Hydrobiol 2004; 4(2): 193-7.
18.	Lapkina LN, Streljnikova AP, Chuiko GM, Lenhardt M, Kolarevic J. Leeches as the objects of fish feeding. In: Smirnova SL, ed. Proceedings of the International Conference "Structural-
Comparison of morphological characters between wild and cultured sterlet (Acipenser ruthenus L.)
183
Functional Characteristics of the Biosystem of the North (Specimens, Populations, Communities)". Russia, Petrozavodsk: Petrozavodsk State University, 2005: 214-7.
19.	Ristic MD. Migracija riba u reci Dunav i njegovim pritokama, njen uticaj na stanje i dinamiku populacija ekonomski važnih riba kao i ribolov. Ribarstvo Jugoslavije 1970; 25: 1-15.
20.	Reinartz R, Lippold S, Lieckfeldt D, Ludwig A. Population genetic analyses of Acipenser ruthenus as a prerequisite for the conservation of the uppermost Danube population. J Appl Ichthyol 2011; 27: 477-83.
21.	Negi RS, Nautiyal P. Analysis of growth pattern and variation in some morphometric characters of sympatric hill stream teleosts Barilius bendelisis and Barilius vagra. Asian Fish Sci 2002; 15: 335-46.
22.	Zou S, Li S, Cai W, Yang H, Jiang X. Ploidy polymorphism and morphological variation among reciprocal hybrids by Megalobrama amblycephala x Tinca tinca. Aquaculture 2007; 270: 574-9.
23.	Tuset VM, Piretti S, Lombarte A, González JA. Using sagittal otoliths and eye diameter for ecological characterization of deep-sea fish: Aphanopus carbo and A. intermedius from NE Atlantic waters. Sci Mar 2010; 74(4): 807-14.
24.	Barrera - Oro E, Eastman JT, Moreira E. Phenotypic plasticity in the Antarctic nototheniid fish Trematomus newnesi: a guide to the identification of typical, large mouth and intermediate morphs. Polar Biol 2012; 35: 1047-56.
25.	Huxley JS. Relative growth and form tansformation. Proc R Soc London B Biol Sci 1950; 137: 465-9.
26.	Zar JH. Biostatistical analysis. 2nd ed. New Jersey: Prentice-Hall, 1984.
27.	Froese R. Cube law, condition factor and weight-length relationships: history, meta-analysis and recommendations. J Appl Ichthyol 2006; 22: 241-53.
28.	Brannon E, Setter A, Altick J, Miller M. Columbia River white sturgeon genetics and early life history. Population segregation and juvenile feeding behavior. Project No. 1983-31600, BPA Report DOE/BP-18952-3. Portland, Oregon, USA: Bonneville Power Administration, 1987.
29.	Walsh MG, Bain MB, Squiers JrT, Waldman JR, Wirgin I. Morphological and genetic variation among shortnose sturgeon Acipenser brevirostrum from adjacent and distant rivers. Estuaries 2001; 24: 41-8.
30.	Duthie GG. Observations of poor swimming performance among hatchery-reared rainbow trout, Salmo gairdneri. Environ Biol Fishes 1987; 18: 309-11.
31.	Berejikian BA, Tezak EP. Rearing in enriched hatchery tanks improves dorsal fin quality ofjuvenile steelhead. North Am J Aquacult 2005; 67: 289-93.
32.	Kalmykov VA, Ruban GI, Pavlov DS. On the populational structure of sterlet Acipenser ruthenus (Acipenseridae) from the Volga lower reaches. J Ichthyol 2010; 49(4): 339-47.
33.	Lenhardt M, Jaric I, Cakic P, Cvijanovic G, Gacic Z, Kolarevic J. Seasonal changes in condition, hepatosomatic index and parasitism in sterlet (Acipenser rutehnus L.). Turkish J Vet Anim Sci 2009; 33: 209-14.
34.	Vehanen T, Huusko A. Brown trout Salmo trutta express different morphometrics due to divergence in the rearing environment. J Fish Biol 2011; 79: 1167-81.
35.	Chebanov M, Rosenthal H, Gessner J, et al. Sturgeon hatchery practices and management for release: guidelines. FAO Fisheries and Aquaculture Technical Paper No. 570. Ankara: FAO, 2011.
36.	Taylor EB. Differences in morphology between wild and hatchery populations of juvenile coho salmon. Progress Fish Culturist 1986; 48: 171-6.
37.	Svasand T, Skilbrei OT, Van Der Meeren GI, Holm M. Review of morphological and behavioural differences between reared and wild individuals: Implications for sea-ranching of Atlantic salmon, Salmo salar L., Atlantic cod, Gadus morhua L., and European lobster, Homarus gammarus L. Fish Manag Ecol 1998; 5: 473-90.
38.	Arechavala-Lopez P, Sanchez-Jerez P, Bayle-Sempere JT, Sfakianakis DG, Somarakis S. Morphological differences between wild and farmed Mediterranean fish. Hydrobiologia 2012; 679: 217-31.
39.	Sara M, Favaloro E, Mazzola A. Comparative morphometrics of sharpsnout seabream (Diplodus puntazzo Cetti, 1777), reared in different conditions. Aquacult Eng 1999; 19: 195-209.
40.	Lochet A, Lambert P, Lepage M, Rochard E. Growth comparison between wild and hatchery-reared juvenile European sturgeons Acipenser sturio (Acipenseridae) during their stay in the Gironde estuary (France). Cybium 2004; 28(1): 91-8.
184
M. Lenhardt, I. Jaric, G. Cvijanovic, J. Kolarevic, Z. Gačic, M. Smederevac-Lalic, Ž. Višnjic-Jeftic
primerjava MORFOLOŠKIH LASTNOSTI DIVJE IN GOJENE KEČIGE (ACIPENSER RUTHENUS L.)
M. Lenhardt, I. Jane, G. Cvijanovic, J. Kolarevic, Z. Gačic, M. Smederevac-Lalic, Ž. Višnjic-Jeftic
Povzetek: Populacije kečige (Acipenser ruthenus L.) v reki Donavi so v 20. stoletju doživele veliko padcev in postale odvisne od stopnje gojenja v značilnem področju njihove razširjenosti. Kljub trenutni široki uporabi gojenja rib se malo raziskav ukvarja z učinkovitostjo uspeha gojitve, še posebej z vplivom rejskih pogojev na izpuščene osebke. Naša raziskava poskuša ugotoviti obstoj morfoloških sprememb pri gojenih kečigah, ki bi lahko vplivale na kakovost plavanja in tako zmanjšale preživetje gojenih rib. Divje kečige (n=45) iz reke Donave smo primerjali s kečigami iz akvakulture (n=20), ki izvira iz divjih ikrnic na Donavi. Statistična primerjava 15 morfoloških značilnosti je pokazala, da se vzorci razlikujejo v 11 značilnostih, poleg tega pa so imele gojene kečige značilno krajšo prsno plavut in bolj čokato telo v primerjavi z divjimi. Potrebne so dodatne raziskave, da bi se ugotovilo ali proučevane značilnosti lahko vplivajo na prilagodljivost in preživetje gojenih kečig po izpustu v reko. Obdobje prilagajanja v okolju pred gojitvijo lahko najbrž zmanjša vpliv akvakulturne reje na preživitvene sposobnosti izpuščenih rib.
Ključne besede: kečiga; Acipenseridae; reka Donava; Fultonov faktor; prsna plavut; biometrija
Slov Vet Res 2012; 49 (4): 185-92 UDC 636.5.09:616.9-07:57.083
Original Scientific Article
DETECTION OF CHLAMYDIA PSITTACI IN CAGE BIRDS IN SLOVENIA BY REAL-TIME PCR
Cvetka Marhold1, Brigita Slavec1, Karine Laroucau2, Fabien Vorimore2, Jožko Račnik1, Marko Zadravec1, Darja Keše3, Uroš Krapež1, Alenka Dovč1 *
1Institute for Health Care of Poultry, Veterinary Faculty, Gerblčeva 60, 1000 Ljubljana, Slovenia; 2Bacterlal Zoonoses Unit, French Agency for Food, Environmental & Occupational Health Safety (Anses), Maisons-Alfort, France; 3Institute of Microbiology and Immunology, Faculty of Medicine, Zaloška 4, 1000 Ljubljana, Slovenia
Corresponding author, E-mail: alenka.dovc@vf.uni-lj.si
Summary: Avian chlamydiosis is a zoonotic disease of birds caused by the bacterium Chlamydia psittaci. The highest infection rates are found in psittacine birds (Psittacidae) which are the most common cage birds. C. psittaci causes infections of the conjunctiva, respiratory tract, and digestive tract, with or without clinical signs in birds. Infected birds can shed chlamydiae through respiratory tract excretions and in faeces. Transmission of C. psittaci primarily occurs by close contact of infected bird to the susceptible bird or human.
To determine the prevalence of C. psittaciin cage birds in Slovenia, oropharyngeal and cloacal swabs from 125 cage birds were examined by Chlamydiaceae-specific real-time polymerase chain reaction (real-time PCR). Two lovebirds (2/12) and a budgerigar (1/44) were positive for Chlamydiaceae by real-time PCR and were also positive for C. psittaci by an ompA-based real-time PCR assay specific for C. psittaci. Multiple loci variable number of tandem repeats analysis (MLVA) identified C. psittaci of genotype A in the positive budgerigar and C. psittaci of genotype B in the two positive lovebirds. The infected birds had no significant clinical signs of avian chlamydiosis on clinical examination. Using real-time PCR, the study showed a low prevalence (2.4 %) of C. psittaciin Slovenia.
Key words: Chlamydia psittaci; real-time PCR; MLVA; cage birds; Slovenia
Introduction
Chlamydia psittaci (C. psittaci) is a member of the Chlamydiaceae family and is an obligatory intracellular, gram-negative bacterium, which can infect many avian species as well as a wide range of mammalian hosts (1). The disease caused by C. psittaci is designated avian chlamydiosis, originally termed psittacosis or parrot fever in psittacine birds and ornithosis in other bird species (2, 3). The clinical disease depends on the chlamydial strains
Received: 15 June 2012
Accepted for publication: 2 October 2012
and avian host. Symptoms in the affected bird can include respiratory distress, keratoconjunctivitis, sinusitis, mucopurulent nasal discharge, diarrhea (yellow-green droppings are common), polyuria, dullness and affection of the central nervous system. Asymptomatic infections can occur with any strain of C. psittaci. A large number of chlamydiae cells can be found in respiratory secretions and faecal material of infected birds. Transmission of C. psittaci predominantly occurs through inhalation of contaminated material and sometimes through ingestion, from an infected bird to a susceptible bird. Humans can become infected by inhaling an organism shed by infected birds, mouth-to-beak contact or by handling the
186
C. Marhold, B. Slavec, K. Laroucau, F. Vorimore, J. Racnik, M. Zadravec, D. Kese, U. Krapez, A. Dove
plumage and tissues of infected birds. In humans C. psittaci most often causes a respiratory infection and fever (3, 4). Person-to-person transmission of avian chlamydiosis is possible, but it is believed to be rare (5, 6, 7, 8).
Avian chlamydiosis occurs world-wide. To date, C. psittaci infections have occurred in at least 467 bird species, belonging to 30 different bird orders (9). The highest infection rates are found in psittacine birds (Psittacidae) and pigeons (Columbiformes) (4). Psittacidae represent major reservoirs of chlamydiae, especially under captive conditions. Psittacine cage birds should therefore be considered to be potential reservoirs of C. psittaci (4, 9).
Diagnosis of chlamydial infection in birds is still a considerable challenge. Clinical changes are not pathognomonical and persistent infections can also occur. The infection can only therefore be confirmed by direct identification of the agent or indirectly by detection of specific antibodies. PCR is currently the method of choice for diagnosis of chlamydial infection. Specific and sensitive PCR methods to detect C. psittaci ompA gene have been developed (2, 10, 11).
Serotyping of C. psittaci isolates, which was previously performed with a panel of serovar-specific monoclonal antibodies in an immunoflurescence test, allowed their classification into six avian serovars (A through F) (12, 13, 14). Serovar A is repeatedly isolated from psittacine birds, serovar B from pigeons and psittacine birds, serovar C from ducks and geese, serovar D from turkeys, serovar E from pigeons and ratites, and serovar F from psittacine birds and turkeys (13, 14, 15). All serovars appear to be transmissible to humans (4). Analysis of the gene encoding outer membrane protein A (ompA) is most often used to characterize avian C. psittaci strains into genotypes (16). Nine genotypes of C. psittaci are currently accepted (A-F, E/B, WC and M56) (2, 16, 17). Using comparison of serotyping results and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) patterns, Vanrompay et al. (12) were able to demonstrate that serovars have genetic equivalents in the corresponding genotypes (16). Other molecular tools, such as microarray analysis, multiple loci variable number of tandem repeats analysis (MLVA) and multilocus sequence typing (MLST) are also used for geno typing C. psittaci (16, 18, 19).
The aim of our study was therefore to establish the excretion rate of C. psittaci in oropharyngeal
and cloacal swabs from cage birds by real-time PCR in Slovenia. Samples were first verified as Chlamydiaceae and positive samples for C. psittaci were then detected and genotyped.
Material and methods
Clinical examination
Cage birds were clinically examined at the Department for Birds, Small Mammals and Reptiles of the Institute for Health Care of Poultry, Veterinary Faculty in Ljubljana. Anamnesis was taken and different diagnostic procedures (microscopic examination of faeces and crop swabs, x-ray, molecular investigation to avian bornavirus and circovirus) were performed (data not shown) in some birds after agreement had been obtained from the owners of the birds.
Clinical samples
Oropharyngeal and cloacal swabs were taken during clinical examination of 125 cage birds sampled randomly, in 2010 and 2011. The order, family, genus and species of the examined birds are given in Table 1. Samples were collected with Dacron swab and stored in one millilitre of 2-sucrose-phosphate based transport medium (2SP) at -20°C until processing.
DNA extraction
Total DNA was extracted with a QIAamp® Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's blood and body fluid spin protocol. Each swab was vortexed vigorously before DNA extraction. Two hundred microliters of each sample were used as starting material for the DNA extraction. Finally, DNA was eluted with 100 pl of AE buffer and stored at -20°C until examination.
Detection of chlamydiae DNA by real-time
PCR
Generic real-time PCR was used for the amplification of the partial 23S RNA gene of Chlamydiaceae. For the amplification, the following primers Ch23S-F (5'-CTG AAA CCA GTA GCT TAT AAG CGG T-3') and Ch23S-R (5'-ACC TCG CCG
Detection of Chlamydia psittaciin cage birds in Slovenia by Real-Time PCR
187
TTT AAC TTA ACT CC-3'), and probe Ch23S-p (FAM-5'-CTC ATC ATG CAA AAG GCA CGC CG-3'-TAMRA) were used (20). The reaction mix contained 4.0 of nuclease-free water (Promega, Madison, WI, USA), 7.5 ^l of 2x QuantiFast probe PCR master mix with ROX, and 0.6 ^l of each primer (0.4 pM ), 0.3 ^l of specific probe and 2
of extracted DNA. The reaction was performed by ABI 7300 thermocycler (Applied Biosystems, Foster City, CA, USA). The cycling profile included initial denaturation at 95°C for 3 min, followed by 50 cycles of denaturation at 95°C for 5 s and 60°C for 30 s. The cycle threshold (Ct value) was calculated automatically. All positive samples were tested in two repeats before they were further examined by the primers CppsOMP1-F (5'-CAC TAT GTG GGA AGG TGC TTC A-3'), CppsOMPl-R (5'-CTG CGC GGA TGC TAA TGG-3') and probe CppsOMP1-S (FAM-5'-CGC TAC TTG GTG TGA C-3'-TAMRA) corresponding to the region of the ompA gene specific for C. psittaci (21). The realtime PCR reaction mix and cycling conditions were the same as for the 23S RNA gene.
DNA-based characterization - multiple loci
variable number of tandem repeats analysis
(MLVA)
C. psittaci positive samples were examined by MLVA. For the variable number of tandem repeats (VNTR) amplifications, PCR was performed in a total volume of 15 pl containing 2 pl of sample DNA, 1.5 pl 10 x PCR reaction buffer, 0.1 pl (1 U) of Hot start Taq DNA polymerase (Qiagen), 0.15 pl (200 pM) of each deoxynucleotide triphosphate, and 1.5 pl (0.3 pM) of each flanking primer (18).
The initial denaturation step at 95°C for 15 min was followed by 40 cycles consisting of denaturation at 95°C for 30 s, annealing at 56°C for 45 s, and elongation at 72°C for 45 s. The final extension step was at 72°C for 10 min. Nine microliters of amplification product were loaded onto a 4 % standard agarose gel. Gels stained with EZ-Vision® (Interchim, Montlu^on, France) were visualized under UV light and photographed. A 100 bp ladder marker was used (Mbi, Euromedex, Souffelweyersheim, France).
Amplicon sizes were determined manually by a recently described methodology (18). The resulting data were compared with known MLVA types (10) for determining the genotype of C. psittaci.
Statistical analyses
All statistical analyses were performed with GraphPad Prism 6.0 software (GraphPad Prism 6.0 software, San Diego, California, USA). Fisher's exact test was used to calculate a p-value with statistical significance considered at p < 0.05.
Results
A total of 125 cage birds were sampled in 2010 and 2011 during clinical examination (Table 1). Ninety-seven birds (77.6 %) had various clinical problems. Fifteen birds (12 %; quail, two cockatiel, two African grey parrot, Senegal parrot, two Amazon parrot, Superb parrot, four budgerigars and two Hill myna) from among them had a suspected clinical signs of having C. psittaci. While the other 28 birds (22.4 %; two cockatiels, one amazon parrot, nine lovebirds, twelve budgerigars, two canaries, one zebra finch and one java sparrow) were apparently healthy (data not shown).
Three cage birds, two lovebirds and a budgerigar, were positive for Chlamydiaceae by real-time PCR for the detection of the 23S RNA gene of Chlamydiaceae and were also positive for C. psittaci by real-time PCR for the detection of the ompA gene specific for C. psittaci. The two positive samples from lovebirds showed MLVA types (ST) identical to ST 10 and the positive sample from a budgerigar was identical to ST 12. ST 10 is characteristically equivalent to genotype B, whereas ST 12 is equated with genotype A. Detailed information about the results of different diagnostic methods and clinical signs of positive cage birds are given in Table 2.
In order to determine whether budgerigars and lovebirds are more susceptible to the infection with C. psittaci in a given sample, the Fisher chi - squared test was used. There was statistically significant presence of C.psittaci for lovebirds with p = 0,028, but no for budgerigars (p = 1).
Discussion
C. psittaci is a very important bacterial pathogen in veterinary and human medicine. It can cause a clinical disease called avian chlamydiosis in many avian and mammalian species. Birds,
188
C. Marhold, B. Slavec, K. Laroucau, F. Vorimore, J. Racnik, M. Zadravec, D. Kese, U. Krapez, A. Dove
Table 1: Order, family, genus and species of examined birds. The total number of examined birds and the number of birds that tested positive for C. psittaci are shown
Species
Order
Family
Genus
Birds examined
(No)
C. psittaci positive birds (No)
Fowl (n=1)
Parrots
(n=112)
Galliformes Psittaciformes
Phasianidae Cacatuidae
Psittacidae
Songbirds (n=12)
Passeriformes Sturnidae
Fringillidae Estrildidae
Coturnix
Nymphicus
Eolophus
Psittacus
Poicephalus
Pionites
Amazona
Cyanoliseus
Aratinga
Nandayus
Eclectus
Alisterus
Polytelis
Psittacula
Agapornis Melopsittacus
Cyanoramphus
Gracula
Serinus
Taeniopygia
Padda
Quail*
Cockatiel
Galah
African grey parrot Senegal parrot Black-headed parrot Amazon parrot Burrowing parrot Sun parakeet Nanday parakeet Eclectus parrot Australian king parrot Superb parrot Ring-necked parakeet Alexandrine parakeet Lovebird Budgerigar Yellow-crowned parakeet
Hill myna
Canary Zebra finch Java sparrow
1
17
4 9 1 1 7 1 2 1 1 1 2 6 2 12 44
1
6 3 1
0
0 0 0 0 0 0 0 0 0 0 0 0 0 2 1
0 0 0
Total No
125
*kept as a pet birds
0
0
2
0
3
Table 2: Details of positive chlamydiae test results of cage birds with clinical signs and results of parallel diagnostic investigation from Slovenia
		Real-Time PCR		Real-Time PCR		MLVA Pattern	Genotype of C. psittaci		Results of parallel
Place of	Bird species	Chlamydiaceae		C. psittaci				Clinical signs	diagnostic
origin		(0 Ct value)		(0 Ct value)					investigation
		OS	CS	OS	CS				
								Depression, weight	
Ljubljana	Lovebird	33.3	32.97	33.94	33.44	10	B	loss, anorexia, abdominal mass.	nd
Ljubljana	Lovebird	neg	30.2	neg	33.34	10	B	With no clinical signs.	nd
Ljubljana	Budgerigar	34.75	27.02	neg	30.25	12	A	Progressive weight loss.	Macrorahbdus ornithogaster found in faeces.
OS oropharyngeal swab; CS cloacal swab; neg negative; nd not done
Detection of Chlamydia psittaciin cage birds in Slovenia by Real-Time PCR
189
especially under captive conditions, are the major reservoir of C. psittaci (10). Most chlamydia infected cage birds are parrots, especially African grey parrots, Amazon parrots, lovebirds, cockatiels and budgerigars (4, 22). The results of our study, in which the three C. psittaci positive birds (two lovebirds and a budgerigar) belong to Psittaciformes, are in agreement with this. The birds examined in our study were from the orders Galliformes (0.8 %), Psittaciformes (89.6 %) and Passeriformes (9.6 %). In general, Psittaciformes are the most frequently investigated for chlamydial infections (9). It is still not known whether Psittaciformes are more susceptible to C. psittaci than other bird species. It is possible that the clinical signs of avian chlamydiosis are more easily noticed in these birds and infection therefore more often diagnosed (9, 23, 24).
Avian chlamydiosis can also occur in Passeriformes, especially in canaries and finches, but the infection is rarely diagnosed (4, 9, 22, 25). Passeriformes is the largest bird order and contains more than 4000 species (9). Nevertheless, chlamydia has been detected in only 2 % of song birds in comparison to a 45 % prevalence of chlamydial infections in parrot birds (9). Based on our experience, it is very likely that parrots are the largest group among cage birds. For example, during the period of the present study, 399 cage birds (80.7 % parrots and 7.8 % song birds) had the first clinical examination at the Department for Birds, Small Mammals and Reptiles.
In our study, 125 cage birds were sampled during clinical examination, in order to detect chlamydia infections by real-time PCR diagnostic methods. Oropharyngeal and cloacal swabs were taken from each bird, because infected birds can shed chlamydiae through respiratory tract excretions and in faeces (3, 4). Birds were sampled before any antibiotic treatment because antibiotic drugs can prevent shedding of chlamydiae (27). Serological monitoring was not done because the aim of our study was to establish the excretion rate of C. psittaci in cage birds through oropharyngeal and cloacal secretions.
C. psittaci infections in birds may range from subclinical to infections with diverse clinical signs, such as lethargy, anorexia, ruffled feathers, ocular or nasal discharge, conjunctivitis and greenish faeces (3, 4). Among the tested birds, twenty-eight (22.4 %) showed no clinical signs, while the other 97 birds (77.6 %) had a variety of clinical signs.
In a budgerigar that showed progressive weight loss and was positive for C. psittaci, Macrorhabdus ornithogaster was also found by parallel diagnostic investigation. Only one of the two lovebirds that were positive for C. psittaci showed clinical signs not typical for infection with C. psittaci. The other bird appeared clinically healthy (Table 2). Anamnesis revealed that the lovebirds had been in close contact before they were tested. In the lovebird with clinical signs, C. psittaci was detected in oropharyngeal and cloacal swabs, while in the clinically healthy lovebird C. psittaci was detected only in the cloacal swab. The explanation of this may be that the shedding of C. psittaci occurs intermittently and healthy carrier birds might not excrete bacteria for extended periods (5).
Three cage birds (2.4 %) were positive for Chlamydiaceae and C. psittaci by real-time PCR. Oropharyngeal and cloacal swabs were positive for C. psittaci in the lovebird with clinical signs, while in the other two birds, the clinically healthy lovebird and the budgerigar with progressive weight loss, only cloacal swabs were positive. In the budgerigar, the oropharyngeal swab was positive for Chlamydiaceae but negative for C. psittaci. The reason for this may be that the amount of investigated DNA of C. psittaci was under the detection limit of the method.
Real-time PCR is one of the favored methods for the detection of DNA of Chlamydiaceae as well as for further detection of C. psittaci DNA. The method proved to be rapid and have good specificity and sensitivity as reported by Geens et al., Ehricht et al. and Pantchev et al. (2, 20, 21). The prevalence of C. psittaci in cage birds of different species detected by real-time PCR described by Ehricht et al. and Pantchev et al. (20, 21) was, in our study, 2.4 % (3 of 125). One of the reasons for the low prevalence of C. psittaci infections detected in the present study may be in randomly sampled cage birds as only 12 % (15 of 125) of them have had clinical signs that could be related to C. psittaci infection and no sampled birds have had history of previous infections with C. psittaci. The prevalence of the infected birds detected in the present study also correlates well with the results of previous serological monitoring of C. psittaci infection in breeding flocks of parrots, canaries and finches (25, 26). Antibodies were detected in 6.2 % of parrots, 0.8 % of canaries and 0.9 % of finches breeding flocks in the period from 1991 to 2001 (25, 26). In our study, most
190
C. Marhold, B. Slavec, K. Laroucau, F. Vorimore, J. Racnik, M. Zadravec, D. Kese, U. Krapez, A. Dove
of the sampled birds (112 of 125) were parrots, of which three (2.7%) were positive for C. psittaci DNA. In canaries (4.8% of sampled birds) and in finches (3.2% of sampled birds) no infections with C. psittaci were detected.
The C. psittaci detected in cloacal swabs samples from the two lovebirds and the budgerigar was typed by the MLVA method. C. psittaci of genotype A was detected in the budgerigar and C. psittaci of genotype B was detected in both lovebirds. These results correlate with previous findings, whereby genotypes A and B have been predominantly found in psittacine birds (18, 28). Surprisingly, only genotype A was detected by MLVA in samples from lovebirds in a recent study (18).
Even though the statistical analyses showed that lovebirds are more susceptible to the infection with C. psittaci in a given sample it should be mentioned that both positive lovebirds were from the same household. In this case, it is very likely that this was the main reason for the infection of both birds rather than the susceptibility of the lovebirds as a species.
For an avian practitioner, C. psittaci infections in cage birds, especially in the absence of clinical signs, can be difficult to diagnose. Generally, avian chlamydiosis should be suspected in any parrot that shows respiratory or gastrointestinal or neurological signs or has been in contact with infected birds. Real-time PCR is a diagnostic tool that can be used to determine infection by C. psittaci. In addition, the MLVA method can be used for typing the microorganism. If possible, serological analysis should be still used to complement the molecular diagnosis. The infected birds should be correctly treated and the transmission of the pathogen to susceptible animals and to humans should be prevented.
Acknowledgements
The study was supported by the Slovenian Research Agency. Authors are thankful to Katarina Zadravec and Andrej Likar for statistical analyses. We would also like to thank all the technical staff for their help in the laboratory.
References
1. Everett KD, Bush RM, Andersen AA. Emended description of the order Chlamydiales,
proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards. Int J Syst Bacteriol 1999; 49 (2): 415-40.
2.	Geens T, Dewitte A, Boon N, Vanrompay D. Development of a Chlamydophila psittaci species-specific and genotype-specific real-time PCR. Vet Res 2005; 36 (5/6): 787-97.
3.	Andersen AA, Vanrompay D. Avian chlamydiosis. Rev Sci Tech 2000; 19 (2): 396-404.
4.	Harkinezhad T, Geens T, Vanrompay D. Chlamydophila psittaci infections in birds: a review with emphasis on zoonotic consequences. Vet Microbiol 2009; 135 (1/2): 68-77.
5.	Vanrompay D, Ducatelle R, Haesebrouck F. Chlamydia psittaci infections: a review with emphasis on avian chlamydiosis. Vet Microbiol 1995; 45 (2/3): 93-119.
6.	Hughes C, Maharg P, Rosario P, Herrell M, Bratt D, Howard D. Possible transmission of psittacosis. Infect Control 2012; 18 (3): 165-8.
7.	Ito I, Ishida T, Mishima M, et al. Familial cases of psittacosis: possible person-to-person transmission. Intern Med 2002; 41 (7): 580-3.
8.	McGuigan CC, McIntyre PG, Templeton K. Psittacosis outbreak in Tyside, Scotland, December 2011 to February 2012. Euro Surveill 2012; 17(22): e20186.
http://www.eurosurveillance.org/Viewarticle. aspx?Articleld=20186 (13.6.2012).
9.	Kaleta EF, Taday EM. Avian host range of Chlamydophila spp. based on isolation, antigen detection and serology. Avian Pathol 2003; 32 (5): 435-61.
10.	Vanrompay D, Harkinezhad T, Van De Walle M, et al. Chlamydophila psittaci transmission from pet birds to humans. Emerg Infect Dis 2007; 13 (7): 1108-10.
11.	Everett KDE, Hornung LJ, Arthur A, Andersen AA. Rapid detection of the Chlamydiaceae and other families in the order Chlamydiales: three PCR tests. J Clin Microbiol 1999; 37 (3): 575-80.
12.	Vanrompay D, Butaye P, Sayada C, Ducatelle R, Haesebrouck F. Characterization of avian Chlamydia psittaci strains using omp1 restriction mapping and serovar-specific monoclonal antibodies. Res Microbiol 1997; 148(4): 327-33.
13.	Vanrompay D, Andersen AA, Ducatelle R,
Detection of Chlamydia psittaciin cage birds in Slovenia by Real-Time PCR
191
Haesebrouck F. Serotyping of European isolates of Chlamydia psittaci from poultry and other birds. J Clin Microbiol 1993; 31(1): 134-7.
14.	Andersen AA. Sero typing of Chlamydia psittaci isolates using serovar-specific monoclonal antibodies with the microimmunofluorescence test. J Clin Microbiol 1991; 29(4): 707-11.
15.	Andersen AA. Two new serovars of Chlamydia psittaci from North American birds. J Vet Diagn Invest 1997; 9(2): 159-64.
16.	Sachse K, Laroucau K, Hotzel H, Schubert E, Ehricht R, Slickers P. Genotyping of Chlamydophila psittaci using a new DNA microarray assay based on sequence analysis of ompA genes. BMC Microbiol 2008; 8: e63.
17.	Geens T, Desplanques A, Loock MV, et al. Sequencing of the Chlamydophila psittaci ompA gene reveals a new genotype, E/B, and the need for a rapid discriminatory genotyping method. J Clin Microbiol 2005; 43(5): 2456-61.
18.	Laroucau K, Thierry S, Vorimore F et al. High resolution typing of Chlamydophila psittaci by multilocus VNTR analysis (MLVA). Infect Genet Evol 2008; 8 (2): 171-81.
19.	Pannekoek Y, Dickx V, Beeckman DS et al. Multi locus sequence typing of Chlamydia reveals an association between Chlamydia psittaci genotypes and host species. PloS ONE 2010; 5 (12): e14179.
http://www.plosone.org/article/ info%3Adoi%2F10.1371%2Fjournal. pone.0014179 (13.6.2012)
20.	Ehricht R, Slickers P, Goellner S, Hotzel H, Sachse K. Optimized DNA microarray assay allows detection and genotyping of single PCR-
amplifiable target copies. Mol Cell Probes 2006; 20 (1): 60-3.
21.	Pantchev A, Sting R, Bauerfeind R, Tyczka J, Sachse K. New real-time PCR tests for species-specific detection of Chlamydophila psittaci and Chlamydophila abortus from tissue samples. Vet J 2009; 181 (2): 145-50.
22.	Fudge A. A review of methods to detect Chlamydia psittaci in avian patients. J Avian Med Surg 1997; 11: 153-65.
23.	Harkinezhad T, Verminnen K, Van Droogenbroeck C, Vanrompay D. Chlamydophila psittaci genotype E/B transmission from African grey parrots to humans. J Med Microbiol 2007; 56 (8): 1097-100.
24.	Smith KA, Campbell CT. Compendium of measures to control Chlamydophila psittaci infection among humans (psittacosis) and pet birds (avian chlamydiosis), 2010 National Association of state public health veterinarians (NASPHV). J Exot Pet Med 2011; 20 (1): 32-45.
25.	Dovč A, Dovč P, Keše D, Vlahovic K, Pavlak M, Zorman-Rojs O. Long-term study of Chlamydophilosis in Slovenia. Vet Res Commun 2005; 29 (Suppl 1): 23-36.
26.	Dovč A, Slavec B, Lindtner-Knific R et al. Study of Chlamydophila psittaci outbreak in budgerigars. Bull Vet Inst Pulawy 2007; 51: 343-6.
27.	Billington S. Clinical and zoonotic aspects of psittacosis. In Pract 2005; 27 (5): 256-63.
28.	Mitchell SL, Wolff BJ, Thacker WL et al. Genotyping of Chlamydophila psittaci by real-time PCR and high-resolution melt analysis. J Clin Microbiol 2009; 47 (1): 175-81.
192
C. Marhold, B. Slavec, K. Laroucau, F. Vorimore, J. Racnik, M. Zadravec, D. Kese, U. Krapez, A. Dove
UGOTAVLJANJE BAKTERIJE CHLAMYDIA PSITTACI PRI SOBNIH PTICAH V SLOVENIJI S PCR V REALNEM ČASU
C. Marhold, B. Slavec, K. Laroucau, F. Vorimore, J. Račnik, M. Zadravec, D. Keše, U. Krapež, A. Dovč
povzetek: Aviarna klamidioza je obolenje ptic, ki jo povzroča bakterija Chlamydia psittaci. Okužbe s to bakterijo najpogosteje ugotovimo pri papigah (Psittacidae), ki so hkrati tudi najštevilčnejše predstavnice sobnih ptic. Okužba ptic s C. psittaci zelo pogosto poteka brez kliničnih znakov. Pri obolelih pticah pa lahko opazimo apatičnost, neješčnost, našopirjenost, očesni in nosni izcedek ter vodene temnozelene iztrebke. Okužene ptice izločajo povzročitelja najpogosteje v presledkih z očesnimi in nosnimi izcedki ter z iztrebki. Prenos okužbe s C. psittaci je neposreden in je možen med različnimi vrstami ptic in tudi s ptic na ljudi. Za ugotavljanje prisotnosti C. psittaci pri sobnih pticah v Sloveniji smo odvzeli brise žrela in kljunske votline ter brise kloake pri 125 pticah. Vzorce smo najprej pregledali na prisotnost bakterij iz družine Chlamydiaceae z metodo PCR v realnem času. Okužbo s C. psittaci smo dokazali pri dveh agapornisih (2/12) in eni skobčevki (1/44). Za ugotavljanje okužb s C. psittaci smo uporabljali PCR v realnem času, specifičen za gen ompA. S hkratno analizo večjega števila lokusov z variabilnim številom tandenskih ponovitev (MLVA) smo pri skobčevki določili C. psittaci, genotip A, pri obeh agapornisih pa C. psittaci, genotip B. Z metodo PCR v realnem času smo ugotovili nizko prevalenco (2,4 %) okužb s C. psittaci pri sobnih pticah v Sloveniji.
Ključne besede: Chlamydia psittaci; PCR v realnem času; MLVA; sobne ptice; Slovenija
Slov Vet Res 2012; 49 (4): 193-200
UDC 636.2.09:618.6:612.751:616-008.82/.83
Original Scientific Article
BONE METABOLISM MARKERS AND BLOOD MINERALS CONCENTRATION IN Dairy CATTLE DuRING pREGNANCY AND LACTATION
Jože Starič*, Marija Nemec, Tomaž Zadnik
Clinic for Ruminants, Veterinary Faculty, Gerbičeva 60, 1000 Ljubljana, Slovenia Corresponding author, E-mail: joze.staric@vf.uni-lj.si
Summary: Biochemical markers of bone metabolism are substances in blood and urine that indicate how intensively bone is forming or degrading at the time of sample (blood or urine) collection. The aim of the study was to establish concentration of total calcium (Ca), inorganic phosphate (iP), magnesium (Mg), C-terminal telopeptide crosslinks of collagen I (CTx) (biochemical marker of bone resorption) and activity of total alkaline phosphatase (ALP) and bone specific alkaline phosphatase (BALP) (biochemical marker of bone formation) in blood serum of clinically healthy mature dairy cows from dry period until peak lactation. Holstein-Friesian cows (n=54) with high milk yields (average 8,463 kg/previous lactation) were enrolled in the study. Cows were divided in 5 groups according to stage of lactation: 1. approximately 1 month before calving (AP) (early dry period) (n = 10), 2. 10 to 1 day AP (close-up dry period) (n = 10), 3. 0 - 48 hours after calving (PP) (n = 10), 4. 10 - 20 days PP (n = 10) and 5. peak of lactation (35 - 55 days in milk) (n = 14). The nadir of mean Ca and iP were in the third group and significantly lower than in other groups (P<0.05). Mean Mg was higher in groups 3 and 5 compared to groups 2 and 4 (P<0.05). The lowest mean value of BALP was established in group 1. The difference was statistically significant compared to all other groups. The highest values of CTx were measured in groups 4 and 5. These values were also significantly higher compared to groups 1, 2 and 3. The lowest CTx values were measured in the 1. group. Results of the study indicate that bone tissue is the most catabolically active 10 to 20 days after calving and the most anabolically active during the dry period. Strong negative correlation (P<0.01) was established between BALP and minerals Ca and iP.
Key words: biochemical markers; CTx; BALP; ALP; cows; mature
Introduction
Bone metabolism in physically mature animals is a continuous dynamic process of bone resorption coupled with bone formation, so called bone remodeling. This allows adaptation of bones quality (flexibility and firmness), to physical load and during periods of minerals shortage, bone can be the main source of especially calcium (Ca) (1). In mature dairy cattle bone metabolism is especially active due to Ca requirement from parturition
Received: 3 October 2012
Accepted for publication: 28 November 2012
to peak lactation when Ca demand quickly rises to its highest. Enough Ca for maintenance and production from ration is typically very hard to obtain and they have to use also their body Ca reserve in bones to maintain normocalcemia. Ca metabolism is connected to bone metabolism and closely hormonally regulated. During bone resorption, inorganic phosphorus (iP) and magnesium (Mg) are also released, but their blood concentration is not hormonally regulated (2-4).
Biochemical markers of bone metabolism are substances in blood and / or urine that indicate the intensity of bone formation or resorption at the time of sample collection. During bone formation (anabolic activity), osteoblasts are more
194
J. Staric, M. Nemec, T. Zadnik
metabolically active. Byproducts of osteoblast activity are markers of bone formation, eg. bone specific enzyme bone alkaline phospahatase (BALP) in blood serum. During bone resorption (catabolic activity), osteocalsts are metabolically more active. Byproducts of osteoclast activity are markers of bone resorption, eg. C-terminal telopeptide crosslinks of collagen I (CTx) in blood serum. Markers of bone metabolism can indicate if bone metabolism is more anabolically, catabolically or in general more or less active (1, 5). In high yielding dairy cows we expect increased catabolic bone metabolism at the beginning of lactation when absorbable Ca demand suddenly increases from about 20 g to around 60 g or more per day because of colostrum and milk production concurrent with a relatively low dry matter (nutrient) intake (3, 6). Lactational osteoporosis, where around 13 % Ca can be lost from bones, can result as significant proportion of Ca is resorbed from bones at the beginning of lactation (7). This finding was confirmed also in a study conducted by Beighle (8) where cortical bone Ca concentration decreased as milk production increased. When milk production starts to decline body stores of Ca are replenished and bone metabolism is more anabolic (9). If these processes are not functioning properly bone disease and Ca metabolism disorders develop (hypocalcaemia and milk fever) which affect animal welfare, result in suboptimal production and other diseases in cattle (3). Very little is known about dynamics of biochemical markers of bone metabolism in dairy cattle during lactation and dry period.
The aim of this study is to investigate bone metabolism in mature dairy cows in intensive dairy production by measuring serum bone resorption marker CTx and bone formation marker BALP along with the classic mineral metabolism panel (Ca, iP, Mg and total alkaline phosphatase (ALP)) from dry period until peak lactation.
Material and methods
Herd and animals
The study was carried out in a heard of Holstein-Friesian cattle in intensive dairy production in farm setting. Clinically healthy skeletally mature cows (n=54) in appropriate body condition for their physiological period and at least in 4th lactation
(range 4th to 7th lactation; mean age 7 years, median age 7 years, range 5 to 10 years) were enrolled in the study. Cows were sampled from February until mid-April when all animals were exclusively kept indoors, in tie-stall type housing system on short stalls. Average annual milk yield of investigated cows in previous lactation was 8,463 kg (rage from 7,128 kg to 10,215 kg) milk with 3.7 % milk fat and 3.17 % crude milk protein. All the cows included in the study were in dry period for 50 ± 3 days.
Cows were divided in 5 groups according to their stage of lactation:
1.	35 - 25 days before calving (AP) or at early dry period, n = 10,
2.	10 - 1 day AP (end of close-up period -mammary gland is regenerating and secreting colostrums), n = 10.
3.	0 - 48 hours after calving (PP) (the most critical time for development of milk fever (3)), n = 10,
4.	10 - 20 days PP (direct influence of calving on bone metabolism is low; milk production is steeply rising), n = 10,
5.	peak lactation (35 - 55 days in milk), n = 14,
Ration
Cows were fed usual winter total mix ration (TMR), adapted to high productivity and their stage of lactation during the study, according to NRC (6) recommendations. The TMR was based on home produced forages: grass silage, maize silage, hay and straw. Anion salts were not added to feed in our study and forages were not treated in any way to reduce DCAD. DCAD of TMR was estimated to be in the range from +200 to +300 mEq/kg DM.
Composition of TMR is presented in table 1.
The ration for lactating cows was suitable for 30 kg milk yield per day. Fresh cows received about 15 kg DM of ration for peak lactation cows and hay ad libitum.
Blood sampling and analytical methods
Venous blood samples were collected in evacuated tubes (10 mL) without any additives (Venoject, plain silicone coated, Terumo Europe N.V., Belgium) from v. caudalis mediana according to the protocol between 9 and 11 a.m., to avoid daily fluctuations in analytes. Cows were
Bone metabolism markers and blood minerals concentration in dairy cattle during pregnancy and lactation
195
Table 1: Composition of TMR fed to cows during lactation and dry period
TMR ingredient	Peak lactation	Early dry period	Close-up dry period
Grass silage (33.1 % DM)	14 kg	14 kg	5 kg
Corn silage (39.2 % DM)	20 kg	7 kg	7 kg
Hay (85.3 % DM)	1 kg	/	3,5 kg
Straw	/	3 kg	/
Wheat	3 kg	/	1 kg
Commercially prepared concentrated feed (26% crude protein, 3% protected fats)	3 kg	/	1 kg
Commercially prepared energy feed (9 MJ NEL, 14% crude protein)	/	/	1kg
Rape skins	1 kg	0.5 kg	0.3 kg
Beet pulp	1 kg	/	0.3 kg
Soya bean skins	0.3 kg	/	0.1 kg
Mineral-vitamin supplement for lactating cows (Ca 18%, P 6%, Mg 4%, D3 80.000 IE/kg)	0.1 kg	/	/
Mineral-vitamin supplement for lactating cows (Ca 19%, P 4.5%, Mg 2.5%, D3 125.000 IE/kg)	0.1 kg	/	/
Mineral-vitamin supplement for dry cows (Ca 3%, P 8%, Mg 7%, D3 125.000 IE/kg)	/	0.1 kg	/
Grounded calcium carbonate	0.06 kg	/	/
NaHCO3	0.12 kg	/	/
Dry matter intake by animals	22 kg	11 kg	10,5 kg
Ca	165.69 g	49.99 g	58.74 g
P	86.14 g	39.54 g	33.70g
Mg	47.75g	25.53 g	43.28 g
sampled once or twice a week, during 14 sampling sessions. During this time at least 10 animals were randomly obtained for each group. Only one blood sample was taken from each animal. After blood clotting, samples were centrifuged at 3000 rpm for 10 minutes then supernatants were centrifuged again at 3000 rpm for 10 minutes at room temperature. Harvested blood serum was stored at -20° C until analyses.
Blood serum Ca, aP and Mg concentration and activity of total ALP were measured with automatized biochemical analyzer RX Daytona (Randox, Ireland) according to manufacturer's instructions. Blood serum BALP activity was measured using Alkphase-B kit (Metra Biosystems, USA) by enzyme imunoanalysis according to manufacturer's instructions on Immulite 2500 analyser (Siemens, Germany). The absorbance at the end of reaction was measured with optical reader Humareader (Human, Egypt) at 405 nm wave length. Cross reactivity of the test was validated for use in cattle (1). CTx
concentration in blood serum was measured by electrochemiluminiscent imunoanalysis ECLIA. The test was conducted using Elecysis 3 - CrossLaps kit on Elecys 1010 analyzer (Roche Diagnostics, USA) according to manufacturers' instructions.
Statistical analysis
Data were statistically analyzed using SPSS verson 15.0. software (SPSS, USA). Mean and standard deviation were calculated for measured parameters. Influence of physiological period on parameters was analyzed with analysis of variance (one-way AN OVA). All obtained values were previously normalized according to Box-Cox. When statistical differences were discovered between groups, they were ascertained with Tukey's algorithm of multiple comparisons. Person's correlations were calculated for all parameters. Statistical significance was set at P<0.05.
196
J. Staric, M. Nemec, T. Zadnik
Results
Descriptive statistics for Ca, iP, Mg, ALP, BALP, CTx and statistically significant differences according to stage of lactation (group) are presented in Table 2. Dynamics of investigated parameters from dry period until pick lactation are demonstrated in Graph 1 and 2.
Values of Ca and iP were statistically significantly lower in 3. group compared to other groups and under physiological range for adult cattle (reference blood serum Ca of adult dairy cattle is 2.2 - 2.5 mmol/L and iP 1.61 - 2.26 mmol/L (3)). All the animals had Mg within reference range for adult dairy cattle, > 0,82 mmol/L (3). The lowest values of BALP were measured in 1. group. The difference was statistically significant compared to all other groups. The highest values of CTx were measured in 4. group.
Statistically significant positive Pearson's correlations were found between total ALP and BALP (r=0.585, P<0.01) and also between Ca and iP (r=0.671, P<0.01) (Graph 1 and 2). Strong negative correlation was ascertained between Ca and BALP (r=-0.372, P<0.01), and between iP and ALP (r=-0.191 , P<0.05) / BALP (r=-0.352, P<0.01). Negative correlation between iP and Mg was close to significance (r=-0.162, P=0.08). Ca was also positively correlated with CTx but not statistically significanty (P>0.05). All the other correlations were statistically insignificant.
Discussion
Sampling methodology used in this study employed original approach compared to other studies in biochemical bone markers research, which achieved minimal changes in environmental conditions despite very long production cycle in cattle (ideally of 1 year, but usually much more than a year) in farm settings. It also includes different animals, sample more general population, physically comparable though in contrast to other studies that were monitoring the same animals through the lactation. This way we wanted to test the use of biochemical markers of bone metabolism in more applied clinically relevant settings that wanted to prove their dynamics in different groups of healthy cows in appropriate body condition.
The highest mean CTx concentration was established in the 4. group in our study. This
finding is in accordance with Holtenius and Ekelund
(9)	who report that CTx concentration in dairy cows was highest in the first week after calving and then decreased evenly over the next 33 weeks. Filipovic et al. (10) also observed the highest CTx values in 21 Holstein-Friesian cows 10 days after calving compared to 14 days before calving and 30 days after calving. Similarly reported Liesegang et al. (11) in a study performed in 30 Brown Swiss cows when they measured bone resorption marker ICTP. The highest CTx and ICTP concentrations first week after calving are in accordance with general finding that Ca resorption from bones is the most intensive during this period (3). The highest mineral demand of cows is from calving until peak lactation, what is demonstrated in more intense bone resorption, since enough Ca can not be provided from the ration alone in this period.
Our findings suggest that bone is minimally catabolically active (very low CTx), and still has high anabolic activity (relatively high BALP) during the dry period, which indicates that there is a net gain in mineral reserves in bone tissue. We believe that reserve gained during dry period is very important for maintenance of normocalcaemia at the beginning of next lactation. It is well known that peak production is followed by maximal consumation of dry matter in dairy cow by about 2 - 3 weeks (12). During this period the deficit of nutrients (including Ca) between those required for production of milk and those available from consumed feed has to be mobilized from body reserves (3).
Liesegang et al. (11) found out that blood osteocalcine (OCN), a bone formation marker, concentration markedly decreased after calving and then started to slowly rise until the second month of lactation when it reached a plateau, then slowly decreased until calving. Similar findings about OCN were reported by Holtenius and Ekelund (9) and Iwama et. al. (13). Filipovic et al.
(10)	measured the highest values of BALP 14 days before calving, but not statistically significantly higher than 10 days after calving. Our findings are not completely in agreement with findings of mentioned authors since we ascertained the highest BALP activity within 48h after calving and then in 4. and 2. group. This means that bone remodeling is very intensive around calving (both bone resorption and formation are very high). High activity of BALP PP shown in our study is negatively correlated with serum total Ca concentration
Bone metabolism markers and blood minerals concentration in dairy cattle during pregnancy and lactation
197
Table 2: Mean values and standard deviations of Ca, iP, Mg, ALP, BALP and CTx at each stage of lactation and statistical significance
Group	n	Ca (mmol/L)	iP (mmol/L)	Mg (mmol/L)	ALP (U/L)	BALP (U/L)	CTx (ng/L)
1	10	2.43 ± 0.123	2.22 ± 0.3334	0.97 ± 0.082	32.4 ± 5.923	11.64 ± 1.642'3'4,5	0.089 ± 0.04445
2	10	2.44 ± 0.093	2.04 ± 0.193	0.84 ± 0.05135	48.1 ± 7.41	16.29 ± 2.113	0.201 ± 0.13145
3	10	1.96 ± 0.271245	1.37 ± 0.301245	1.02 ± 0.1324	52.1 ± 10.71	21.75 ± 4.351.2.4.5	0.386 ± 0.13245
4	10	2.30 ± 0.1435	1.87 ± 0.1713	0.88 ± 0.105	41.9 ± 14.7	16.91 ± 3.1213	1.174 ± 0.582123
5	14	2.57 ± 0.1334	1.94 ± 0.233	1.05 ± 0.0624	44.1 ± 12.3	16.14 ± 4.0313	0.828 ± 0.35212'3
Legend: 1,2,3,4,5 - statistically significant differences for parameters between groups at P<0.05
2	3	4
Stigeof Licition
•Ca(nimol L) •iP (mmol/L} Mg(mmol L) "CTx (og/L)
Figure 1: Dynamics of investigated parameters from dry period until pick lactation
2	3	4
Stage of I a era ri on
■ALP (U/L) BALP (U/L)
Figure 2: Dynamics of ALP and BALP from dry period until pick lactation
198
J. Staric, M. Nemec, T. Zadnik
and indicates inappropriate response of bone metabolism to hypocalcaemia. The mechanism for maintaining normocalcaemia is likely overridden by other mechanisms, associated with calving in dairy cattle beside enormous Ca drain for milk production. Cows with milk fever had lower CTx and higher BALP than healthy cows in a study by Staric and Zadnik (14). Adding anionic salts to the ration would increase bone resorption (CTx) and the concentration of ionized calcium in blood (3). High BALP activity can be associated with bone metabolism that was unprepared to provide Ca for the steep increase in demand or responded inappropriately to hypocalcaemia. Filipovic et al. (10) ascertained statistically significant (P<0.001) negative correlation between estradiol and CTx. Estradiol reaches the highest values before calving (15). Anabolic and osteoprotective effect of estradiol on bone tissue is well known, which can significantly contribute to the development of periparturient hypocalcaemia in dairy cows (5, 9, 10, 16). Estradiol contributed probably to the highest mean BALP activity within 48 hours after calving in this study.
Total ALP correlates with BALP and can be used in assessing bone metabolism, provided that there is no liver pathology present.
Results of Ca and iP dynamics in our study were in accordance with results of other authors (17, 18, 19). Almost all cows experience a certain level of hypocalcaemia during the first days after calving in our study and in mentioned studies. It was suggested that this is physiological in high yielding cows due to the very abrupt rise in Ca demand for milk production. After few days the homeostatic mechanisms for Ca adapt to higher Ca and iP demand and maintain blood Ca and iP concentration within the normal range until the next calving (17, 18, 19).
Mean Mg concentration was within normal range for dairy cattle in all test groups in our study which confirms appropriate Mg supply. Mg dynamics resemble those of Bigras-Paulin and Tremblay (17) and Riond et al. (20). Higher mean Mg values were also ascertained in the 3. and 5. group in our study. Higher Mg concentration around calving is consequence of hypocalcaemia and high PTH, which stimulates Mg resorption in kidney tubules. High PTH concentration lowers Mg secretion in urine and thus elevates blood Mg concentration. PTH also stimulates iP excretion via kidney and salivary glands (3), which was the
reason for almost statistically significant negative correlation between Mg and iP in our study.
Further studies in bone metabolism are needed to evaluate and extend current knowledge particularly in bigger animal sample and in groups treated by different means that elevate blood Ca concentration around calving and influence bone metabolism, like anion salts.
Conclusion
Dynamics of biochemical markers of bone metabolism in groups of cows from early dry period until peak lactation were demonstrated. Results of the study indicate that bone tissue is the most catabolically active 10 to 20 days after calving and the most anabolically active during the dry period. Strong negative correlation (P<0.01) was established between BALP and minerals Ca and iP. Our results suggest that biochemical bone markers can be used as precalving tool for detection of cows that are at risk of having low blood Ca and iP after calving, which could be an important novelty in detection of cows at risk of milk fever. From the results of this study we can speculate that the dry period is important for filling up Ca reserves in bone tissue.
References
1.	Allen MJ. Biochemical markers of bone metabolism in animals: uses and limitations. Vet Clin Pathol 2003; 32: 101-13.
2.	Breves G, Schroder B. Comparative aspects of gastrointestinal phosphorus metabolism. Nutr Res Rev 1991; 4: 95-140.
3.	Goff JP. Pathophysiology of calcium and phosphorus disorders. Vet Clin North Am Food Anim Pract 2000; 16: 319-37.
4.	Martens H, Schweigel M. Pathophysiology of grass tetany and other hypomagnesemias: implications for clinical management. Vet Clin North Am Food Anim Pract 2000; 16: 339-68.
5.	Christenson RH. Biochemical markers of bone metabolism: an overview. Clin Biochem 1997; 30: 573-93.
6.	NRC. Nutrient requirements of dairy cattle, 7th revised edn. Washington: National Academy Press, 2001.
7.	Ellenberger HB, Newlander JA, Jones CH. Composition of the bodies of dairy cows. Vermont Agric Exp Stn Bull 1950; (558): 1-66.
Bone metabolism markers and blood minerals concentration in dairy cattle during pregnancy and lactation
199
8.	Beighle DE. The effect of gestation and lactation on bone calcium, phosphorus and magnesium in dairy cows. J S Afr Vet Assoc 1999; 70: 142-6.
9.	Holtenius K, Ekelund A. Biochemical markers of bone turnover in the dairy cow during lactation and the dry period. Res Vet Sci 2005; 78: 17-9.
10.	Filipovic N, Stojevic Z, Zdelar-Turk M, Kusec V. Plasma parathyroid hormone-related peptide and bone metabolism in periparturient dairy cows. Acta Vet Hun 2008; 56 (2): 235-44.
11.	Liesegang A, Eicher R, Sassi ML, et al. Biochemical markers of bone formation and resorption around parturition and during lactation in dairy cows with high and low standard milk yields. J Dairy Sci 2000; 83: 1773-81.
12.	Phillips CJC. Principles of cattle production. Wallingford: CABI Publishing, 2001: 31-3.
13.	Iwama Y, Kamiya M, Tanaka M, Shioya S. The change in dry matter intake, milk yield and bone turnover of primiparous cows as compared with multiparous cows during early lactation. Anim Sci J 2004; 75: 213-8.
14.	Staric J, Zadnik T. Biochemical markers of bone metabolism in dairy cows with milk fever. Acta Vet (Beogr) 2010; 60 (4): 401-10.
15.	Patel OV, Takenouchi N, Takahashi T, Hi-rako M, Sasaki N, Domeki I (1999). Plasma oes-trone and oestradiol concentrations throughout gestation in cattle: relationship to stage of gestation and fetal number. Res Vet Sci 66: 129-33.
16.	Kurosaki N, Yamato O, Sasamoto Y, et al. Clinico-pathological findings in peripartum dairy cows fed anion salts lowering the dietary cation-anion difference: involvement of serum inorganic phosphorus, chloride and plasma estrogen concentrations in milk fever. Jpn J Vet Res 2007; 55 (1): 3-12.
17.	Bigras-Poulin M, Tremblay A. An epidemi-ological study of calcium metabolism in non-pa-retic postparturient Holstein cows. Prev Vet Med 1998; 35: 195-207
18.	Ramberg CF Jr, Johnson EK, Fargo RD, Kronfeld DS. Calcium homeostasis in cows, with special reference to parturient hypocalcemia. Am J Physiol 1984; 246: R698-704.
19.	Horst RL, Goff JP, Reinhardt TA. Calcium and vitamin D metabolism in the dairy cow. J Dairy Sci 1994; 77: 1936-51.
20.	Riond JL, Kocabagli N, Spichiger UE, Wanner M. The concentration of ionized magnesium in serum during the periparturient period of non-paretic dairy cows. Vet Res Commun 1995; 19: 195-203.
200
J. Staric, M. Nemec, T. Zadnik
KAZALCI METABOLIZMA KOSTI IN KONCENTRACIJA MINERALOV V KRVI pRI KRAVAH MOLZNICAH MED presušitvijo IN LAKTACIJO
J. Starič, Nemec M, T. Zadnik
povzetek: Biokemijski kazalci metabolizma kosti so snovi v krvi in/ali urinu, ki kažejo kako intenzivno se kostnina izgrajuje oz. razgrajuje v času odvzema krvnih oz. urinskih vzorcev. Namen raziskave je ugotoviti gibanje celotnega kalcija (Ca), anorganskega fosfata (aP), magnezija (Mg), celotne alkalne fosfataze (ALP), kostno specifične alkalne fosfataze (BALP) kot biokemijskega kazalca izgrajevanja kostnine in C-terminalnih prečno povezanih telopeptidov kolagena I (CTx) kot biokemijskih kazalcev razgrajevanja kostnine v krvnem serumu odraslih krav molznic v času od presušitve do viška laktacije. V raziskavo je bilo vključenih 54 klinično zdravih črno-belih krav z visoko prirejo mleka (povprečno 8,463 kg v prejšnji laktaciji). Krave so bile razdeljene v 5 skupin glede na fazo laktacije: 1. približno 1 mesec do poroda (AP) oz. sredi presušitve (n = 10), 2. 10 do 1 dan AP (n = 10), 3. 0 do 48 ur po porodu (PP) (n = 10), 4. 10 do 20 dni PP (n = 10) in 5. višek laktacije (n = 14). Vrednosti Ca in aP so bile pri kravah v 3. skupini nižje kot pri tistih v ostalih skupinah (P<0,05). Višje vrednosti Mg smo izmerili pri kravah v 3. in 5. skupini glede na 2. in 4. (P<0,05). Najnižjo vrednost BALP smo izmerili v 1. skupini. Razlika je bila statistično značilna glede na ostale skupine (P<0,05). Najvišje vrednosti CTx so bile izmerjene v 4. in nato v 5. skupini. Statistično značilno so se razlikovale od vrednosti v 1., 2. in 3. skupini. Rezultati raziskave kažejo, da je kostno tkivo katabolično najbolj aktivno 10 - 20 dni PP, anabolično pa med presušitvijo. Ugotovljena je bila močna negativna korelacija (P<0,01) med BALP in rudninama Ca in aP.
Ključne besede: biokemijski kazalci; CTx; BALP; ALP; odrasle krave
Slov Vet Res 2012; 49 (4): 201-3
AUTHOR INDEX VOLUME 49, 2012
Ahačič K, see Kotnik T, Ahačič K,
Rostaher A, Bourdeau P................ 103
Akçay E, Kulaksiz R, Da§kin A, Çebi Ç, Tekin K. The effect of different dilution rates on post-thaw quality of ram semen frozen
in two different egg-yolk free extenders......97
Arsevska E, see Nikolovski G, Atanaskova Petrov E, Cokrevski S, Arsevska E,
Nikolovska G.........................79
Atanaskova Petrov E, see Nikolovski G, Atanaskova Petrov E, Cokrevski S,
Arsevska E, Nikolovska G................79
Barlič-Maganja D, see Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P, Jenčič V,
Barlič-Maganja D......................89
Bilandžic N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B, Končurat A, Šimič B, Rudan N. Content of five trace elements in different honey types from Koprivnica - Križevci
county............................. 167
Bilandžič N, Šimič B, Kmetič I. Effect of three-day ACTH administration on concentrations of cholesterol, cortisol, progesterone, testostetrone and LH
in the boars......................... 123
Blagus R, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T.. . . 133 Bourdeau P, see Kotnik T, Ahačič K,
Rostaher A, Bourdeau P................ 103
Çebi Ç, see Akçay E, Kulaksiz R, Daçkin A,
Çebi Ç, Tekin K........................97
Chakeri A, see Rahimi E, Chakeri A,
Esmizadeh K......................... 117
Cokrevski S, see Nikolovski G, Atanaskova Petrov E, Cokrevski S, Arsevska E,
Nikolovska G.........................79
Cvetkovikj A, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A.................5
Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K, Dzadzovski I, Cvetkovikj A. No evidence of avian influenza viruses in backyard
poultry fram risk areas in R. Macedonia (Virological
and molecular surveillance 2009)............5
Cvijanovic G, see Lenhardt M, Jaric I, Cvijanovic G, Kolarevic J, Gačic Z,
Smederevac-Lalic M, Višnjic-Jeftic Ž....... 177
Čebulj-Kadunc N, see Snoj T, Čebulj-Kadunc N, Nemec Svete A, Kobal S... . 27 Čebulj-Kadunc N,see Čeh K, Ježek D,
Žužek MC, Čebulj-Kadunc N, Majdič G......41
Čeh K, Ježek D, Žužek MC, Čebulj-Kadunc N, Majdič G. Effects of organophosphate Chlormephos on development and function
of testes and brain.....................41
Da§kin A, see Ak^ay E, Kulaksiz R,
Da§kin A, Qebi Q, Tekin K................97
Dodovski A, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A................5
Dovč A, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D,
Krapež U, Dovč A..................... 185
Dzadzovski I, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A.................5
Dokič M, see Bilandžic N, Dokič M, Sedak M, Varenina I, Solomun Kolanovic B, Končurat A,
Šimic B, Rudan N..................... 167
Esmizadeh K, see Rahimi E, Chakeri A,
Esmizadeh K......................... 117
Farzan R, Rahimi E, Momtaz H. Virulence properties of Shiga Toxin-Producing Escherichia coli isolated from Iranian raw milk and dairy
products............................ 159
Felipe M, see Satué K, Felipe M, Mota J,
Muñoz A.............................35
Gačic Z, see Lenhardt M, Jaric I, Cvijanovic G, Kolarevic J, Gačic Z, Smederevac-Lalic M,
Višnjic-Jeftic Ž....................... 177
Golob M, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T.. . . 133
Gombač M, see Žižek S, Gombač M, Pogačnik M.......................... 149
202
Author Index Volume 49, 2012
Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T. Effect of treatment with TRIS-EDTA / chlorhexidine topical solution on canine Pseudomonas aeruginosa otitis externa with or without concomitant treatment with
oral fluoroquinolones.................. 133
Hostnik P, see Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P, Jenčič V, Barlič-
Maganja D...........................89
Jamnikar Ciglenečki U, see Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P,
Jenčič V, Barlič-Maganja D...............89
Janicki Z, Slavica A, Severin K, Konjevic D. The preservation of triclabendazole in baits for free-living red deer (Cervus elaphus L.) during
the pre-consummation period.............73
Jaric I, see Lenhardt M, Jaric I, Cvijanovic G, Kolarevic J, Gačic Z, Smederevac-Lalic M,
Višnjic-Jeftic Ž....................... 177
JaSkowski JM, see Olechnowicz J,
JaSkowski JM......................... 13
Jenčič V, see Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P, Jenčič V, Barlič-
Maganja D...........................89
Ježek D, see Čeh K, Ježek D, Žužek MC,
Čebulj-Kadunc N, Majdič G...............41
Keše D, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D,
Krapež U, Dovč A..................... 185
Klinc P, Rath D. Improvement of sperm sorting efficiency and fertilizing capacity employing two variations of a new bull semen
extender (Sexcess®)....................51
Kmetič I, see Bilandžic N, Šimic B,
Kmetič 1............................ 123
Kobal S, see Snoj T, Čebulj-Kadunc N,
Nemec Svete A, Kobal S.................27
Kolarevic J, see Lenhardt M, Jaric I, Cvijanovic G, Kolarevic J, Gačic Z,
Smederevac-Lalic M, Višnjič-Jeftič Ž....... 177
Končurat A, see Bilandžic N, Dokic M, Sedak M, Varenina I, Solomun Kolanovic B, Končurat A,
Šimic B, Rudan N..................... 167
Konjevic D, see Janicki Z, Slavica A,
Severin K, Konjevic D...................73
Kotnik T, Ahačič K, Rostaher A, Bourdeau P. Canine leishmaniosis (Leishmania infantum) in Slovenia: A questionnarie-based survey. ... 103
Kotnik T, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T.. . . 133 Krapež U, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D, Krapež
U, Dovč A........................... 185
Krstevski K, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A.................5
Kulaksiz R, see Ak^ay E, Kulaksiz R,
Da§kin A, Qebi Q, Tekin K................97
Kušar D, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T ... 133
Laroucau K, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M,
Keše D, Krapež U, Dovč A............... 185
Lenhardt M, Jaric I, Cvijanovic G, Kolarevic J, Gačic Z, Smederevac-Lalic M, Višnjic-Jeftic Ž. Comparison of morphological characters between wild and cultured sterlet
(Acipenser ruthenus L.)................. 177
Majdič G, see Čeh K, Ježek D, Žužek MC,
Čebulj-Kadunc N, Majdič G...............41
Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D, Krapež U, Dovč A. Detection of Chlamydia psittaci in cage birds in Slovenia by
Real-Time PCR....................... 185
Mesarič M, see Simčič M, Mesarič M,
Potočnik K.......................... 141
Mitrov D, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A................5
Momtaz H, see Farzan R, Rahimi E,
Momtaz H........................... 159
Mota J, see Satué K, Felipe M, Mota J,
Muñoz A.............................35
Mrenoski S, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A.................5
Muñoz, see A Satué K, Felipe M, Mota J,
Muñoz A.............................35
Naletoski I, see Cvetkovikj I, Dodovski A, Naletoski I, Mrenoski S, Mitrov D, Krstevski K,
Dzadzovski I, Cvetkovikj A................5
Nemec M, see Starič J, Nemec M,
Zadnik T............................ 193
Nemec Svete A, see Snoj T, Čebulj-Kadunc N,
Nemec Svete A, Kobal S..................27
Nikolovska G, see Nikolovski G, Atanaskova Petrov E, Cokrevski S, Arsevska E,
Nikolovska G.........................79
Nikolovski G, Atanaskova Petrov E, Cokrevski S, Arsevska E, Nikolovska G. Bovine tuberculosis in cattle during the implementation of official control measures in Republic of Macedonia for the period 2007-2009................... 79
Author Index Volume 49, 2012
203
Olechnowicz J, Jaskowski JM. Somatic cell counts and total bacterial count in bulk tank
milk of small ruminants.................13
Pelin Can O. The efect of thyme oil on the shelf life of chicken balls during storage
period.............................. 19
Pogačnik M, see Žižek S, Gombač M,
Pogačnik M.......................... 149
Potočnik K see Simčič M, Mesarič M,
Potočnik K.......................... 141
Račnik J, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J,
Zadravec M, Keše D, Krapež U, Dovč A.....185
Rahimi E, Chakeri A, Esmizadeh K. Prevalence of Campylobacter species in fecal
samples from cats and dogs in Iran........ 117
Rahimi E, see Farzan R, Rahimi E,
Momtaz H........................... 159
Rath D, see Klinc P, Rath D............51
Richterová Z, Svobodová Z. Pyrethroids
influence on fish.......................63
Rihtarič D, see Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P, Jenčič V,
Barlič-Maganja D......................89
Rostaher A, see Kotnik T, Ahačič K,
Rostaher A, Bourdeau P................ 103
Rudan N, see Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B,
Končurat A, Šimič B, Rudan N........... 167
Satué K, Felipe M, Mota J, Muñoz A. Blood leukocytes in Carthusian mares with endometriosis or endometritis in comparison
with healthy mares.....................35
Sedak M, see Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B,
Končurat A, Šimič B, Rudan N........... 167
Severin K, see Janicki Z, Slavica A,
Severin K, Konjevič D...................73
Simčič M, Mesarič M, Potočnik K. Analysis of conformation traits of the Posavje horse in
Slovenia............................ 141
Slavec B, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D,
Krapež U, Dovč A..................... 185
Slavica A, see Janicki Z, Slavica A, Severin K,
Konjevič D...........................73
Smederevac-Lalič M, see Lenhardt M, Jarič I, Cvijanovič G, Kolarevič J, Gačič Z, Smederevac-Lalič M, Višnjič-Jeftič Ž................. 177
Snoj T, Čebulj-Kadunc N, Nemec Svete A, Kobal S. Determination of sex hormones in rat hair after administration of testosterone
proprionate and estradiol valerate..........27
Solomun Kolanovič B, see Bilandžic N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B,
Končurat A, Šimič B, Rudan N........... 167
Starič J, Nemec M, Zadnik T. Bone metabolism markers and blood minerals concentration in dairy cattle during pregnancy
and lactation........................ 193
Svobodova Z, see Richterova Z,
Svobodova Z..........................63
Šimič B, see Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B, Končurat A,
Šimič B, Rudan N..................... 167
Šimič B, see Bilandžič N, Šimič B,
Kmetič 1............................ 123
Tekin K, see Ak^ay E, Kulaksiz R, Da§kin A,
Qebi g, Tekin K........................97
Toplak I, Rihtarič D, Jamnikar Ciglenečki U, Hostnik P, Jenčič V, Barlič-Maganja D. Detection of six honeybee viruses in clinically affected colonies of carniolan gray bee
(Apis mellifera carnica)..................89
Varenina I, see Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B, Končurat A,
Šimič B, Rudan N..................... 167
Vengušt M, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T.. . . 133
Vorimore F, see Laroucau K Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J,
Zadravec M, Keše D, Krapež U, Dovč A.....185
Zadnik T, see Starič J, Nemec M,
Zadnik T............................ 193
Zadravec M, see Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M,
Keše D, Krapež U, Dovč A............... 185
Zdovc I, see Hosseini J, Zdovc I, Golob M, Blagus R, Kušar D, Vengušt M, Kotnik T.. . . 133
Žižek S, Gombač M, Pogačnik M. Occurence and effects of the bivalve-inhabiting hydroid Eugymnanthea inquilina in cultured Mediterranean mussels (Mytilus galloprovincialis)
in Slovenia.......................... 149
Žužek MC, see Čeh K, Ježek D, Žužek MC, Čebulj-Kadunc N, Majdič G...............41
©MD Svetovanje
Finančne storitve www.vaseffnance.si
M
Izterjava dolgov in
upravljanje s terjatvami ^
Namen ustanovitve in delovanja podjetja MD svetovanje d.o. o. je pomagati podjetjem pri poslovanju z nudenjem produktov in storitev, ki ne spadajo v osnovno dejavnost podjetja. To dosegamo s celovito ponudbo predstavljenih produktov in storitev.
Zato smo naš moto Skupaj bomo uspešnejši! nadgradili še z motom in sloganom Vse za Vas na enem mestu!
Vizija
Postati vodilna neodvisna družba s celotno ponudbo za podjetja in posameznike na enem mestu in na ta način prihraniti podjetjem in posameznikom čas in denar.
Vse to nam bo uspelo s trdim delom in kakovostno izvedbo storitev in zaupanih nam nalog, predvsem če bomo sledili naslednjim načelom:
zagotavljanje celovite ponudbe, vedno delo v dobro stranke, strokoven razvoj, organizacijsko izpopolnjevanje,
zagotavljanje visoke stopnje kakovosti storitev z upoštevanjem predlogov naših strank,
ustvarjanje novih delovnih mest,
povečanje produktivnosti in dobičkonosnosti,
visoko motiviran in usposobljen kader s primernim vodenjem, kar
zagotavlja
kakovost izvajanja storitev,
postati vodilno podjetje, ki ponuja rešitve, ki podjetju omogočajo da si na enem
mestu zagotovi vse dejavnosti, ki ne spadajo v njegovo osnovno dejavnost.
Prednosti poslovanja z nami:
vse svoje potrebe in vizije uresničite s klicem na eno telefonsko številko,
razbremenite se ukvarjanja z obrobnimi zadevami, posvetite se svojemu strokovnemu delu, informacijska tehnologija, prilagodljivost, zanesljivost,
povečanje dobičkonosnosti, zmanjšanje stroškov dela,
MD svetovanje, poizvedbe in storitve d.o.o. Dunajska cesta 421, 1231 Ljubljana - Črnuče
PE Ljubljana-Vič Cesta dveh cesarjev 403, 1102 Ljubljana
01 / 620-47-01 01 / 620-47-04 041 /614-090
www. mdsvetovanje. eu
Zakaj M D Svetovanje d.o.o,
visoka profesionalizacija, visoka strokovnost, visoka uspešnost, konkurenčne cene, vse na enem mestu.
i
SLOVENIAN VETERINARY RESEARCH SLOVENSKI VETERINARSKI ZBORNIK
Slov Vet Res 2012; 49 (4)
Original Scientific Articles
Farzan R, Rahimi E, Momtaz H. Virulence properties of Shiga Toxin-Producing Escherichia coliisolated
from Iranian raw milk and dairy products.............................................................159
Bilandžič N, Dokič M, Sedak M, Varenina I, Solomun Kolanovič B, Končurat A, Šimič B, Rudan N. Content of five trace
elements in different honey types from Koprivnica - Križevci county........................................167
Lenhardt M, Jarič I, Cvijanovič G, Kolarevič J, Gačič Z, Smederevac-Lalič M, Višnjič-Jeftič Ž. Comparison
of morphological characters between wild and cultured sterlet (Acipenserruthenus L.).......................177
Marhold C, Slavec B, Laroucau K, Vorimore F, Račnik J, Zadravec M, Keše D, Krapež U, Dovč A. Detection
of Chlamydia psittaciin cage birds in Slovenia by Real-Time PCR.........................................185
Starič J, Nemec M, Zadnik T. Bone metabolism markers and blood minerals concentration in dairy cattle during
pregnancy and lactation..........................................................................193
Author Index Volume 49, 2012........................................................................... 201